vzkernel-2.6.32-042stab106.2$>op9WJL>=-%?-d   0,0@ F`w}> -  A  UL  |     h   E(EF GCGGH(I78I@ 9Qh : >,1?,1@,1F,1G,2 H,Yd I, X,Y,\,p ], ^-)b-d-ge-lf-rl-tz--- Cvzkernel2.6.32042stab106.2The Linux kernelThe kernel package contains the Linux kernel (vmlinuz), the core of any Linux operating system. The kernel handles the basic functions of the operating system: memory allocation, process allocation, device input and output, etc.UIkbuild-rh6-x32ןParallels, Inc.GPLv2System Environment/Kernelhttp://www.kernel.org/linuxi686 if [ `uname -i` == "x86_64" -o `uname -i` == "i386" ] && [ -f /etc/sysconfig/kernel ]; then /bin/sed -r -i -e 's/^DEFAULTKERNEL=kernel-smp$/DEFAULTKERNEL=kernel/' /etc/sysconfig/kernel || exit $? fi if grep --silent '^hwcap 0 nosegneg$' /etc/ld.so.conf.d/kernel-*.conf 2> /dev/null; then sed -i '/^hwcap 0 nosegneg$/ s/0/1/' /etc/ld.so.conf.d/kernel-*.conf fi if [ -x /sbin/new-kernel-pkg ]; then if [ -f /etc/virtuozzo-release ]; then KLABEL="Parallels"; else KLABEL="OpenVZ"; fi /sbin/new-kernel-pkg --package kernel --install 2.6.32-042stab106.2 --banner="$KLABEL" || exit $? elif [ -x /usr/sbin/update-initramfs ]; then /usr/sbin/update-initramfs -c -t -k 2.6.32-042stab106.2 || exit $? if [ -x /usr/sbin/update-grub ]; then /usr/sbin/update-grub || exit $? fi fiif [ -x /sbin/new-kernel-pkg ]; then /sbin/new-kernel-pkg --rminitrd --rmmoddep --remove 2.6.32-042stab106.2 || exit $? elif [ -x /usr/sbin/update-initramfs ]; then /usr/sbin/update-initramfs -d -t -k 2.6.32-042stab106.2 || exit $? rm -f /lib/modules/2.6.32-042stab106.2/modules.* fi if [ -x /sbin/weak-modules ] then /sbin/weak-modules --remove-kernel 2.6.32-042stab106.2 || exit $? fiif [ ! -x /sbin/new-kernel-pkg -a -x /usr/sbin/update-grub ]; then /usr/sbin/update-grub || exit $? fi-C@!P= D, 7WHT$>hGt 0nt[`<!d/ ")4+&4]Q,+03?\ Y<TT+I) Tt P"x$8BN+K`=G#xc*"$1@@;F#'L(<C$".(#)E)!0B!PtO2$($P. .l=l:/@;|F/`=R$@&|;x:'8.h)T@(@/N 0*pXo |^BrP&Np95,7@kP1.l01p$!ل @* 805T3k<8 /R/L;@z3X#T``#PB=2lVu3dB`%p'hnt)0 $HL&0U$("P:)48a| )!",S\\[`?`EH5&txs]L  MX +V`d"Y(>XJht|,#p"QI5[W(/ q ZP_ldK/6D0xH ~<Yp\N @`+BL,8{  14@4,6dhK:pqh]8`9\! - 6HC8<-5TM,H8OC> 1%hNb[ z@v X.XI#)505h8X5 S0pTD4#<$<$TN$,1>p(4%d:p`!p<"p8kPh~(S,R4˜`tjp_Pό><""#H<OT60%|5p{D;Bp5 T3"@p& [/P-"4*(d`#\h $+ @P\D$tE8CHgdQ|3$b&Lf4g|PV<j?$K|=/<od#`TnPp}P&"8# @ \$ (+} 5,^H'TjH#L= bLLrHX^`DCTX#X0L<k@%\@ 5l!`5G;<&<OJqhE0+?M\XO#}7'lO0+/402TNd(.O0'|</8(d?g`g%9B%|64f,^'dZ@54 *h+RKh/HJ_>L`XH3, "4`%$L-?$d+$B*x.|+42@>@&L3'('x4(*&h6x $$(>PH3 0 "`" (4lixS\"DF(yl;6[< `kx$YPT%t\d H < \ d , L t h H 4 P l  d p d T  \  $  t 0  h l 4  de(q,Uu0<0ݜSLt 7L\> D<` k<Hc\x_z5DՔ $; F-%"&L!<H34)7,.DJd'?E\ .,6"P">&D!U@=\@,|<+|\18H4+84)4@h ,TX686 L40<9QLr4 0k$!$n(DX`)H+ ;Td?/$U4!Xv<Eo U`Wl?8 PaK`DjP` t 4]ox)3T1)$20>\zx3!,130HG`K k@.yf T:?st Ip< t4<P,*8>PP, DqfX|\'8kQ`Tm`|e$P$hdH@C t<=8j0#EAb0Q5sH](|8 "@h< <'x5PUX`lXvh!xF.{@.~pHzdx`cD~T?r 0b@H0<q\@7(@ \5|?`DR<X&',,$tA_0%$+ G/ s\LiRs$P=. '8XAMX*  @8?Ґ/OҰ_pLh]dZL9iV'#+"!hIfUTf"eL,T%p'-oHo@&$t6* + @H*d68DHapl(=x_VP-DY-&H0/,H"83-PM @&+|'(@9X"$#KT&)&P1*p9\2|#P7=,#&(0)x*;tphJHQ8p@ 0@(U\$7 2$;$WS<`{H.pOL[ot+ .P|8 `g(@Jl.@)52l%L/<90@,8x'$,&4'4@<!0''|,P'(,P;*#),x3ט`L4paA 2A/<Y}4S_1L@O|xxx`xHTXDxxxtttt\\  @St"l'x@:42(L,%(4 l @ (j#0,N3@.$4Eqt(@m4|\wr ` lX<4 p `|'h\48\W(1\bl\ el$<PD#P*:|EMAD7pK5,p*@|\|58 T`4@,LEP{|8L$hXD)3  `HPx<<HPhThd((T (7N-$ ! 4 @,`:JK' \-'(yD~<4t'l %X h   \z8 $ J(-TgJh20EX(i$t!|=UGGUGFUGDUGDUGDUG>UG>UG>UG>UGEUGDUGDUG?UG?UGFUGFUGFUGFUGFUGFUGFUGFUGEUGEUGEUGEUGBUGBUGBUG@UGAUGAUG@UGAUGBUGAUGAUG@UGAUGAUGAUG@UG?UGBUG@UG@UG@UGBUGAUG@UGAUGAUGAUGAUGAUGAUGAUGBUG@UGBUG@UGAUGBUGAUG@UGBUG@UG?UG?UG@UG@UGBUGBUGCUG>UG>UG>UGCUGDUG>UGFUG?UGFUG>UGCUG>UG?UG?UG>UG>UG?UGGUG?UG>UGCUGCUGCUGCUGCUGCUGGUGGUG=UGCUGGUGGUGGUGEUGGUGGUG>UGFUGDUGDUGGUGDUGDUGFUGFUGEUGEUGEUGDUGEUGDUG>UGCUGEUG=UGCUGEUGDUBtUGUGUGUGUGUGUGUGUBtUG+UG+UG+UG+UG+UG+UG+UG+UG+UG+UG*UG+UG*UG*UG*UG+UG*UG+UG*UG*UFUFUFUFUFUFUFUFUFUFUFUFUFUFUFUFUFUBuUGqUGqUGqUGqUGqUGqUGqUGqUGqUGqUGqUGqUGqUGqUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGkUGiUGkUGRUGWUG\UG]UG\UGXUGNUGNUG[UG[UGSUGSUGSUG\UGhUGhUGQUGQUG]UG\UG\UGgUGgUGZUGZUGZUGZUGZUGZUGZUGZUGZUGZUGZUGjUG]UG]UG]UG[UG\UGRUGRUGWUGUUGRUGQUGXUGXUGXUGXUG[UG[UGiUGSUGXUG]UG]UGSUGSUG[UG[UGkUGkUGRUGWUGWUGhUGhUG]UGZUGZUGRUGRUGhUGhUGRUGOUGWUG]UG\UGUUGTUGUUBvUGkUGkUGiUGiUGXUGgUGZUGkUGkUGkUGQUGOUGiUGiUGSUGRUGSUGSUGSUGSUGSUGSUGSUGOUGVUGVUGVUGVUGVUGVUGUUGVUGVUGVUGVUGVUGVUGVUGVUGjUGUUG\UGOUGUUGjUGOUGUUGkUGjUGjUG]UG]UGjUGjUGkUGQUGiUGiUGXUGQUG\UGiUGOUGTUGRUG[UGgUGQUGXUG[UG[UGgUGgUGUUGPUGPUGPUGPUGPUGPUGPUGPUG]UGQUGZUGYUGYUGYUGYUGYUGXUGYUGYUGYUGZUGYUGYUGYUGZUGZUGYUGZUGZUGYUGYUGYUGYUGjUGiUGWUG]UGUUGUUGOUGOUGZUGWUGWUGTUGTUGSUGSUGTUGTUGTUBvUGQUGPUGQUGPUGeUG_UGaUGaUGeUG`UG`UG_UG_UGaUG`UG`UG`UGaUG`UG`UGaUGdUG]UGbUGbUG^UG^UBwUGcUGcUGcUGcUGbUGbUGbUGbUGbUG_UG^UG_UG^UGdUGdUGdUGdUGeUGeUGeUGeUGdUGdUGeUGeUGeUGeUGeUGaUGaUGaUGaUGaUG_UG_UG_UG_UG_UG_UG_UG_UGcUGcUGbUGcUGeUGfUGfUGfUGfUGfUGfUGfUGfUGfUGfUGfUGfUGfUBwUGdUGdUGcUGcUBwUGgUGgUGgUGgUGgUGgUGgUG]UGaUG^UG^UGhUG"UG"UG"UG"UG"UBwUG"UG"UG"UG"UG"UBwUG"UG"UFUFUFUFUFUBwUGrUGqUGrUGrUGrUGrUGqUGrUGrUGrUGrUGrUGrUGrUGrUGrUGrUGrUGrUGUGUGUGUGUFUFUFUFUG,UG,UG,UG,UG,UG,UG,UG,UG,UG,UG,UG,UG,UG+UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG UG UG UG UG UGUG UG UG UGUGUGUGUGUGUG UG UG UGUGUGUGUGUGUGUGUGUGUGUG UG UG UG UG UGUGUG UGUG UG UGUGUGUGUG UG UGUG UGUGUG UGUGUG UG UG UG UGUGUG UG UGUGUG UG UG UG UG UG UG UG UG UG UG UG UG UG UGUG UG UG UGUG UG UG UGUG UG UGUG UGUG UGUGUG UG UGUGUGUGUFUFUBwUGUGUG#UG#UG#UG#UG#UG#UG#UG#UG#UGUGUGUGUGUGUGUGUGUBxUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUFUFUFUFUFUFUFUFUFUFUFUFUFUFUG!UG!UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG!UG!UG!UG!UG!UG UG!UGUG!UG!UG UG UG UG!UG!UG!UG UG UG UG UG UG UG UG UG UG UGsUGsUGsUGsUG~UG~UG~UG}UG}UGyUGzUGzUGzUG{UG{UGzUGzUGUGUG~UG~UG}UG}UGUGUGUGUGUGUGUGUG{UG{UG~UG~UG~UGUGUGyUGyUG~UG~UGyUGyUG{UG{UGzUG|UG|UG|UGzUGzUG}UG}UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUBxUG~UG~UG~UG~UG~UG{UG{UGyUGyUGUGUByUGyUGxUGyUGxUGxUGxUGxUGxUGxUGxUGxUFUFUFUFUFUFUFUFUFUFUFUFUFUFUFUFUFUFUBzUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUBzUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUBUBUBUBUBaUBUBUHEUHEUHEUBf34bb48e4323bd5fc1c06993726313ac9e5f4c5cc06b2a4be13ede39307dcd231faa10d7a11938f55ceaafe712d435878f4e33f3dc3e414ff94e5fb6905cba8cec9c5086a0d8836462c4759ae6cadc134ff57c4bca402094166ee6e0a76cb86c3c6eccf8f1c6c90eaf3eb486cc8af8a3fefb19113127ba8845d1f0982b87e261e7e527aceac346909163bd6632bb710d197408427936492e53719826251e1481ee4f7a06b68db6fe5c41f72f7892aad6e195c109d655b7a482de3031fd9cf8191c9892265ff889f5c87bae3294514cbfa1c36babb6af9b2610ffb516282a74c33b035dead8226deb3dba6a282e21ae10b7d01bd80980201aae5ba3d760c1370c5a1e47741fdf61ab1752c1d0782841805729cd457f730564630ef41daf5c6e9805dd2f7b4e11cba8c2c9ec3183adecf13757df51d9093e146ffee2b4e362129b8967b368a2a5ac02229523967d0391db7fb3d65d2f63d312aea873f4c828e1123505be8a4f7ff14d03597b4ed5afc57019b97610ec4e31ab89cee38669ffc6b45596b88277898dd99a35a43999051d5f400cbe799206211b9c38330c7563d270f6165916bf85a6d2c89c857b69daccbed156f16e6fe060b7b4d6a6b124556e13be7273b4e35ce33d3875d3329f43ec5414db5fd3ccf3163985b5f7f6ba909d39a8ccaaff6aa0a0c7e4ad18d17829eee7412328a0b4adf35af71fd07f61c93bd38f75a38fa7e8929b2482a1dc4f8859e975b3beff414eefbbf954d95005998c92ded000453ded6da5b5e9c2990828767bd13afdbfd21aa83d6ab375eeb867f0246001fadb245918fc7f640cf699ee0884595b6c017abe57a0b630c2fea3e25cb7eee60aaed78b664410e72687f63a75bf90422c61a4cad7b9f409b3680afc77d67c0e682a56adc9617e9a71f4c20384c820be5114ee51fac370d52c1085a6875dd5e4a282f9ecafabfc0250434b9f80d03ed03f46ac005f6a4f2c50dc7703d11edd5de6973fa670801a9fe88a8471090325b1b56094a2e5ef42c0579881fdf100b4dfac35a90f1410087f31f49db4b8bd49ea174ed0f1fdf1a034e986ac644ffdd83a842a12c8ac7643ad8351c715c147e925e7ec2bc69cd285e92068cf7a03dc720f92642c461f8b61cb33dacc28b788658b37c6e98e639e15ed14fe2ab0c70f6db03197d1b2eb2407adbc8c3dc11bd46a0d773539b501b1b1a53a134450613b0a0a5fb419d7deb3b6e8fafb02313308a0659533a98fadd3fbcb462f6eba424b73d2b36101ee6afb760556e63961054290c198e5166359d020f5ace8ab6e6a62d2606c5ae9b89d2ca2484e757acd01e2a16d963541074df89ed0edc37788767667acf0b32c16e0d4588bbee8fb00949c3fc749d1a729b0c0ec7ded1f39de462953611c2865f6b9c5b89e007cbf1fd41ca4adf5e47daf3b4468244d644137cbe1730cc2f2849523c4900459da47aa11d96a1bf010f67d0987a13400c636b59ea6f6c5b5aa583c2f0af977c70c8c93e96f4a784e58e7c6e740b8124d44f912c074a4f99f36972ec57e649ec3fea07f2875eddeb46aa35c0cae24d5bfb8bf5b41c6da1231f9f962f9479fc577dac863e0b17e8d3d46f880f07eed8fd1cdaed2b8d0cbe3c57be0037aa71d4a2a1e46bcea790fce6e8e2ca800b8e0f7b6e64f543985e4c2e8897031ed48b2bdd091f952aadca1520836f96c7310ec79c33a0417a587102ac47f60cabca0c18b27962bb6f2131d7d198cb1e22c8101f44d9be57987971397acf020df0ce230429535d9dade1d2ae418dade58005cd4f099c3a812ca4df6b6a9531cbabb33b815d6d6a63bb47c6a35f8266210523d86f55a76a129c5647be4544c1e86175c6e421cbddad6b9a7f0c1b3c124936c5e395570c5aeee53bcd2bdef35df0ecd61c1d4c551f12bf02bf413ab80d0ba5e2d6f4c61648ceb97c5134a1d1c07c5596481a50c11ffaa269ce904bea5b13ddc1e29f3cb2a382b515343afaec9eb522a322c183b4a86e0eedbc7ac67d532b6bb8d57e290b0518df17918b39ce0e0836acbd80109cefec0cb1d6f4cadd7aae8b001086badb8c1514b737a2dba0eeb3309efe102a0ccc9d0c3ff652f37ce3028bf0f24e37908f24ee18e87d04449d1287a2454c28cb09647c4d1b96c9d1094a59ef2d2fc9b06b011bf127e264b9437e25cced6eae1f7561693444858f547d75b586b64f47853894d4ed1120839a14a5bc8c080dbe6c64c2da2194aa326a9a051a45cbcbe1b1716f094b50cb069f1d1abc96f031b7cca397924b0f618bf19ee3ff2f5ff46c34fead517ae0957ceafe2ee463ffd446cc1dea87c86b02ac9278bec6482f2524585a6f5385e362be78f86843573cef1f1673242f8cdc876320624819cb0cb3c58dd970006c5a53c609f39096d3b8927b0f7e3a8a86d9d749eaf5dc56f27a84733d8ef6db6d8f6bb521a7ced097e135661ec79b36fb3f45facee179cfa8315bd608f192c735e5d02360918b9275189eea0157287ecae7e380a407c9f4fca3d3a7a35852e5ce4e12ef9e334d2f4bed5ef602be6155961e662d11ba3629f1de20a05ad05686cc23d71f48cb85de4f9c88952b9875fb94772b423087adadc28d5cfa266e81656d9ff199b9d4282e6a4a07b796d3db1076ec551227e1adb5d70db2f50ebc9c3f602929cd68931771bc3e9dd663e55214c89196ce95a55c373d5bb5318e3c939720de700ffc80baa6626e3771f19656d5d24fad34ebf670aa5327575b3055574c88b38ab3a50d41e9843869997e79d0ff4c140ec2deb6a00ae2a403580353ff2849b05bfa4da68a4a481541d71cf21548b8b5451e2c426d8166c4983c08b905e9ba5de4302036fc0e28b43b951d19fe6165f6060136774951072e845eef3662fb28b195313c2f92b6b3f2e462852b2cbfef384a964fcbbf480ba0bf5320e5fa7ecf98eb0cbdb8a2d4c3d4663cb822f854f71ecffa46205cf1255491dfb9592cec13621f2dc53615c6ae587657df362e68ae395db8116f85513173701aae42aa3f7c974e07237410f79926edc68d41a83ced88b6b79b390360111d56182ebb0316419af785a9a5ccbdb30cdbbdb71ddc82f4d4f5d5d12cc4861aad86931424fa684048332dd632ac0ea6115394150b9e9955006934ac3128bbc405adfdb6ae8804684769ed909219ba6a708181916566821e4b8520c639da5884af86909c886aedb28488ac7debffe6e31b2fadfe922eda3d8eae2c50ce107fba7206f46534987f87136687910b460f1f16648bfa5ccb70322eb7a3ad98ded0c9477642fdb385e3680d4b1bf3df52c1e9314f5896d21629a119a5d88750a4366655fb3a949599dcdd2cc275bc250c4c75e98f21c4466f3252162646157bf30a1dcbc66f51677ff813abe16efae0e48602659b3480beebee2b15e6dc7b38b8987391d48cc6df69aaf39dfdbac6bcff6e51adab0c5c5cb3b1167333041ea7818444d98ca145555541222c7e75e3f8ca4480b05a1c528acdf297a4b43d8e3a0153e2ae5987f0d3d162027f2955121efb9ac134baf4e86b0ceb72e48647b66c58229e34dcc5f42b48b14e340303cbe3aa4420de0e56ea4ad5572fa63b6bf7f3a9c833a35a46ebef8535704c757cad40c1ce440ba7e3c05d96d37d5515febe6ddddcb8a2330b974b915616ace7edfc8f77e02d9971112f2fed091e64ae9790e5a7abb89fd159b0c308d6002766983285c5d12ef40243ab2a2145dc3149d4b865e5acee309689ca68ee0435067935cb754d43b5d3edd434758935d1af2bf0e6bc16333c1e5a7774aced9c75c3d2649bc6e5bb8cea289d0a231dd31b3d3a062e11829afd7563dddd7def3094ae8952f33afc937849e00a87b0a518f0d138e094abe1e66e181b29add51e564e292e933456387f0afd58fedd0b5e79a9ef0b9326beb2634ab5fb8d955f7db379b64d2687aee06378345dbb41681df1f542fae1af5ac66b7665f2b6389315595e5239e338fb16faf0a239057ee671a83dcfb2c2d0e359fea5030621a39152f2484e646378d8d5fbde83f26f2ab32ca35d126eb25829829abaa2e698ed28272925844a7bcff90666e467f9c19faadb843d9c5ab22276d967025a7b64c0cad68671ee22369d07f80d25388473eb58045be78e447efef5805b998a96c382fbc8675228e3834e7c363360f6925c448ab40222bdf5e22cb3236b8bb54f4c829f47211ff182a86382e4871c18623c33260a8d933674a7a1513cf95175dd7c77c25463b92f22c7ba2eefb3f5915c9bc5946ec5544c59748a35f21274c47c7f25160d09733113b9931b092cba8605ea3cf6467e80429aef2bd7fab10b83ab7b6a7263d16434c4eb905d592f22eb56d6f4df7c7559b2f59fb25a27fc199c41f1016fe5a5caa1ccc5322329203c4078cb241eacae9e4603ccd5784bc1f5ae32bede15611404dd62f47cc96c69875f314df7c72c44a846b5d70508d8224eba7d1297e60338e7cc3503d45d713b44212b97469b8457c78bd348552d79e2591af09ca125c8ec6ab2127b08560535115dc4ad297cbdb813433128c16c9bb5ed3d064befff52ff9254df2983af47b1a8532e0f963d88dde1c9ec919416a95cdecaead744ecd94bb27ae56b351f8d0e4556f772999f65a36aed68700c0c7df1c5683e5bed87816439950ded44d08369bc7506a3c8321cd98b136d6f9d9b038c1a1cb37dac4c77b4cff63a4639cb7761753465c3133a6ffcb68773036244598e92b3f7d6f671d66ae411a30b99a671fa57c09c9ccfe6d3728129477aa09b0709e5b8496b278b3a0f996f720ed63fbe2d95cc9c6d4af5c2bc49c9856e3ba68d7b18248b1b973fa9effb0890b44016c59d39a697370b2aed312e1e7fe4eaafb2666fbbf156c82cec5218d95092ccaf4ef802a0df26415f61e8b32e5bd87bf9bf049107d297286008dd4b19f65da2364e6e1038e1e8614954cb21ebaa98d17459e2be1be0848226d12edb67baa42fed348b4929a906e3b16cb02efc8272de70306cd376e4594b0d962c6359dbb9a4eb167d2efe1d63871deba8f26fcf6a1ae291b555db81b313d90ccca725269667b52353d728afb8691e1f8718003f2e87686ab0c020757932f4cdf3555b37dad5c02d23614172d19d95b27d14845c9ae553348296d173ea1f88942ea25492adc1f8e2af28cf5e5e7c29fa968007b0f7e55b0a6e9f61d15bff9e70596c031e0a3e51731ae5ea8e097faece5041a40509a087bc96584e9746864a00ef642404b035b45f77fe2c3d61806d7237ad6da9b90777dbc2fef20925f7310c0dda9ac6d2b775f69fc4e10f0df64448d3324c355fe965df133ce0ec42547e40b5ec99b6051e2e1894156741c54ceb9b7726eabee3b53cbf566ccf48143dd5832546704991b8550d513bb3a965a8e851cbb8bece625eb6bff46ca072c8791c851ff0f09aae6ac19ab99106d0254c7f280de24357a1168bf7d9651bee1f0fc90f1f4ad0fa33fd73780cd19cec98b2ca367d9998ffe664c8508e27a3b0b63fadbcb39f630761845e9ccf54e17671da1cd5719c2661d9774f48242b1667812824baed1b275770f1878c91bb4fa7e985d882b3a5f65274c743bf2a3237821569543ace8cb1ddc0f2edd598942cf082f2758700859cec191b49a265b9c4e43c23ebdcd935b40795afe573f94ec736b2aed361cfc6441b8ca07efdbcbb0118ad0de071664873dffc71f3e6911e3303a57d03bdec0729487263bb5e80aaca1fdf0153e33f340447efd76d63d05f661a387c874b47409c1cb79a89e006d389329766d3398cf49b798205564e62c7093143b99999ba1672cfd4c4ff84b9dd1443fd644595b7c704d8cbc43922ca219f6c5716a82a5bf0afa7373850df0219c018af526f3f2ba9322de4682ad3fe2efc106d8e55348d54294e4812d9c7bc7846c3f7bf0416f09eff906cd1278b201fd9a0a3491a91524ec0c74e21ae81df9db6aa77c93c775db7e11e5c52b5c60b40e46af4d33b568f90ee68cec628378b60594d2a19bb3d58dae1bbccb18cbfd24549ac6fd31f861027fa6c3ed4b3d7bcda7ebd5704dc18505741bb8100a2ec3bb16e7204bf59652af0389ba58188e7df7789d069561aac7033a5485dcedf9c2a68a2b59853b75a635664e394ba89a5fe0ea94078069d6e8930ccec8ec0b0e762efa91d05be12ffc8bc4d11b02907d9aad744ba494977f575b630ec708b393d56b9b6b6c5a668eb7223bcbb40ee66f4ae71b42f8881ef3311138a12435a914524bb34b201a37fe7c95b46e7858f72a339ba741be927b2e8944f5e803f1e0a3f7de932ffd49c6c9f7db3e5ec24647878b37288fabc428644691aee4ba85fa54119c33f09fb6cf71e727155f4eef47be2625b4b19c4ed2923d995efec491789f8bdd80cf389d8a7e196e7fd22fc1bbac23716dd84896948a8f3ec3007db170f74daaa2781d218b0e4cced4cad8e5bf32f6beb207f845b345cf08b901d784762966e708799cd5fe84afa8e4f19b27a8ade2b7cf325207a7df9ce5e88eecceb2d89ffd94922fcc59cbc29c68aa2b069a4881a246ad5b56904835a7e3a004525216382cb63cdbe8d707ac3fd9a6fccee2462e24b4c8918a4941df678343fc78d80a1707d2e573c27f2bcb1a620d5a2c0a78f9688817d7a4c361328354b67b1ce757311d77ea3fb5b4380fec33851db83ebc0470d696cc133c48a743386ccdfa419c256770280387507f464e40ebaf5f695190366f8f7df72aa4eff823f853518005ce40c21ca6a5156f4cb126eed837e17998294f5356eeed344e5fc5b6ee7bcd73d2b45934925ef98a45d6231379c6d6c20359ae243cd2ae776482c09f1e3074ff1a4b4130a401c1412d3f834946675cf98e0cd19a9ebfa6fef4756da8280fd92c6c6218b7f005adcbb7e0049a1da6cc307592f00a2264f7232b02d27f46845ebd275411d95114ded0d0f09e0535bc36ecb03edf0f985e9c353ff9da414df677d714522467315cea3487c9f6364dd055ae1099ceff33ea4205e18ace5ba6986ba8add215e811895cf782dbca617c47f5542e9dda68d34892b86c7bd469f1ce0c431a122b5f52b5f19cbc7d941c1c22b0dfa9842d28a757453c96a3c8b0f96a8ad72cddd6c51349071e887b2f78b67db4e5e4526f055e467721e544cecf1f4d8f956d197dbe811433b81f0ccbdb9116cc8b2c5f977aca2db9da0beb520c9b53b37246cb30c7c29f04d5b06b7185d98c4ad0514ecde55c5d9deceae947d2dd28ef720007a5aa2e7a55782e6ba5778f2a0b06ae1a51c0dd953d5a37f1cddf248d1fcf3b97599943b7da7248dc6dcba0015d9bb5ec1eb0dc1243642eb18c74ab960faa1fe560a7eefb9edeb99b0219a3677b5f60d1fe6daa31301ac4f0ccfb9cea63d719a6af4e03f4d3ceb65b655b1ad2fbdb7d21aba1a59d4ef9c725a504228d15f94f27fe116e7664cdd5a40b5becf5f0207606275b8d7cd4088f5c4fb5953bac0d6f02616996ec8523b18e692e9f775d7063fd28218a937cd5493dc6851362aee29bcebf45e734b5e6932e4151b795877de22c513a9ec1f4e4cdd61fa7dc73358a18746200b6a3450250e18be5c6db4714927f041a8317cc31b2e06e1a70770e7b8795584f538b472d3e118e8f641e9a420d5d68a4be909caa79cab9cd854758ea93745ef82e973cf6ff236cc371426c04b54049810d17b509e51f035b61b1547b1829e7c93a1d4e00ed712c9cfa9206b750ff2e24d15642d7fea8c1eb7fc72f14e415f92bb5fec0b4613023617ea11c16fe7a6bec008731cb4341f4a13a733e928d7726fe882232747bdd86fd7a156054ae47859163b275ee9f324902c321d08194e1bf13105feeebe6cf38a194379a2e3739c6d241ce973e8beeb8dee31bd97a48a1f7b77fb3b3f8dbec8ef4d98d472344dcca95475fcf2041fd4c809662c4f729f3d50e786f3b5293823b50ae32598c5232a3f513cd7418d28ced395b4e75f74e8b5e0aa95545b04b684f694610d33a093a746b247a066035536787bf9420d274922bec1bea7320895880b1bf671d4a8f5ca46736e88c989826da3c0d91e2d160c64fa545bf5cb0ae775c12989d9df13a11e13a34eb45b30ecc1525b7a7dd5157d2d218db63e19ec85c05ef3b74dee54063629b1ebbcbb2606f775845ed62965526de1bf99b3debcf9e5eaa3dddae4b89faf3e8a9d7e182bfdcaed1ac5afc3c5d5147d733b085841fa0a36436cb7e5b4b8126e97ec3254856893b625fb8d7bf207da8dcdcdf7eaf8a5f53d66bce4b30ec0fe233aae5d7836baff854a498874d49e6dd40c45ef894e9c41ad1c4bfbb1ac163e9c64c409213977287fe72a92923a2d7c1cfde7d2858e00039e707021b1703bf121f2fdcbfeb05120e8d9f25207a1857ced1a491882fa9165f412f91c1d0543f805790545c554392b1e64c1dfad9a0a2d1ec351099f590b7de38a12c5c37f1b7c53ec6338f0d5f3e7b46c3b903beddd935e4d9aae0a5e781e1720bf06d62b3b744507d1a8bb5cb7281557f534bfd81934e20bc13c2da99bda5f1d6e6a18afe946d9821ccda20cc4f845999c7025df7140d29af45dcc16a064228d021fc8b5b35e5470b5ab0b4d97265d71086936a2482cd2a511e7946df648c020e110f47847f1847ba79f86bfa19edd96b8b49479a3379795e3ca5cb217b8dad0d67ff150b7a30850d78edea5805d8f12ae01024ad41e36df57785a39c782e29041d638d985faac0fc76c349f6d57344ae8a0c5338afb5f2d52f413e6fc18f0650c39a1f47e14d781773959d338355b0d2a6902154388cb6d1bf41ac48afa03e89fef2a6372c33393d49842b96b81f32381e705fce3b9a2ea677ec0358b5e0620d6bab5e1725d43d50803c332fecdbdd572f1d5a133df488f64c4bdf20c8a98586b22270548d2d2193498cff0fbaf0dc7449ecef7b5f2250d473163d456dcade331d656e4c3fcd2bd8473549d9e22d2ece064ef2f45a6051a797bee2f0fa045ce7a3b59c7719c5b01ad89b1bb1fd57cff0fc8b9290a53d6a13f254faa6be1b1276c131d38721cc0a398f13003b0680fa614d9d2ca7eb434725fb857d4b86e0da90f335c42300fbd95447ab388679fe189206722bf3ebf3488a0345430895ee732a840e613a3da56be8bf31feaa1c4bc0b2c3c48e310efa8e08f197d03dee57453a5ed0ecf1348f402dffe91f55e64d096cfc6c20dcc2544f302346c33b20248a09c24c306760c94b64dd66d41dca1d2e60d5c390bfd800f83f7fbbf5ae3213fce9526325a6597c163bab7199effd4723cfffc59b1d5c95c5956f91b43729db72b45a4a839b5484fab4d51fe0c22da27f2507ad42b298094a780eaaf8cc43052e3d0aaa406ad73ffc6737ad547a36be960459692abcf9827b4b7d6da59660c48db3549bb3c621dddf94ae64ef3d4f38f8923f4e2fb26e561d30a6d8ad312727a4f831db55e89f2b9fa76351250b35c95bb0353932531fa1b5a2f86a54f448171d342309e1cca49ef9d67c8d5557378bbf76271900d5daedf6b4c9c206deddfe58fe8e4346a3bbc69dde7536a2f432428b4b979a9ff89ce99f1b15dc8b17fe14f6b95af504b10762d629443d0d5a9e679cc69764df21f96fb7c02448eed86bd65ff85aea4c7514f422e30ea4a08d3f79f79da08bd1f6a741a6d825cd8e4982b78e0567b9f13a2167eb2deb1d3fe7f2d2c898642035ceef219e9918d27b40da1549802af80b3cf32f62386d2a8c2b11d3e76e3a3c15a8f4830686a31f4455cc2da182909d9fd91b58ca60a42d2cbe20bdb204995f394f6b5cb6103d20d3595a8233860b6e59291f8601fd4bd820bb1ea9ba3a6c9de8a7993af125bfa6c490b493cc3082f4ff908202da3104afee6594b983614b885c09ce3a9337e7f8096bfa27ff72796674de3d891ad63bde7d6342ca53f86537bf41750760ab9c7df96a1bb2860adb5037a94cf9fb178a786c2fbca6abb5a5d872a303605b56565925d0d560b48e6cf5b20486048b2a700144363bce195a2998e8fd6d11248b3467b835dd2c0b3693c690332038818b073bc1e842c262c1f4851d82e1caf995bfd13cf1416bd718a4a43b507a0e6e9318fc7a71123cbed6380317ffafd882bc21ef8070d725609865f4ed9a8a82b4b3dfc838e08200a904527a304ad788d8fd4bcf5c666f8cdcbf9694e51cffe161b6a9f782f17c45269512db96ae22f81facd7118c0f285ae03b787d6010727a6d1f2a48023993f17b629bcda02dcd9d996c49a8fe812aa2c0ffc1af8fefd6d21020c72660a6f9d47d94b2c3b81e42dcba7c46030bb155acb98edbe65ca7d1e100735c8081a1981f1794ebfc995252724eccae0d8364be2457f9705e3a706725faa79c5c9343c5f8edb24fbe5ec7cf1b8c61871109a352e04a2e49dcf820ad3005ddb4f5fdbd36ab23ff97d0c838ffd9bbdad0ea717819236ebb4e88739ac22c1418769aa805dcbab92a7923e5fb2458d3b48e7002a64031cab1f6b81e493199a31dbae545fb13010aff926685f07de8158e84c7c859fa1ece557fff37d3302e8311141847acd8a7a1a31a830d55ebd19bea36316b93cef24e41a3cee3594afe8852868ca522f6168214990cb871e78cc846ebbf57c79412ec089dee3e9b3571fda481e80fb9e01881ca013b2498b7f377eed790d33843b56122b2966c88cb997d1cc27d039ed6fafce3df09b8ff69be93cc6fb8f752211b6764e326a526356896b0508ecefab9abf30b45c131e871adf8a9c0d63ab3df2acb4651c90bd123aa424961d7f08138f28416b07678593288c580c8877da1f6c496e37159a26751d4b155ef0129a58afd89f2710b6de57c961529c9ee0476b2e9f51f18333574d8437ee6f88462ca764a3f2631bccf034105949b7ee926283b6b877a142db08680dee51dd6e944363909823346b2257f6eab02639760d6c5cecc5d330412b9b4eec4fcba1bac9fea87016fef07a69fe197929950a2bd4bc543b06c9724fc7ca1d5db59534d73c503e5cc6ad42f1397d91b310cf1b6def3bcb409cef53995f0183712addb5b3a303dafe795529620bb8efcefd5fb3148c552eefcd4b3dd241595ae13548c0ee25a2315c6741fba9a594ebaca7692ef16caf89857172d965626bd551df55f20930d7f4c14823a0a1cd67785b26282757722144eea497b7064959c10caed24ff3c476d3af0d921d44d4fba0c4ce88e8777d160f244960cee0ac1093569fa28a7829e1b6d169128fbcf46b63687cb6a6c766be899e766662ad9b945750c7ded28e9d2863b9de1c701e0ad6a3b93026e3e58b4dde3f8849839e75df822e0b488d7c1ccfad6170dee211f9d19439e09240aaa9115a9e84a590769ce299c72b1db1aea1fde37978572387714e06402e36c58850951780e65275632e38a076e97208962e387d9f908296a5a976c623b3e7a94b25a24b7904065a2df45ae427631276441433ab9ecc3502e7d0801b00b73dfd48fc4b0d4b3dcac1fe3467c66178fca1f7f46f11328da3ff43aca3ce7244a7cc2e2dcedd241eeb2bd67e0ea52efeec76bb9decfcccb5e1ae1d60be745efe3525e0e2b093051ca85e656747cd8df62f2e792cd6602ca1a70fb3443540641f71e436f44e4152ecdbf1f89a50e0d63c0dd94e33aca386c6f5f24050b35781c61df5c6f4d35c25730d3aba5fe375b4d03f459d8a84b87f37505e0eaf4d28e7634a48d837652d5900ae3662b1c0f07bf57fde3d296e3a884838bb02a455031060f4ba7d9938c0cd62622efa5bde103445cb3208743ec1815f87577e4516079efbfd839420c5b210a00ab3cd3020f679889168a8c22a6c9208584e55253a05377e3dcfca5b654a7151db92eafc70bedc78d38129efd460d0f99137a21d808c4b06c1afd588f944239134799f66570c65da7e28d85dee0f1de2b637be44e4a04c6b07b1a9572587474a1ed5193944480376cbf46e859125322995e9555c0743eee5319be2ffe943fd1afcb589a3da1d6e5a1d2495605ba3ee7090a75860d02918d752c9fa40963ecaefda41a0877cfc9b9222e3e251023461f15c90dc185457cb311d251a7040e1f15b37df380dbe5baddcf8c40e1f543c1c1aab41aeef685f6c1b7751aa5d4c34d9d68d6c2a240ada20152fee4d10798797417e764cce3e2a900c629d6c757974439f156aecc37e86faa4f0470b1949246d278637b3aa519c19a60831247662f334e3104fa405101e69eea1b16caaac3707d9da5f83fa71ae593c76ef68d61be1753e5ce6e202238ea9df323e6ed95f02a145b0a8047d10f1eb64b0c81f09ac42f6277985d32faafeb1df7e126ba73a3bd82dc56129c9f47ce34c7cac946d0fb0cffc927b201033e6801f2e6105335dc76d31e4e60a6b63ed6dbd0cc40f3254648a88e7e1fa625a61eeaa5c4921812f5dbb6a660d2bed26929eff937aef679246a40dbd5f609bd1c66c7544783ac9e972272f2cebab197ad8763e04b3c0ffd00dba25d1bf4fc84495a24fffa7685b17a6458cdb133262eacfb950468ce22e762cf8adaf51b01c4af4eaf418a0a0e5703de36e02344ab6e7162a7c05e1b2df610cabcf8a378601947706a6d3a8484bb6b81ce791a2f1eff616c24cfdd9bfe8208bd65e55f43c3348a18991d3b4b3c7a6cb4b7f4a8c7d491c626e1f2f0a525ed5c3e6c1932b63746b8ab638306fdacb810fa8049a055f74081483651ba780aabda4c4a7858030d2dff5362c55d86d0c9f9ea52551b751249cb9e2009c99fb386373c7cd97f8a9389c2a7375c9820abef0b67ef75cb3d605556d97e9e266ba8eb3a15bd0126ad29ee8a5f404f16d129caa81caaff8cbbef755fe67085cf8296e0a2d079c197cd220156d28884b1a48e9e95475988627452c31adc57bf4a368f7ac1056f04a1a85f9186ddbfb67816463dcc5f46608ab611b77738fea1b5f04cdb8c8155691f5b3a68cb4e41c1ace0677bbe41f1050d00639a97f6e72b7e648e62419b8c3fc5c4ad831a7074b2b99bd69d3773ee3eafeb91f2e6f45697f3bb1c2bc03f6c9c022a74419be486c1b949f62534d9e14b4cb20a6f30cca7692e764cff90313f83c961ef84fd2bd21598e1b0b2937b2705a37ed1a12b568e604bb6ca6f8da84316ead7b6e37d0f5c40954bf443a10f59012e232aa9da71cebd95888c727b3c1681c985cdfdbc64d28cc97ea4a4cb7dff08d7a32c45232a338d808b1671dbeb6c8e819b7e514d4b2315fa61a3b1e171a0eaadf2aa7a5a69fdad05ff906f8d0332e29756dafdb93ae272d4005420706e5cdf4ee0aada751ba9e5a57012ac519e82e717a75fa7018b68ad6eec24eb641ce8905a0134ecdf88d29e51d2e2ddd0fd97a5d86e947a2aff82d82829bde5478cc793058b50601b17e21e9750313c32e05a14749b309836e1902f98de04edca0e6cde18cfd8ed9fad1c30e95bd4557d6dd975f650da3549284bc250c1c0de7302527c5188d30cee2402f1c778a4e64c21a4e69c2d7f357834dfc2da4033e243dc020f4e1ae30461c930d185f5b17a055dc876e18d90d81c4dfd9d31711379314e766881bf526b9ac5446435d025410aafcf9fea82dbfb76f2adc14ecd53b5b2f5ad4e8e45a0da202f4978ddbc3609bff2b986eed8d8152ac168512d7484cf8eb759e5ebdbc6fbc87754051069777913f83055d79bd4fa18d3ca3f7ea80b80ce2ab952fb152a3368676f7b376401521ba596c3726c1db2aa2c2892b1446ec6c5c58efc870f87f81aa73bdd602fd602172be50b2a2be01f3a429762b1cd1230be26a79416521baaf293dd6128e0607c99e9f0d095a397b995601e6b523e3d9a0a67ad83d6d7866b77aec6541b71490e760c6c726fa2056639cc638253341929102449153bc66ae8b38e97cce45c5e77dcf23a4b48e634eaafef6b18d644c5de1a0740b79ac1fca0aba72f5869e6c3bc8ca8a014a3bba55364a6404aeade1c7116906065979f47f6b1e6a35413c02e776b35a268d3e938978e6889339c861000ad96fb9c4167d9393bc8c71e38fb752ee29cc712a0bab351aa7d1f90a50cc4b2fc43b3e01128331e2ab5ccf2590bc9b5a26733cd854b0f3f58db34df5721fd108bccf4d744f8b7158278e056768f2e5346f3c2cdfa931973c654e8c9889247f1380596b5034c223e6f5746076871109b6b2a68bc697dd922124d418330158b8647aef746a14e24c7ce2ceab87bcc741dda5ea58d38b2a09d106856e4f09bf039b694b9ddc9034fe34f4317d1c3eb3c0a9462aff0738e6b4d9da405a51f1b08995ff5229003f82afdb1b89221d808bc00a069a39263edd65ac80aea0295f45ff18b4c90d948711db58fcab387f13859453fb64ff42bfc95b60bc00767f9d4da6a9bb6b6b4c1364abad0ddc04538cdc3367745a0db41abfd9deb135f402ec14d5643d22d0275508a67267ba2c9dc8c10b9fe49dbe2815729843d43f9c6af63650173c4273d7a179871ecaa9e5e668e2a5b1866ed25b9dcf208a5f0daafba485c37deca789fb6e10fba932fe77a906c76cb9a6327f9eb16b7c8fe3554100d3bd291dcf32ae21c35dee6bfcd68e2b558c34bf519f9e01bf153e5910f636949fadfdd58afc224754d298d8c33dfb1b7a81354b02714b45f7b48d55dcb64f3601033216d6764d46113ff8ee54f0d24c3a76b7a5fa40b5908b0f48f9ab65e689c099cb07714aafed4b95fa79bfd6840986002f2aaf8aefcdc2df31c514f5f3d85dd1b5ea539be8b1e06adf139b2b98655665a714ee18686c4e530770bd7ad19b4853f1924f569c2b2ae194a29418888263e48663f4ac9354ca1fab1981295ade8ac70c438f665b444983d26da3b72b722bd5431d647a1373bfedb0974951a7347f80bc2a7b776895d2b057bc34b3a20bade609dfce9bb6fbeafe009c590d9b4a06118886717ded8370a90cdf2e2adbd82a555a285d214e2f63bee3f9180ed7606ba5449143891b3fc36903e676ef8f119f3f809018b16c27418d3735216c006abef18c70bc58c527820749c4d5138c7e7abe650cdfc0ac7f3d8b35d78928bfc13f6b9528cd5d471e531e25ca54228819dcc6df0e92bd8bfd2c9380b64879ac29622f132b5e87a8d1e4e7102eb634f44aa264b44ed9a194f61f8a9632ad03fe7c0594700199166e66914ddd79bf953fff8f066099ca35e72337663871906834a081cae9fcc26f42783028b3678b4cd2a815f121daf6c788655acce81842a92819894fd7e17451b64627165c70a65e406323ccff2f31aa6e56fbe7d5c536c57dcde82c65c18a2c87b001e4320c22d30caa6cfdc06550af25088e6a564999c334ed7ecee94d99a7589376bcf5b9b273b3bf8ff43bbd4385a526c3ab36a2d3bc5e489b88db5eab978400bdddd1afa3c60d7a3765131bb2b4e02b0265a5d6bc4397f52fd17185b6713ae64ef74f4c5eab831afa68c355ced018be76258764f3eeb8c776240535b048c52f0803482f586d95c2d4c2ba588d54897de67f871aac5a4cc506e725792632dc155df6ef86c7c6cfb845f87a8097c04b7b6f2c8f2030e5ce63d630cb957dee15c4a78ba01bfac7e8e7d3f5c316268f950167301396246cf9033023fb15da359f5f5ed9b90d5a0772a978fedf2f95564061741949946d759adaa4a3d6b7bb32ce5567b561ff8b94d57d5d09e35a76f73c131052b9d4f81e066d691a757637c4176d6769e68a60c4f4f100689069379098ebc0907e20f4584e63bb246a0d618d15b56cfa1935917c2adf8668d0443d43dc77247b9619b0cca7a8c6e1d51e8139279f3c41491f7c4a54f0f73ab48dd025581aaf2964f8d1a38a13c8a9b8c824dd8a8d38c6e83b6d609eca6d92a4aa81dea58e09cd9314c3881c0d10c7311961bc6081d5f9cf328e15cba8daa0d6b1d93aff58461587d64fd13f6fa68b885c7ef8fb9b2abb29a32f0c8ce99f29b5757c1eb1c037f5e25af616e18d21b2d1babf8f938b46b496874514c8252fb199ea141283452aca9cb4a109a1708ea39b07fbc465812c4bfdfd6de270c434f42b91600b9ed4215d54b01df50abbf3c498b907485e3a38f3da18cc95a3c12c9db04f3af4ad06f7682f957c654328741395af9c96e2bac44d0dfe0fd03952e3567e936737308847254f739d64ed01a5b207528ebd3f56b06e15a775ca83a43bdd83957c12707d70da37264449091679182dba89514fd454401dd7cd66f712563591020c281e7183467d3a924370450c4a56eb42125c52d460de075f96d3c249490bf939b0fdd962f2c607cb80bcac070b0c6eb27f85fdc48919d494b9c273073a81bdb290d3f797f280a046e1cc0754de409428b87128c9b407d65ae045bf874fe7a9d81969551da36ee71124eb43638523493edf67c5fb8bcc92ef42190171e1f21b2424459ed76d4d02d892e6f17ff55e3a58e3d46de267a7cdc2908b9668f77587be2ddcd6ea386ab64539a6e588eff333c4f5ed2b3552f71bfa3b4089808713b5754ac16252f135e53cd21ec728c76e9c4f7076e15ca51ad0a7ddafe5ccba08be74d5172455e05da35dd37878c75d9dab2c4d550de02d26f152e93a294f6d0b900dec6310abc65cabeea130a652e62d4487a37c174b37c6865155f9b57fe7e3ca18006d915c2a87e86be02ecb98a02a8b447da07d8ff6e2180c8316ab58f2c00e32d69646911359def5a679709f3f3ce65468762e9f76513717648a381df447809f77fe0d4e9af7c3cf694bbc58ba3ca5ff7172fdab285f79a3456fb8b8c517b01501aea814553660d4b24dd2a8b12844ca3c4fff238db55c906bdcf3ed3396c8b2a9cd79cc5460145097403f7bf71e814214283117dc562f8d1fc85d85cb98d06cb77d71727e81746d38e1a04268fee7440390b6f9abe7961145cff837ee9b364ceb2130208b0c836f4b7f3541d5e135185ff9e48f74343a9ae8a176266ce7e19210a79edc8b26a7b02481751b8c0dbeb9e1566c13c0fc96b1a8666c5770371ad65cee8b7bc5861909f3aa3f7edcc0a3a2b3ea8b44b99cc2ac8cc10b49f1ac18dca4227075556a45c6cbdfef1fbf35ee120a78632c279cd7579a51ba56075036461c217a2809e78bc3f5666bface5cffee5051f53c8b2651c30f71304979b2fc7b6bd7957bd5acb0057d68300ebe3247a5ab243e64fe76c185b8a454607d7f4067db6019daf491cb19fae4f0091792e972bbda16ea815de2a757cc7441d227a0c2b7c75b8c267a5a2ea813703940c5fd5868d7ae7f1db67dca780a522aaa32b679a781bbe029c3945f5620c853b853d0ccb7239310c8d5cc88b8573c0b94667189f0b56cdbce2a0f29d479af575b232a3d3f438e30ebe3c2db749a071e2bb073bd11d3a6e89e61eb378ff55b799ff00b7a2495c1f6d5466fd9c7d5ed7d0e75a5aebb3a3916440be0c944d4d1a1e345d7debcf9ad59d97011a44312e335af0b7a701429e67cde3faa0964513d7dab9be504fb89bce82601816ae3f79293aaae093790ed81f4cbf14d730b52cb1aae4ee21d5fb5e478440a96562f1cb5e572c7104ccccbc55a87acb714e9051ccddbaa7413fd0068bb4ec2190ebe190fdd98c10b1733283506ea67fa20c4fbeb8c331695804676f9f8aa59fcd70cfa5f11b2af0f44ccae5f09d551d2103eb50551de42d4f0c1e29366bac503b2ff0999e2210a9dd20da4fc3712bab94f439d303098b28748ade4b7b8cdd46165c34a4eaed30e7d8ffc660e143f0e281e24ed96554c48d59f765a54e8eff6c57d16fbb72f64c2113e8dedaa9d9fe12603b271dda246da6a4f466883eae1e03a3a84ba9f3760c0b7e7a4cb348e40bbb165bf976a675453ff806d3b220979113877acb624ee4a1f165cc9231ec39adead21a45ff3aa74bf330af624751f6856b3e3ef9c4d1d1e6f5cb4464626e58cda84a92e27996836f7dda8f55ee15431abcda4e756889b576e59f4eb4459aa0bfe12d73afb935ddc4a7cf2d76e0bd61fcf646521750995315eb03cb693187d3569af7103dc773a691510b607329981a545378b24688cedf9fe979a06437b35e3da0b2a5a8734919581074da8586c5a9126b3916a1a2f5b1652b942870c60785f95c00d8b78738d0d98b7a03d53c14e79ad367c5906b6ecb20da278f032ea4936b5f2af874c42d7ba8b6896c770feeae43242276aac2f5fed0b849d5e42506a26ce64e99dd50d7af6f52e087c0c2f60116619386bba0388b1066ce1cc4f91523f0a42c75834cea184cccaa71bdac7b33ff9749dd73c4c4434fcf8f299eee9103daea79b503299a1db94374cc06d7437760b536542a57790f8a97827b82f767f163ad8150ddda54635cac7acd763bc028b2dc2ab72f41b6d25e3c9ff608844298dab43bd1a28738e32f662f3db09413a938b79a823af0a6f3b0de55bb421da74296167756a4224f75d7a9b31fdf39466e0665d889de7e23fc2125629eb6c649a8ca245496ba5c4a201dc7d74909967dc61bf2b282c137b58b7e65ac39462bc294587d95d63f5e72486dd807445842c9f0082556c0f6b8d0a3f527f58055b1a62e8ca597e30dc6394204bae8648e836f93ae72944edc1d2fdbea42635f71cd7a461b65c11d7c0feb617f1fa622b45e3a8470ea5e75afe77a9bf0fbc8e3d44224dc3d8fe3823c4f52a6fc9b129979254f1b0d626779bd31f65d84a82b24043ce63d49ca9fdbea38a75962d957c9f6207c9b9fe94cc5c9726c98e2d5933999eccaa502cfa0efc5429c053896cbe2ffd27f0943796dc6f52877e708bf07cf642b85d06b06b0f792592663c94d588b05e88ea8cfbf47cbd591abd50ce7b22e4886bb7c0d4a5f964ca92707f67907527e3008059dd6d759c6a8c6fc1c587bfb24175c124d97fb01b776c386e592b2953e7f9388fdfcf2b4f54168534ca39648a3d460ac497e68ec9b742a255ce7f0ea5268403c375d85883ad003e57b8e13ac367665288239692f6977a2b66760136a5e002c975d61dde1e7b4837e9df861eeb81eebd3b1e00cc2604133b0888cfdc6a164dab65467b0c8fdce7e5562dee99857acbe8d5de33afab459fbc2c0d3fb7a917073ff223d37d4b66e04f225c495828ebc6d04d9b2c249545c319457a109240d376db2ed1897e2736bf4c7ab1d095104e9ce540e0a8bdf8a381011e89f723b3b90b5739764c30baba413a5bb25b80ada08d1c2756e70ea02af59c01e35a7f5d834dd246029ed8deede285c1c9b911d5dddf609c0c3b3e336513fce14c93f9d04b733dda228fcf6ae49efe8451ccdad7394335f7d718aeda02b9e011195b493b91f0e7dc02d739b12de7517caf7a422d6a2ce1552b020b113ae45c01f43cbe6341e3abc63f59027f4521035843416b6a36847f16100c145cdbfc8cfe6e6e3f9958f94686527d9371bf18b546205942d126719ddcf3ced4a36abfdd00492b3adda60ec4d0a07a1402b97f7ee62b5d40b2ef55be176a29ba3300a73215b61f0f0c52438882a0857bae8a64541082e3d2f79516b158a92b5fad9619c2f5ac518b19dd51b74985d72a3a1719bd2f71cfe4cb48ca521418c59242a937f95cf6af8d5ed2d5568a04792bb5ff902b9e646be037b8e77eae6afda23cfa9f5a422f9e93c54601a9a82c58c38248d2e2013a36571237db77c89c60828d477b74bebc96880a79dcd5e0b8c539bdee5efb4747823e144ae877304bf458d0f0b0f38e31cae9892695b6fe3ef6d4cab7a58e290f63ee09d8e3a6e31123a7d4eedd2b8e6631193d475dad4a6bd82f9a683e8a4f05cb2cec3cee42965119e48f3dd9c68d71405831641403fc8269b543a9c6c818ac02b631f3e72d16cac764210fc2cbdde484f502b1a36cd4b3fa90e2e55e83b39bc07a8c1ebab2c6b4888ee782f41917162ff919ddeb461d90c08c20637561ed972bb02ad14f3604148d9932b160f59448c2bbfa1ee2e8487ded0c79e4451810f5fb217f61d58ea6da014a93d1a4b3a0bcfd0c44513bcb5b32f0d02dffc70b7d10227403157505daa5821f086079d0e03c7d3df4aff80887778d4f6531269d25a0cf3ca9b85a5a23489e8b49dc5733d2166929574a811639a0681308a6af31c5af2261cddebb8b6a08710c80a807df6c7663646f3db9af59bbbfd5965556b113b5ae9196283a05ea3bfd1698076b6d5ee71fe634e4403c32126a7d797f9c3dcb9b2ed94c4665451c7e929a5d0ae60c68c6ac5b6f8052aea03473a711d65759b3806853d75e30926f93893858b45b8e51be616637ceeb0c8af0b0907d03c7781552465abe5288db09bd2238e92cffb6932837e3e4c799ea01d60e9356ebb04608c5b21b8d7f491e4f6377aab33cb038ebaf5a2a40403ac1ec77afeb66b276c9cc0ae819729f0f89c46294b9ea9b24a2f7e23226f7dbe05e25a29baceff5497963dcbb49ec890d5589d63b858515eb27cde39e4dfaf3ff20566a4e4e8d94fec6f804349d26def6d8220a8b58590d32be749c002bf33af79133414790d4d2a95ad6abe607668c6663a28c9975c0df9eb1e68571484f434f7bfe809d73a0a4f1d269374661ca2501603626ec61eb60723d5547bd0e7cb5a12e9f6a7058543c75209d2d22ab374c82bc3ae61e0ad98264509b6a640858524aee69cfd6bd40a3db41c9880818b1473fbb31db5400af5edc30ff7e2eb92d613f4c912475b07cb85ffdf854a2c67798e50723aa8476856672b27ef32cabe34e13af19d3bfe4ead66902879192c4c058fe81c1497f421402978736fb7aaa8d2f59d59d3ea6131d2cb23dd9ab9f012bb621e6587a7f5912d66057dceaf701a3b339bca5c177b7ada4a96e462359cb9c7d43e84f37a7f24828e315cf799f290089c78456de5ac621fa10ba634d4f2813282f3e2ccc6f08d5d6e3a0f42449152e92fb40beaeb08d2ea123a56b5e6d3eeeaea4f23e38a8c302037b138de591f1eda5b03aaeaa609e72cb8f9b98843334bf4574fc8be7d61c1c27212e74ce08dc581a8ad1056e24640f4ff867078241d6427a08f6b6e9bc3622f976e814564f571f47fb9e35e935043bcc9e0e083df5bf8b11d84a8df5907420a22a6bde690bc0911ca9ae37518981001f422f6a8988f5e9ba7dab44f1ee857a923ed55aeef6f59cb457c92dd3fa12ee2bcba4e78ec1b66999b6104a302a8925e20415059f22b880cd790edbfbfb49445749566b26b63fab5ecf4a25888209b8accf5db9b1b7bde0101837261a2ea128b11254d0ecb8ffb9ca596b75c543ecf5a6635c6b8b0e5c2614f9669835c07d6a8b0cc95fc00c0b1e75329dc988f2a28dec6fd414e8d01c246ee5a8397dfb3c91e649423590f209c18ec996ab8cce21b85ecfb408b62a03acd9ed56f557a608c00eb21931d9d9d7467f59a9e4e0964aaf57051f9210a3b6fb01a5677b444c0461715f680a3c852e7828dd7adb1d2d7f5a1b93a9e8d4dc48b969dd805e8874a00865236cdce98be9a5b0d76aab63108f748de6a00204ab382fb8dd8a3c3f6a2d8aba243963c56c3da0a9a5a4d7a477c0135d607019b9322cb082fbef34f331b3ac293c9fc9edd3be79f12b921ee3506672b2bece993ffbea205aa553333e39e60a3c25540434dd9084ece3399713a0331299aa63a28b5dad5c701c7a2f912b6a053108e708ed9ec16f45e1e5c9822b4bd5787f9a4c4897a2823f1b84b97a25567f86cd664497680d68cc4b9efc8415cc0e245f3739b9b38657902446d1f2e953b6ad3cb088b33b390803e0acc88edbbdb83f2b7f6ba600d1866af431b5000524419fc46c2c265db3a7d7cc9d236c3491b7e7bb497b545c99ba90de8484237c4648fc84afc115c997398c1fbfcc8a325748723a8f169aba4a32a3ee7dc744b76b7c58fe5c0bf992fef12f82f4e96c7472a1246dd4500db1918c2e49761eb8ba53e39a6992c0e83c1864cad5a21b326faf6f097b850b3f031e8b5806106476c0f43c1c331fcd6efee38d36c373824768bb84c8d2243c12eec73a7b86ec2d7ab830e901aafec8825359d3105ce85dbb0376c5170151960a07202f08d9c2dfc4da05aa2496a14dbdec575cfa2c3b9cf57cba2853ec37f5c67b5227e6886e9d56df78795a7a5d13e47b7a683b4d742c77fbe1fb403bc34109ac9a5da96f0afb30c4377df8dd8ff2c1f2810cdea179693f9be6c96781ea2fe46fde11f6ebfc1796293ef93c936bb54eccd2bb9bf23dff3fd575fa7570dbf5c0ec43a894beb7e34c2fa4c3b8dbd955b761b00a5617cd35fe0232ada18c3a8a6fff176ac705985493774e71698ac9e6747fb9edb987d92eda4cc7f889b9468986257acbb138f82862cb654d45273663a1a033fe853d2a7c8b5bf7161ee5159972ab6f5c1b3fcf81390ba0376ce1fbfd375245603a232b4bf176c8c13ed3eeb671404e9c338c690fa2400c4b7299f0d3efc2362e545f7087c536ed86c780c143ee9cf7918d257bdfa908adc79e7133f121ebd150ad9bba1f1aff6011c44c314b737b6b25ba78f3e3c587fb3ee52f6d3283e7bb15bc85086d05f6aac992ec3bd72fb0273c7a995343274f6bdec5fe715146569f9cc78706358aa9225b8ae112efb60aa52c8356b9e207a0bbb0fdbddff5c0948488bc0612702b3225a9380de9f6ec0e213d8adf1b688b1ec6f79884906280867b0673d28327944698731781ca02641f77a2165c0e177716b0eba8f9c6b63caa72dbd5eac53e01a014e08a8f871326e99c14206fba56819479238c573ccabe78e9531974d35d938b0e887523966d1f4879154a653260b57bff883be3cd71aa8184e52b1dbb856a85ac0b2f9dd5132e8e12f7571dd8127b4e664d126c563962971c171787b67b1696a026ec5aaa53ca16d73ea888ea632f5f1477ef68dde6ab9011a46abb1b807908d875c5113b90f2ae662f75e57cc4cbbdfd461b78eb3d5461c619d1a82c2324ce4b7745c1d3f019a4cf81c8c1bac39b6c6d7f95d52cc946a45e737bd634042e4c3dc120668e8fc5acf24fa68bf48fbbb2f100440b3cf4adc54aa446a8d5e7cf9aee27a0f938fc9d405911bd469d0776a9ac67426601b9ffcc1b67ee89885ff1eeb7e8d86fd07c86df738e30757335ead2a5600c601882d5fe952198322827df9321524bec1916eaae1922cd45635ab77395185057f274f097486d493845d40f631aad731d04136168a3a3233cd32a40f12ae9589feb2da562ac6a409578a58d9be706e803d813457c58ffea451828d87eeb5363d8d812f58b73caf8943969116b7c991549eb1c7ed4eeedea5c2feae14294b12642db2b1f496e5de18cbc2d7f1cf7df0ba649a6a11e3a65496169f2b758a11fd1e21114873feef46ba255ca26f3e4588d5e54950f02c417f863aebef7d30b750f3cc0d7d52dcffa0a11d42c7da73ecfe336b24c91d7274b44955884855476e664c4bac7cbd2958d19d8f0198f8c90aa93724e8f97a04f825810e6d39dd26002bb3a709c7826d52c5a63528c24bc51bd461e5cd8652b7d7f2f63cc147499b05f875f99aa429f1ad514a1134d1382b69fe501d0ecfc587d97f413eff875f7f246c5ebf30b298331a53d4a3924f358693a11fbead138ba8579d88f62cfeec2417557cf1090f4c7c1f07f4d3aeef298f38fbcc6fcf70a6cc3f5524b634dbce5a7b1ba100f6fe22d105134fc479e3b06bc58068bb52cda446e0c2fe95197f6d8858b2853f38c74689512c65d65e7e476710e802a12d7d00782a2ebbebc929771453319958ecc8568a794a7c9e9ed4173b9633a802267d355857569a081ef676cead398060fa072b226e8aaa73aaaaf9df3814382030cb63064480c470d71e063c2c9efca97c95a2105d07955ed792d5b510b8aaddd85f9625e9eb58fca879ec6becc32be9a64d4bbe15461452323f63b05e401cff81e238af68393d7f797b0263892cd1add68c0a25257374a24ca8c2677618f7a86186d8d7f1f181d4f667fbe4770fe884028258bea544a9e7289287405349e7e2d6daaff93c162e48899a90cf44a0baea73c983547e6fdec4560c3e690d047d00eaec29d1345ba90bd1a526106b6404f5b75aa92972e51a6cc380df6b4ac7159e676b7d41ac04f24f46c675903a43d441c65bc66548a7804adc5ade96d65f777e373bfd5f0afb21d25a3a67af9181adea6909bddad717e8282f9d69ad86a94db09dbc4db5303e0226a227c4e2937f35fcf534eaa582a7b0c38f6eb411b738bb7bf59907c4dfc366b8d69607a19230f4334efce4800e4bbc874d4eb2e2582ae363dc8f55b1fa01865a2b9a239396f1ca2f2906ecfc478f149e133e0a6bd3b153893326a1102996a36276eedb4b8cf6c28b88e9d2d68e58941418a184c5ff1c7010a23b19bdbd7d753e5666dd72813cbc65de5fc4eb9bef562274ecd23745c062630abfee07d5f2c52af0f642e64718f0d07144079adb127cfc0ae83f1b63822927c8c3a7d173450e0172dcdcf6e8153a6d0113fa1a463d174ffa3034e58aad73835b200b3234ae103a3ff7a00748bcfbbb8049bc32b7aeca585c4ac57695ef7adbacf3b12220a1f26af2d8e5d102fde92b6cd42bfad9709602891e491ab63beffd50df7dd0069b830dd27895b6214b5c166d2e0f68b67f5f3eb8d66d76e19348888b1ef3de3a5671e72172851497ad83973054087c3ca538af0250b8dc513c2c03445bcdb9090f89e61659ea9b14c8b3a93ab8d9f8eb4da68e1be24011065ef57f036774de223c75d28333c8c520260090b1fd24b4906f0ef412a03e536e65949cfa7e878edcf5e35d103698f1edcbfa2e88d8469fc1ff126f15a2f18e862b937cbd0a4b28ab1092decaaf1d76a9725fce76179ab00cdd42c7ac6c25a18d1e8411a38dac69949e3f906173dcf927b4038eeee88b0110eccc88e7b69a26eee5d7aeeb4008fec75326107f1d114bef4420c9bbabc3744b14d08f15fbeb4aad0fe4880c3bda28e873a3e4a2fdf9628ab77bebd7e2380d22597ebb254e8b64c4ece9b4308657020761f523f44293a78fa4e7bd8b6253cbc5c23f2ccccde193d924c51d264fbed3495cc9d05353ae37e5b2f78a6b668f889d8d98b9d8d0bc639960583559c90ac5ca552d9ac0044efc5531720089f746898cbd179e26f2925b108b4dd9d31f4416c6e6ba877680d08da27b4c2a8087cd47b5c22807bcd4b347ef14c1a420af2a43b0e039f2f577f189f96da3cfb53b3b82a6fa2dfce47b03753101d878df237ee520f02baf186d064b508d5aee208aacf01106e39de06a51984a78f948606f82aedb1de2b5588af4dac4300a44981743b753c70eb766072c70394b0e610923df8efce0f8effec2e743090e38b03331d64acce6c8aa6b4b0075f8795486df3d665892b1405a57e5825c5517b3d2298b5ca87cb20db49ccd125f0c91691e939d6659a5f8c7c1facddd9e2eb4d5fc426609ab7cee39a875335ab3c314f7f1215b001130ae9aaf57fc0bbdc37e6d23a8cc176c28499c8ae77aaf438f6ebbc952745c87d04b847e59badbaa4203d3053e477cd1b13b496bfd904bd8f08feb52ef287e5d59e2a7a4b6ff200f8d56194c2146fd9f14728a2490fcb7fdcf72f4fb90d4e0a333fae27f5c986dbb3d1ce648b90f976c10390be72aaa66444a414362811eb3deae71af60c332c8a76f83e8eb4d60085c0e18b3c0cf9e77d4409d44b8f8381b350cf026909920b242c987eb2f27fea35e7d3bd1b57de36b956c6caaa486987e1c60c89cc3c5dc4ce5912b5f093b67b8b1015a16905895af98bfd420b7838039a457f580e44e1ab7aa5d6b7cc0df94b15bda582fbbb57720389135999cda38c092352db334f4c55d1549b9f9a1ca48f4f9dbcf62b7acbf40978180906530559db05e2318acf2f233692c286456cd6da838b9bf41364390f35fefc49fe52c780aefff519e2791d09dcb30dc8df2849d92a9d47eff6f476e3b60bf5d7e8f3580b85962f476f2c93efa4530a6b602fb64e88b9f6d686d5d3519eeef7e894917e3c88e5634d51b9c533c7aacc827a4c34254530cd304e2a1b18760a2a507fbd9ad99cb79b23e0fa885d56c88cbe5ae0054f442014f084ee76b31e362b92e04b93b12520c7ce1097ec97107039746cdd4110c8067a3bb84364eb25e42ab4601ab89a24646033d8d30f6a14adad4c073d9f3e442afc3b41b0b44d0aa96faa15cf53b30d5cd4173b8c8b7ea96535bddb49dda41b96cd222423e313312a1d92b1881c5ea216dd7922e86e394c349d3549d10830ed7e1fbe59e2561597601601c38afe582a2030eb33c904a57e3d7e87b9c19a1d15bb71e586d26e61b27aac404e372e5ff105323545ed8c3a568bb2e891ba3d7f8857026eaf1624ea55016db74928f47a68095a67fff763cb178f881810d025254d1949fff69ef47dd41aa99353fbd85de1a1703eab794589ba8ba953490c4be36666bb5b5ac8c2777a07213edc239c35065ff7538fd10758f7cdfc0ec82b6315d904ffba2c464ee7761e31b787daa57c0193c84ef332788b85af7205608b5e46e84d9b69156952ef5e49c1ba95a3af06aa0d979951d4f4828d6f5a0374f31b221d315e29787eea535e4dfc4c289a65425693c489c40644a60df6c43475ac0eab191fc0f9e1203707b12b287fa6016b1deae7f35d4240166838cb54413b5a013f88c970eeb471116804283f23eb5e5c315f756028f5b227d987cf81c4096997550dcf1c1b5b99febf773a591b9cf183d9e33a5cc31c600b1e46a8eba537bfb542d10efaf752b1adef7fc896803fd0b34cfe3204afccb7f86097e6c38062f494361781ede0119415ba65313c1d6fab3603fab86459be650eaadadf0ac02b29df40aa01e032a98bdefcf17219b10d8e50e56e246c44b424d4a0a2d6d729a8d29797e6da7845cf6457271840a93d63a5681e509f51ef46a81b2adc40126034f1e3e00a8e72823d8afb8ddebca03c0209e4b2cb5d9880d6024f3dc9e3ab4d1cd7f5f257d724b0f84263b08d789d59be74033dad233029d328c080da47f6e2bf5d9b7d0793e0af716917c51a70c87b60d2b0bb1f3707e555dc4f642f5eba68599b386ab24dfff310d874cb267c9dd786f505857dd63f4890aac9e7748483a8294b5ad3d42b1997ef40ba93f7ef2e6f6ee9f278b86b657ff8dfef20281fde66543f4af311ec5e1f08c5ce9cf6d7bb23d947ae0d95c3dacea23b2040c08c8d6a46dc64a4d6ef64dac8c6c4ac9bd586bfc0c4eae32703914fa8a1427d25d160ece1a2bab1677f7b87e28c889f376c3d288fc1ac5829b39db5af9151a763d4c3ae5734b1bf842c9d86be6496c237b3190cc104d9f97a60720ad8d3d165c4dbee908c254d14ae4eb87f248a377ea53cd11714fc2f15833b6490b485de4716558fcef3be900af532adb057c6cdd89f5cf2e6452b54ed67f4ac4f8cacea2bca7e3caee10d48bba3700f53558083867bd6de28d0c26cc76dca46216ec6042984164e4b392d2e9ade32b90a01cde3bc15da2c80b8566f8045c8e939ab0c82ee2ca2a5c16aebfc89083ea15ec40b654dac6eea520fd7c73dd5fa1aa2a35fc93676aa9588bb59e0e915adeca8d0c85f57744b10fc1fb58552d5fd1b9d0d32cfde744487dab828da6d16aae0334649d229bf788a5b83e668d7d33f2b508213482c403ecdd1901d1c421ae7624e6d7dbe236007f8d0238f7c0bafedf6a495a778c3d26e757c91d568c5c28aa431cf428c12d897369fb64c5dd73381c4f2b60d89bf086656cc374745a6f9b6cf733298c92d1a0ed87661836573d6785d4f37ae94307f5c6a29010c7f23f76d8f7958ec7b273ddda6db4e4afc1922bef39e1dd2924bbf626e7b6e52a563f8e36ef997f3de1d9586f202d5114039bca2af2d39ec5fff024b0132435af04c6ae915bcf0ed5b920d2a6e95215afbc0ba04d23694167bf80b3f2fad60d1a6a281324faaa65e91162960175b7d7ee3321c5121924f3ba38532f2a12d7d47d46fe7075650c12cc2f79fcbad410d080c7d2cb3f70c3dce7d039591c0f12b47e07fd694985fa43c3fcaea19c0b8fbdc91d1c4838da6e54e1afe349c71e917f47017850f276b5ee03b3f05c345ea601cde83f86f6b5ca20ef2926d8844a0ff283d6ebfe6019f9b0c8e8d615b79a7144cfa1a532fd3e3a8de7f1806b920c2cd7ec0c81803beffa8c6f4011e8aa5f60ff2dbbbd03d16450ea30b690c3d550da6c09e17c864e7e81cfa527d54459871c2570ba8449676b3c7648a4d440d8b42fca4a8efee584ec908ef01fe8667a0f318aa195075c5e21beb8961e9f36b6a26eea49f524ca7804bda222d5aece7e80b8474c3c3c66fb4e8c024b96b8845166c2f8e0590fd48f4ad244b0d6fc0b2305efe97b394dcdbad40c90cef41d3d78aa2a75651606d7d327ec72aa1d85cd752d983af13fa7dcafc740795fe761f2628b6eed2d68694980375535100a3d71bb4f075723c48f0a9379a3fa15c9e0faf67c7525565ba40890be4210ec639e232b1b15556b76bb2a0e250cf0305abf6fa1578270ac041d8251a7d5225f3e5362ddbad563b3600dab6317a7c692dcc82a51f20663c611b5757d4ae0e97e0b873a24a64922fc01822649e24abc96a8488992543249de2a63aab3e3080fa9d36dd210f39f4e175b2e92acdcd1197db383ce0b87b50a1779e9aaa8243c560ae4c0c65f793b7d7f5f10f7e7275e242ab7f86d46774df0719cfad2ccd6c141c42e73593a73f885aced022d68551a8a7edbfc5ea1fb9d37112c2d261f03c68548149af82f513e45a3d39485fa2e999420a0b4349d4d9f4f864d08452d3bbcf1b92a4b37ac78c123a5ab0d7d53204fd85dccf27ac2e95117dd5caa00749dd7553d0599a2159f7d91dca3e52013875cc2815a32c91d7e0a7a5ae6500a46b7a4d84157594c35c580788b067efe8907eddfd14ec29339e2b38b62082ed3b23eda6f9f1bbfbb8f82b9100d780ff7f9d22d288ac0ee8ee3909541dea8852496530eed8c16ead63b9d586e4f52362ecb4c8deff88b69e0e4b08a35e601e199a3cad560487830b43c3da7e6ea7fb52fac720beeb5cbc85a141e992581a3c18be3e8a5e8a58852ce6e7dd326f451705b3fefe89bd82d78ba15ec814cd9f5d6b160e45eb5004219d615d87fa428ed40008b931758ea416363b4e8f33e5bcd48da45f873db87151fa383794cf1c28e3b8ca7bb4379fad12b1e1c3eea9491e3dadbc09ef0fa302dd25075f13a165109b2cc68cfeddb1b349734f5d012a701abc6ddf09c34b6cb5dbe6f8ce2bcda27d7637050575ff4a665d3f3013ad6932d507ddf0f96e8ca4198caa9ecf0ed12111de7202acfedb6c297801a34c3b7657a15dcba360244347d931f48fe6d5e9c3f03959c8967e63067eec2fd2996a175a43f90b75778db7650f251d1de081a63d915fa5ed0c6f71035c130b8f3dfc3b7d7dc1502a9b6fa3f33e042689f24de9eb1410d20269e1af0cecb7f0a214dc22a186c706c500bca60d0bdab9b639fa1aac800d135446445a2333b6874b73f9286cfc67bcf4d67108eb61929ba7ddc824be282f26fc9dafc185f6d644eb91c0340795a00c1a378089890fa9729e21ea4b22c82c020cc63c5ea519d3cef3c01ee3f69545fb4cb4463b20cdf78123162bcc0561ad754e9d483feaf01c338322753833b34f503ea7b09f474b506069c0e90867d93ac2f3e80fd388fd4b0d6648f0c012aa42488ad206ee31fecfb64927ddc8e2acd5ac534c58feaebb76e053d704f77bde680ca7cf93d2471c87abcd8d5c26bf5eb19b2b7fcb2e227fd043ecfff65d7d3cbef57ca3b50abf452fce0f25dceacc1b8cbf4e1fc2758a5af3e2a609bf1d6507dac4990e39d74493838c19660f8fc850fa2c339cc45aa52b311253805c2416a4c3996bd59ce18ad97bbeb8259ae1d2add1c85815835c18d1b8e436ee5e084c12de3272282b6607633649bd32b2fc0465e47308bab5d6c38ae9887eed3b84845fb4437a576c5e03218731ea4b13654ad2bb243a06958aa9be672945737b70ee6d30fd7e9ac22f2dd905997f9749442f0fdc9adf6067273d652d5ed82424947befb089c6fd8aab1b759180c8826a705cb2d9738e10b6b45f19227d9a68acc45142326a02617ed782afa343b732a3da8d69803ff9677eb78637cac8abae2ad952664f5847b74d3975b864d406b688773b09b5b2e2163acf8473957f13faf400cd1d45a279416ce2bc54fe7b82e6ea04c5307f4ca9d4dec104442d9e6e25e60ad6f3e50f9bf2e45a64f16c5d0d203a9ce5f206360ed4e6960dfdfeaf635f20b5159acaf4503e4d0a1cd3bb31d794a78caff19aea78f7806e4071e88c81535a025becd4af6771247ed75b1ba9fbfce50d532920c90f6abdeaa83d237115570bcb2dc4662204bae1f038105917e18c7e54c8fa41056e05a5a58a68b4c6b3b95f3956f0e358b647df1cdc3c1ab1c354b86e5b53bde454a9134357b421eaec40e4ce7497e23ecdbf3df4ce638961b7662fddaea4184cb583527e21de86737729ce1b1bedd5185330dad7879ebfcc453c010c74913a2dcf003b8d9b32317d0b79644a703968d799a90cfc2f69b3ef7133bd7b5487acf7f8ad876bff67b79cf13d791e4ef0538a8e1436d9e3525426febb9c8ba9a20120eadc6a1462ed7c851de6ae4e0efeae9ab3448c075bd231b87398e90822ebef3cd8ab9d89b4ba3449f89829bfb94dedde80ef329fca18fd3125ba90a912fb66961217577e60a162362ec8573f30012407f0f08e6c792de0d7541e41d5844f581a67ee3369b9319ee1522f497fcb1792ee126d8292adbc0bdee9fd4a2514039e78fd587f07711492d62d9e2298557231016092cc40f01d07a65b24fd386cfcdc9a60a9d2ed54190c005e07e1dcdfc9e31cadc16701537a81c0a76e910ad87004a3e68fc08ba92914e372e576dd54a43f0c49f9c5f97aa5a4e4c3fc273a22eec3ab047dca90533605471f5c27ab3bd5edc4964cc6d0d99415782a0cc2bdcc359201a6c204fddfb62716bbbace3b14dfcf530afe54b960ada4e47117a8907a699f687edd3bfb2789ce26aa43346d51397371781fd2b37a08335c22fc8616c785fe8a3ac49a9c1629d0e36521a7391625b1acdaf3b1c5b4fa45b47bea16bcf042fee26686c2c124b75ee809ae5220be9674ffcc94ec029a34d2f9464e2c8691833f3ceaa75cc950a0555ebca815c84d579db3f29d08b066ef6916832dd5ececfd49b32ec05dc7a3f15a63ab90ede4a2095481a06f590cbbec67326aef6167d7a2b1498e7b00798eae30b91449b77db459de2035610e5406c991611ddd97c8cbf66b652d23de6a225ede1d3d6996dfcd1f80ffadc15c69dff624ddc52b503483e4b36439730631155e89d6abfefbce3c70f9db275b6090ef00782f5befb0936c07a3e636addec64e1900896d6a49cbfd361e319d06482d77c63422e4efee5fdcf836c97daebf9cfd6d58ffc81de7841437ffcbee12937cfcae13b291a195da097a3eb4a39517d4552e9cabc5ba4ffcddee3fea29e8679d37f478ef55f748c89688d8b2f33984174df958449f0cd288eb4495f2e778fea32ba251536657fd2215efa4b409e2174c8bd729876c38d5a63fcd32151568156693a762b9c16c3cf6a6dd23cb91eb1a8b0018fa576b62fc42e4d00126d2baf2d20a3b673462cd04345ce066bf097388c276a8cf8ca269d31b4faa9c0d0470d2453838dd0111207a34255ed39738d7da0b02320de98170af1019bb9dc86cbe9bc4c3791c044c6a85d5dc13547c0359bf13ec0d789cae00b20628b0bc91d5a98bd7766f3905087afae0e2eb1b981299510761ca836e13f6a81624ffa31772c20a425b7dbab47010b8f33fb0b08f0c7f116122c43d14712464ce145f38c470fd7c8c84baab0d51f3f23d84ad6d242765d0b239c104c6a7526e7907415c0fb8dc715134675b8b93c975b5a34a3c8c2ab76757cc8f9d852316331ccb6d3b85cf1cbde35f751268aa2a5ede7de985c7f01fc2b9a6821eee256197651b48d1301c09b99bc17aefc013b3e230ef11f92b22fff3996a9cec6bb366c2a344430d0c705fcbe47ed1b0291ecf527ef326b0f8e68a3ea6aae47a337c57fe6f6a53667ed31b40712297ab841448c2fb3ced034eb2af1836e593289f6cbd76ce46c8fa2ca2ce98b463ce17799954a4f58565b827a0da4d960f84c25d3372caf5d04503c06fe686fb5cf432affc9080861c898b01b352f8cc8f28a002abd8a4ab19b92521d2255f812e7141b4f60f4d116f7f365ec13369967a4984fe00063f3a45ac76541588ff56fd8cd02198df95ef2fad1e9472cd41ec71c647c3908febaf19aa8361141658e7a076e6fa1623047450e3796f7e47ab1064d80cbce62301200544801c753d3abdf8772fb8c42dfa6a0710cc78730eddb944cd6b40f07c1721ab2e735916ff7f6194a38bf3255606143aef94387ad20f1ed237bf49741b58c74e4b8fd0410f963f44dde288c8567af2d64dabe42ff77a5637fc284779004d8ae11b9680a46709f6e32879395ff1d146302d87b9949d55fe5b23abfdc20eb39cc00a9f05677791717526da327beb3f53bfe73203095cae2f1436cea4626f9aeb9f863d2c62c8272b4452da783f20889310e42444024144e63123d838c145a8f54e01a26069bb5664acf24b205ddf03d64215efd6dd40d7e104e1c35bf73d2861a5a787aefff5ca9ae05027b5ec799f5645acd99fcd6208332e162e7c777a9cb85d2375019807f33a2ada3ebba927267d551c581e4e43f57bc465e37df83d5b6e2c464bc68949b3198b097c9692d9f9b5293b3cdc3832a6cbcaf245f0e8f4138340e97adeb4a56eb4f2192bb591ffac8552f22d2a13e7de7ad9d57f76352a8fcb67e9f93887d64178b73d26aa31f4a088c5f4628aaf51cd3ef87df87dbeb335057d4ef391d9275869444e9d2e1135e07352c95fe10054acf5dcc06d3918b24f70a44d6a032b19f08943af4ab1e767f99469f8beb3da681126b7278ac3a19179458cb83023664324a00d55374fe4783f24270d9eb7d983c9b462da55bdea7ce4bc21938743cbb1b50ad87b8c237fd0964ddae8e11cf20a78ac6b04d5d7f09fe236f3f9e465a3e6b2925902c77881dd28b32e5e3f731c0fcdc70a48c41dc65e0eb87adbfb223305bb1347bd25c9c2211643987fa7d869409b8d009aa4ffa46698d8e56cfefdfa8036309e7009fa2da5e667c8659ae1e3ed4f39652785de2abc23e6cdad2f2f002cd09ea04d79906167e502481d6a22326afab44015042700c610f7e55564f40192bd49931e454b8f26aa31545a706737ce44226dc04cea6c76c06f1df781440db45bd70c0c955996cb1b330f171f24a864b47145c3ae0c6af76839b05bf5d283f8193470cd1c9895ba8dc43dc2ee17f3f30adabbeb351c05f18ad6a7648b7fb4c29a05d0e40428df6b8aee0dca00661f4434013366bb757de1d3139e0739adcea4645ced8c497672c6ca03119f79992708e663db7ede565df17a1574b84ce2c60cbf65f939a31b2d1208b88fe6b24e127b88604b157e891d0a9b107a9e1ea57a9a9e801cbec31dab636e1533013f4e3ecfeb494aa358bd2db4f9f5acb3a5a2998d733e7bd2251b88af1d97e0095db5fa773bd87217ba67d22147c8a3cca9e196f39d9aef162eeafa83d0eecbca574d8f9f916039406046a6a3342829f5fb7453bf303468df013c60407b7ab098291f8ee69d3524726ff74aefbb4e7340e8d71da35664b5bfa28b73917126571fe936f7933ab5575196f025107d6068003b4ace3b9cf603ae5d6d5e8cb0aff9d4d922fbf2db993f8592d9de9778c2b54b91ddb7d8c070e78046c26ba4a4c77f5f36de03ce3fcdb4ed53e39b1be15c943f9e4d5e4893180961c71fff1603825d58762ffc9e8408e0f5771f39b2d46da2c8c5d6e1c4b459872388a6e144800a1974a261bc93a3b1584085b96f251792b2d1a253f2bc3c74b58b6f5e872a13e059a8f3204985135ba7483853cdf76864f14ae72c53de926312a2414d612ee46a05853d2e50b00d5076cf59313a55784d61b241430a39d2249098856d435eaa81cbc471c7d3d96c05de2d1b67941bc9cc4de1e4bd42b0ea614efe371022efd1358e18a1b175aea6ab98edc4a8563b6511e40b653382a72b7df4fa5e408c65e8f76489412a58298452c79ce295cfc693239071be6bea83b51d1054ebf253e3bf13aad46b22846df0f6f7e517b6e673f7d393076fce59be58ad25f426857d6105a0845cceb94f4079183ff74038ea5ba74d2491bd140c8215d7d2907e97752326b2d9fa8407948e42be4c3f84e4bca6a6214ee3dfe48af4d049bd5fe030de0d6edc95d1c3bd3519c9766273341d4ba139d3e225d7165821bf52d58f5250516e499e3942d45ec71b9726c30f6983f2b78686924d1bfdbaa517fb24eb678316e13a1a554489e0d145f1dd0773b928ec21e7f33178d457d9269cf4c3f280b42b6524d96acefefb0fa38a6c95795cfb92ffda4cdd727e92ac89829a8cbbcaa428d86850205b173b0dc0ad3b40b7fa1f5a0d6e37ae3f1b45c5cdd678064d713a9a30d93eefb15704ef1267eeda6f7de6291b5bb77d150d99b4bc596aa6005d7d90b2ed34bf65c31ceaa288616d007149beb27b6d53aa5540d6a84b5b06e2890dbd86fe1910427a1204f752fe5f4cb00bfb67c366a84b0b3bd09c48d038abc6bdcfbd79412f46787fdbc7a881d47885056a8327f41eb0dd4cb4c0726bd3b8795127cefb80949c410989de35719417ee18129c04eaa3cf9c31f67c57eea63a2ac07ddc0d741fb81805aaac0dd2a7832de8b27db8b9aecd0f9149ba8c7218bfbd49e507e2aed685c8271eaa467cbe168658cdb0545cc76fcd22493fa2d05ff6d06dee9207ef5353a10536d2978cca105ca8074e70aa75a63f67249d2a77bb2f52fcf015075cba9fb388472692fac82da540efb6da2b1440f8ba76304dee47c21ac4cd90cda465cd83637637fc3e524e3e8676ff662a8c0b0b9ff72acdb7d8e8b863d6dc008b89d548aa8ed8d848848173eadc1ee682567567a03bcb8860cdcf24f765dd85c10aba696bdfb6c1b13a955e6b331b01477956b7fe6e3ac843433d8d0b2e15a14a928ce717b791fac0c7f129be9eba14836ed98a16d4dfd265766e6b6ecb8b6a58a1d20201e1f0b78b45a83cb01b935736fcd319941597ddc64c3e31ccae90e09b90e2f156a5c033918d9de54cb94fb5553f379f56b2f6acaf6081a93ce2c9920dc592dddc61ea72331b414ce39bfdad161147249a50249a40693f58aae86912a5c557dde83c1ff7c0efe428a1c18a5d5af467871cdd7e90b57042ec42ae58b9a665efa7330962c2f1f24fc17b52d32eb8d825a2c24e56cbc171ea91c2d85cd82ee53cb2c5a1767af0605a14e8d7c42c8f2f98fdde42e361ea01957477f47d7eaf34fafce13e7e20bde3788cd1072b96f435797a69515069c71ca0c9034839c7d7510800e2931a78fc6360d3be9b3236de890f85bc3ef549d8e26ceab50d82aa54b741e155a85ca4783a760c533a8fa9d613a219444267ad0d2da931cb2bdcc8316f7a3a839bd45f6184c049c90ce08cee86c61b3747efd1294e16d062985c02afe7645fe37046939ce7ef2797f483a589bd9eb44e79b5d493252662d5425aed69d373157bc9d77a43a366d0a0d184e236a558b41c57ae3eec8bc00d099f28ccc2dae5343e8a9daa3d32ec8ccd34e57a950e32679374c3a7b43756bfa730df567764b43da9f912d75c8b9bf8c78bd1c2706baef1b39a4543b40400a6e94e9f97fe0c80c2ceef84e95f5ecf00848dc7ee404ddd1bbc1895542bdd1e1c5e40655546bb336195c1a8aa6b1760fecb867c952d950d25f2488e9517baa9bbe601dd6777b3e893aae2078dae11ed2b5416353bb37ed1eb80be65412626ad2882ae801a3d6849933a184db3c0c50f89cb489e1d03c4512ce878e9a97dd8cfbd7049af442ee71385b03a2838e3e355c01dda76e45d6be2fa00fbd2853d7213f3b7bd7666e656f9b526161faaf70975405fde8f8aa85cec8ba0dfefcd5a43a74525184563604ad6581eac525376cf787666d009f7a333d270ac4ac5299a4e124cfd6fcda40478f7499d12b05b3e61f8119a4515faf5b481feea3b752e38be05c59dff34fb8dc10505d871ec09ec7e331c4d7b3e04c1c44ac2611ce959e7cb6810389844f6a7483a530e18b40293ac0bc14b6de119f7e7c53ecb38c31fa58e68a12f65aba299b406b743e7221e0b312a741342a69b16de08f685ab9129a3bf9de707be14d686259f0e32b667ec171c0301b087ab50f5b6cff82a2322d3c0683421c2e087a572bff56ce2cc8749d588b8d3ca31c04be4af02089678367a36179c656f54b40212194b41eff4493520754dd0b6a13a096e3e31971bd38a4368cda7a007df04aab436d8bac709b30a9fb67713023e240cc384e42e7ed3a30d0c01947aee0a775fe52c3b9879efc4fddda0c692931637e4f8a3695e94ffdb9b1befa69f3f43911eeddf9f27b7477b76ba7b6e52f2cdef4981d6a84083840571226d89de85f477e640ceb96d594e166a9e9a3dae2f796cbdc0296e0f25d20f2127c5c9a58a3cd50639cbad4e6e439e4676114a2429638f0056daf3a506869946cf653a8c41af5f0ba38352c20b7ed7357eac0e1cbfeb78dbdff2f4d0b7b03c8d792c04e71f803cd14449892f626a9690af87e822231356732ec60573db64f3cea003ed8ef40aea1011f804672f3d024f074dfcdc77f95448cd6f5531615dbd29e2db8e17f47e914dfd1cdc9b6aadd5aa51a8b2fa86f7ea7fe67dac6b15f24fc667f5a1fe04f444aa66d12c96180514e2bc92c14a1886b435edeeadea062a56ba0dcceb8170c5995e7dc94cc26fd92f4e3316d2d00d79f91c6eb010fa87d7ce6f7a9e316e467049264f624fb41c0f4a4727fd43cfa92a273e04bebe79ab3f6d992356a9462adcdd3014b4bbfd85d0ddac2806ce1280b9958c42e6711b71cc0599f6aaa761150972a3d4459d4f9d30ebf8aed320aa00b9501b89fd29064540882cbf8cd2b11a565d2b410ef0f61a2a7c9fb62358f0022313583fa271de0702f5c5224e1bb8c989ad70ea0f316b254ba207dcdf322ce97ce0d591351e2b03c21b4cd5bafb4d0063c1b7b6b8b74aee5196c3efd7bf486e712a5b49654fa5672f88af950eb81b027bd3e6668cae434784e4b177e0d3db867e1e79cf1ed7e476b5c3491db8befd9c02d8db52d7b17cb0acdcbe791f023135f21bfc8fd39e4cef27e6d4571e50828005fb7e839c889fb0f976ac7d0acf1005e1e74f3573997a9d4d7a810662b6c0353827d23372eca9f28906fed1ae0f46274ac0099b920cd1052dea7a495c34ce37eb003d3643a7c212183ab4131d18460cc8f940dd541adef8586abc36bf519a104c4a7991ce260b103c2479d4a4fd4e9f346f3254176bb22ee3310fd854e43baca10d02cfd3ab7638a62e7c218f7ac3643aba7c4b1e600f89bc8f1575b0ba7664c41f3bb14c1911d7703e43f3f78f41920690a765472fdddce1b1922b4d442cd6e18daffb4d412d1061423a22e99498fd7b54e2d523b788fc8d6b996420cc93442937e194d1703021840d4664f1a209a139f0bcdab1b89b1a07be20a8b15d6388a8d3c998aea8bd7bd8ae5d3763508042808b127f25e6761597363b8a640f84cc46ac09f212781510e3a6fa25272ddfeaf45e6c88009162305ae423515660463761d280f262f46409ec5d7e809887d0cccc42b82cd088dbfaddfc0b6a6ad3de2e5c50b2ec0dd8b88abc7920166a322416f250bfb0ec757191981075fc60810442d2f4b0e248c8d70bc0f5dc610c974b2a6c086b5c1250fde481857cdb7c20269a81688559588a0b29c7768c13145cc78f4a6806132a624b1b9fb1cfa9c42793559299348d8a93386efc96867ace0e6bf5088090ea876301f45d055b64527516da995b43cda2af52fa96ffc8d08d817ad5ab087805f3552b7c3fdac8db8ac1011fd799ac37982d59474546717d6fe914bae3314a85666557ffbaee830a3e29bd355b245ec3f92346d0c659deb7263a30b5773028ef088545f1092df020a1990bd1076f02eb6e84133309fcaf66ad619b6ed8afe6df78b80de71ad39a811a04fbf7e06cee72d7184618ab9cf96f85afacf72611360467dcc1b84446e5fdfd2d049c0bae165aff3c0bd3dfa281b0c768a8778c76ffb9731afff44754149e765e81a419da12b0447e408601627520ac65ac0a09fc138cf118d0c92f7fd949a285bd928bd3d3ac3195aa835e2b031a02763c12fea42b2501761775c68c1b16a6bba014ee05f8b0b5187455704266bf5b8b0143967767f684a6e8a21e22c2584e9386f5f55340e1e17f702cc8952be6e3bb6acdde66cea7641626f938890fae5b856f4b4bd5c2046d302a6ef6829f58e285083e23b5cb12a2424ac2655a5d9128bba9138897699229ef35b431f78bdbf250e0deccaf127635b4da5295cf9965495b689536b1dcd83a7f33f4e75cec029d4ff11d18169f7a1cd0b731dced5bd392657d90a46bb7f241d1bbb0ecb1bfc59836942fec6ec6dce79ae7d43fa5e9d90ba8e9d04b8a6119b37178667afdee38ddd16e2eb3c12f41a168f72844090f39b9152439154f68739c24541716e6aed3ae884ad274fe9fb2998e26e5878310077015e40a8fa316dd4bcfc7c9e31083cfb7489bac2c04b674aaa7fe1baae06b30d74ffd5733610ba85372f6449738f6a50620411475622e057427af63adba8ab97caaa989fa1f5c74b63eff2287aa67ae66cb14c2229150e2f1508c823650b4f7b3f2520586e542da034546351123e778fcff2167c26d382862d5d35a113ecf9922c8d79a2d283a040a40da627093de07699444a77c5afb1b3d605bd8bbbd6c5b5d9a3ac565ed295c3083018fad86f70eca875850c3c67fdc278e3dc55582d1fef82e2d99d55832909e4838c1755d78ae858441fb84fd1802a7aafc85e510ae8a707377bc4f2c51768f113ae44887c954df35225cf83fcb7ca3a2fd311a9a5b8bb9269cfaf1cb640c1c9622aa4963b5d1e65b25b861ed7bb006fde2d6fbfe0c53d27d1f7c6a0bf172bcf07a0f2c502649a58cc31c7c4248bd0bd9166f20004ffcbf467205a1d2bad16787fc329ea2e6b639a895857a893f9938b5d6455e011c70c4768020d93f72bb50fb191e9f83828d8dd8dc06738a8f3a520b209a01d35ae343f586202f1f57c5aa2b4dd0a4972fdac564c2854ccb6085dc118464835ffafc9ea1f87fd7b4c8d152cab9872dd812a45de42ffe1208d42874c19c7e34d3a09d0b983dc2af91586d900f885ea436de370ed1c572ac55320c73e1fe5b015b5aad519dde4581f92dffa1fc83c2fe972cf90a13e9c1c14e4d4ba649b01e4152853bfe7c12c232ff860d7a47760af1667d3b9aa5d2b7b7086b46f0acdbfdba9a91d8baf084da411d5975008044c61cd72390f5736177e51c1e935fffdda0291dcae978a4355f66a128ea3f0f2d2da18a0d636ef252ffd4b62672059530743fbb040b184ad2020ade34d6b9c5330f4c780f11c2ac915203bf7fea9976ca0e604aec73ca4346a6f71c8738d6a05747e5d6af09ff45df04e5cd9b0e9719915190394e078d887f5c1f1d7975f33a4b61c8af37cce50edafa0e65f7a0f60105e922e1fca7e0ac0b0a4f56b71be74277b7b9009a7cf23b7417f9a491ea9eb479389f8d2ace14c8526214b767f616fee115c432b33fc9066789526ff272edba43c4c352bc7ebeeed7135a8e6ec6eecdd7aeec6cbaa813db5a1167f40515e25ffb332163cdf2af8c365472a08cb878db026cf951444c3ec14a9bd4c841a590d36b7da2e3259c44d8c93eeb313f4f8f3b92237aaa9187a4f23a9a7354dc7712a28ebcc462c84726709ee29b024b111d228e9636c896be1fd0053dbdfdb5897a251d5d704cb80e2f4eb95121168d271e1b5ce6cf928443fe935c89ceaeaf64b5c158590a17ffbd9f6e914f7fceef7df9561ab413838c88e5a5e71e590462fab2996a186929b167eeb6248c0837e06b7ea8f07590c0eac93923f86bc128567bd35108f34015ec6186779c721767fe649f00091c896a5f81d6c4986d0b6c5e472042bd2773c1a230f776d24c26decebc39ffca709e496584daf676a626330182a69d164fe3b59234bf9bf2afdb755ccaefed9e5d82ea096e7bc64922093d425fd1ba4c3c68e16de99273f2130c00a5cf7438ad51d72bd592e84da872c4f78e155f46985901251b66cbe11a9b1f6d43307867dfb89ace69daa83762ba637142df6ea4e56f6095db82573c2859e5078316efc7f4bc8f134a559bc27cd6c21838f5bce62786cd52cd7108ab2b7d5ce74079f53681563473ed25058c34ef77c5a433e02dbf1444ff5e433872049a3f075c449b7966672c0925c884085d8319781cf3d8dab752dffcb2fe58bed32d3ea57477e096c536d314929b95d390b1178a45772fae25edab28a45113bfc0314bc044b0760cb7d85819e2a61ae7a328954c48b21475952368d1096017b377376692fd8a125acd6782721a1f8ac9a0f1c18b703b0410633a6f75f264108fd4c00a03f86c2ba9da2fd6735c8d51851aab4ea66fe5a4ca4cac2745e436543242ccf676512b4877ace4c4f8a91601994210b2be49c29df7a6f7e3056585ddbfdaec2283328fae7f6547d5c0205f0f22faad837fbe6a4592a16552cc25ef8ae5b3cd08b98f21303497238f10c671cac7e772b6623762073a754b1bf7a795d47878c9d0b19d63f745dfe97e740a240f378a2abb3fbcc6027834da817ad5c664757d7e2378689e4c71fb0906efcb73209a4fe1a9d7c8ea9e2644d513492ff17a2e4c804b01113d84c084289e60aca9637c5ce13127a7c3d495efca9626c04a79b967c9a2d50647d1f9e7c2a236ec3018f7f8c6862a8232081262f678392816af6e6d68802489db1a4139c34b9f31168c3fdbd6ea03204a116391fdc056716e3e566e1130bb6a72e16f413808399187a29aa556e4f20ff5ba9b4714c511a38abd98758efaa62f462b7b2aeb348a55a9a7b7584e1f23e51c060efa2089e3ee76b797b4228d182f75c0af0204ec7c870aa4dbfef9b3ea01b25a1ac8ee90f748675e7dd74e6811ac72fc03d511d886e4a79064ee7e6f5b48cc150944bed4b1900648318e1f3eb867ab54b3b708a97b70c6cfe57fad14f71926b3aa4c0fb38e1d580d855728aad2959645d1a9bbf27dd35966056d0ca347b5721bf85c9a6a4edc94817509630ef737d8f76fe1ea0a1df7833547e7c7d7e0c33de4e9fdeacf5fd9dda9168fd694900af8cb7bef6c968c099a77f8c2f7b46c123816675c01cce76e3706223f4cedbd4fee649cb14061d42768a73a881c3fb1810b6a7cd430c8ba504aa8fe54d3b198ca0819909bcf441148223f3648059ef4f601af286d28c791e7ce67bd0a89d1214b3c9984c6a7c87c4d54e58c8f726f3f1a2657b77345f3139a04314e6f77406fe62a8693edc72f75dc448a2e1d93596df0fc672109102afbda08161c38c810f53a778b2dc1aac11641b3a290c3e6bc579cd27cadecdc20b4b9a979b6eb8256b1e291242ad314d683adf0388c72c8911fefe33eb065aa23eca9b5832875d4e7ad37b358439a04153009dcb9f1bb52d4c3f788faa4137dc1e97e4e9011c885e8d815e4e4236937cb41d560900ccfc37fdc85af20466531fa19a83487a7ac908a90e5232fb9c0be42517a77fd2aecf9ebbd0c961b1b261accd67a3ad5cbc94358cef65fed2fcc3c4ee94499e7017094c0578cb79713367c0bf1563b8821428b51e639714a1698fce6a2e96b84fa525780dc0631897568f66410699ed8f604c82786d8b534534e15e6b849c66d78cebcab6927611de23a073464a954b6c20a61668b8bc16218dce4d66e6b0e8f44fcc46e2253410779ac17090d75497bce44a8a67cf36dca0ba0b9ba070c0197e3b872c1ff8440c2e8c8aecf9ea0179e79206bf39941eeea7a5dec70e52a6240306dc6546e9ece1e9f7b093e149f681a1a33595347eaf4db91c9ee5169c637b4db2ad8c4e3fe5312ece65fbbefe4d62dda8bf3da0fc92e44da62153f055000c5a4ea63c6817210c56e299620e56eff4c37a17d28e40e7d3d29623306da578670b1fee5d847b1c9414d381fb67b37f48a3cc3f9a6a87a04f27ca4dfa1bd4fd208e4dfb622c60cd2d7509faeca3bc1604ff608dc8567602411ddb44240f540e00d77fa8120eb9a4e6cff498159d92ae8b2e1dc60168cf51cceef5c39b7ebaffedcf5d728074d1958531b173359e4bcdc060158cba11e38130c12b8e8a0533381810467b0b1a87f98381ad1a28ddb6c849db6bb50e05de4e0ac05e5cd528851533326147ab39615082f39e5893c9bdf179c500ef55c99e854f43ceb471932d80e26e615943a0ca3f65df303f0e0d5d7bf402a3b702a48865c4d9658fa70ae39d152833b0742288dc9f40bb8018b088a8443d89b9380cee184ec7f53440a108dd532e43b40da1801b55c4798da4e445d39ef8809f3331ba0883e6ad7d6a3948809a549d49b817dfd6aaf47b8355b4e9ee2f8e808e75cad83093731cf86ef95412a6c56836ee29a35c24d347883a7bc4419f20e333462babb6cd2427be94bc1e2df9963174ab92766d07f427d36bfae33cca143d523c13e3473043aa47660a941fec0cd97cc4279b4a59eafe6169d4c980c31fab6eb2fea7004c921cf06df4f67f59db4cfc172e1832f50f29f357030d3dd1ea78ed2bf4b66b17c2b219b5b54dd6439ab78f94d1c552ae0b389ec552f6de8a49f82041627523db1996a891d65a2b53c0b36e6420306742c9739d30bc9bd616f90dd93a28deede10dc16ff2930991e361ceb1126d4cf4161407f789233c4319d514938e4f6a9eb263627e72361d394e221fab22c51d7bc298b1459fbfe362ce29a362a14e9f081f8ac88d7e70f6f0cb82f1a1c63481046625e2b3e5dc6eea74e8b7393f6d4b6d791727570deec8d4d0f3df38e972c1b9f32826105f3b83d28c24e330dd2bbf71dbd3f3271464779a5a657f9bd5917c7faf14b4428c4a8de75bfddcdd1254866750d5187e3babb1000f9de839b2da385bd7c1187c55d0ed24d485bb679f2ca86fcff2934b5deb06e96422e1e937e3ce0e988103b0b237df3d7224894f09e402fb9a9c5abe76410640b2883c22fddd2b61427e474a5e1da9ecb5bb929e884cae220a7c9af963f868849085fd6f9d8c756d2b967408da89503b38f7873ab7b5cacaf9f39fe3bb75a028f4f4c9deddda308e607f86fba91a19de9bd1e83690746bdcae6d37bf1213c023a29adda5376f605deae049eea7e293401515dbe70a238634effce6da33d2935ccb1ae21490c2265d54cee746d2ce241339763494eba417f67cae137b523e0b09f7b4f2f97e93ba413f6b1953a291b84d1019efee7dc3cee355414646c53eaa5e0b38ff9b37e810708d9dbe3e17e44f3e78be238a9c10ff74fbc1713654c69757221dc270b81cec0cca4124b9f9be3430ba97415b4792e04fac6157b8a810d76e04870d87fbd00f90bafe4465c129cfdb0057d98f16e2bd2cd700a6799ecf4ab94d7b47989c9a8fa3dba747eff400969da1563a9a466991fa527e377b458c9cac76cdfc96a12ccad536476b4d5a05b0ab67d8acd2cdc1538f3791792b7996cb76c89590abed84d64661e49885dee4ff23d170d9b9516c682be2ae91a563dbf24fdda82fe81e207604892591dccbc7e28d709305bdcc128352c2fa922e287b0513d12ce23f3a2f43136ff30df8270b10beae63b2ef19ca68e93a748d1cccda7cf3d2d0b59bd850d58528577e895417cc9362fb56cfbe56e721999202c8c19e2c07e1e7646c91910aec31b88c155f8d697b4b8bbbe9609c0c21cfd9981805e0d7f5e0064cecaff8e88982b2da0754bcb744acfede07b936d9d55ae5beec79b28427337c6a21181d2fdcf54f8dc281b8609eadac5dc1df0508c75e55eb3f93fc6df872c514b3df1c88b117cd16398277e81448a15097a4c96ead549e7d9e0c98cbc57ce3878be71ae036af6ec9250ba56a064d1bc954dfe61babd75a452dda61cb2d80bf470d556da9c8ca085e1c82cdf0d1ac9043daba25e4deba24a939259a842188af3fd1c634709ab3c05de0a025aca887ea5cba9ae5c0f2bae56ced2bb58d0f16a831bb16791ae630eb405b2993096a4659019bb2e0b49c1956daff0a2b73ad8437ae535963e544cb9bc0b567016712aca00624cdc336ddfe2117c0ee21cbf422659bca1c3dc8593c679b805c082d153485f97e0433c777e45a9732ae230510ea1cbb67952d547c9721f75aa7775bebcc85f2d7e6a7b76b2d594ebd99ad82970c617dd47486fdd0a22e1e4f2b3406d73046796458c4c9b7c34b92ab6581c49df34dc093929139e0ea164a3b2bf1c6f2a7d9be644f155ee15cbb0567ca31adee5af30408f4c6465e0153c42b4220afea236d49d26b084f7a7853ec6bc9f8700048a79f160ce7a0af2be75c58ae0435260c7d48e109bb32a1e923550c40ae5a1e3fc047bd5795d037ba40aefb65d76e7337c9498d2d5273f6376533c8707834ccf889257f1647076be4577c1bacf1173daa6bca3e20084891b4ed83c64ef03e950d341b328d3d4820b287fa41eb26bb2064f92b93b648e37321113f4fda825392b74dd52c6836e7d82debbdea8dd4afccb4efa28e56521bf43ea89119a33c725a1a3a4aa0d0ea53caa3efc9f1a9bb20a3cb9767040fbab212d23269f761d6dee0d4726a14d1717863eba8f078ee006e41cb6fbf7df4d5448c309d544267ac4379c475bac1f0d77feb8bfb052b58a164bfae8351c5674235d3a4f035cce7e6a3adbd54d54a9a80219091c60a0c3f5979a41d2a6e83371dcf83a2a47e00222418006d4ea431ea9ea3e945cee6dcdc67a7a42ac9197f15c5279d5d9403cf91088016a431230476798306d1fe22528c52e399a733771cdd21ae0f3c105a9cf0fbfe4b6755144c0c6cbcc711f1152dfb016fe5e5e0eb5a37ed0c3270b67cf7376d3e742b7ea1d92e7c9d7d0f9ffa32865637cc2b5c8a8ae1fc8595d36c73072169d93a1b8979eff355c00bc66221a42f27c1cf64d788dbef01f602b1b5c05ce39da36436a4ef2e20c4541ff67d14a6e163905ddf21b2a1e04e94b4a6e60d35672c57b50e0709d13a14d8a536e88dfa3b017c4108fff31d92415329fc174474aeaa4752190d683d946098a99bf8fa85f8b131b44292cde69e5676934266baddcd4392408ab1698e28a05421fcd1b7226ba7ed6ea3736195f817e2704ae424d6ad1c713e273bebf07e1dce3e04438dd648540a4c1c2e7593235e105ac6cc3336fa89fe404d82d595f94587cc2f3202b94139880e29465b6bc23a552cebf11177b6af98fa2493533eadd6100cbcba01646b049cb8e84a3c82812b32e950577c19d955ef4ca5e2b965e410bec42c325ce70f131f3656ad0c32cf4a0ef498d5f0ca91a6ee0093d7b62c09498f73fd13161c65b1c3cf5f55dc64a354a3d8d8472686d454be9380424f00e9d8a5c0846684e559e277ba188dd58e28307425d9402b89c2fafb439df41a5928bf9db7611b8797aa63dac44792aee5a10ce95baab8f2f70058147bb6e245638a315cb074df6c1d0ed933c613c5daf1435d14e520b7abc706537c2562c6de3667b3504af19e3d53c4290327bd1318753c4eb192a540baae5077583eeb32e4d5423fd0a19d58d5c9d238427d5660b67b570acac86fcb554fdff5a29adcb88047f7f5cc3af07dc0bdc76e90d0480555a706388482f68a3d507ada3887ff9696586b54fc862993fc066783dc401270dcb1ef0081f954826f23fd6c098d1dbebc268b07abfe6e33dfdd18aa812a32d04b775cddad26be663c0ffa280400cdbc8a36427d7a804425257450036becf00d7f39c530aee12682424b9c9f08cdfa63260a1d0de2cf4f40561a5ae27da18a59f1a39f599b2a96b1a6a42a5efdbba16db141c6a2bd4b9f5ae548a4519f34c136f63f319cb513c3e918b0533db3eeb6cda45a7ab2b1573bcd00b6b99dee868084e11deb9ee765bad455c512bdcde74b3c6a296c178da43e595998f7f3d986f314eb63b6eb945935f5e9ad63130a769b32d85e8b0e687da70cd36d77d4374f0c3b3e319c70ca6a06e39dd5cc8503a5b0da6593dccd6db4eff0e2f0b638458c194f718bf51f6ef6977950dd55c1e51364345eeb34f46303258aac5560b26053e3fd3198e4df8d0adf4398e5b4b11f798f781d35b13c9bcd53ff67a1a4c372afb7c99fbe5e905aed6de4ec4afd439d2aace83789753ee84d1cd4081961a234e76638f39602f3637535e482c1432fc365c40ffeefcb940e615c1d504db0b5a5b91fcaff01d8fe2cf0b0d29e1635f0a3a8e3cf7f62484a05c4a354a2aae433071dadb9bb3769290570ddae3e08d92870462b086bf04815ecfc4e1746f3878188fea1585a32adb38209b84b6e42de9621909085aefe8220e8ce620db718364d9392ca5cde49b1848ad23c5af073f74f56cfab287b7e235d55ea3133446246fbc8507f85cc96a4e74c9f0dd0b0b6ce84ab1de473472736dcfde52b004a6b40b18008512814d4a1928a66461117977858a6143694a5dba6acadda1f5820d9ef313d53ec8c6dfe251599f4db34b313404a00fa1662c341e6db4500c5ab0f83ab0f82ce697ea62d4854885fbb294de3bff8e3ee25bb5319ac774476229b50c7571b1f0a5fd0d1161eeb31c3eb43e01faf7e3818748b789aa28efadbc38c353c682bf505d846494437d0aa76e805c43994d5a0338596ca55c506708542b1119573dac97a8d2cab955ad36bb4ce084c6e5f4cc11a7cafb496908f769f3f2a817eed02efd2345b8a9834625919c6ec280a89077db077f02037d7e5e49b5e95d0cd05a62738acacc5570c2d9454a3691d1a89641ff4549cf091cc7cafe1c5d02810e722f6b36a778059c911e2dc7d1146079d03d7b864e15195d8a42614f56f8980664d8c400cf27a0b2666e4e24328d83f8a2d5421a6f0f3d4014999190d74fbd188e2dd7cf5c52fec062cc0b1243bb0e4e0d78b9670279b9ac68ee1af182e80fb20889fedf78e7f967de1bedbc038ff74c86f3c3ffaa8c2bd9d777259108c1fbf08e40f../../../usr/src/kernels/2.6.32-042stab106.2build@rootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootrootvzkernel-2.6.32-042stab106.2.src.rpmkernelvzkernelvzkernel-i686vzeventmodvzquotamodrhel-kernelkernel-i686kernel-drmkernel-drm-nouveaukernel-modesetkernel-uname-ropenvswitch-kmodvzkernelvzkernel(x86-32)       rpmlib(VersionedDependencies)fileutilsmodule-init-toolsinitscriptskernel-firmware/sbin/grubby/sbin/new-kernel-pkg/sbin/mkinitrd/sbin/new-kernel-pkg/sbin/new-kernel-pkg/bin/sh/bin/sh/bin/sh/bin/shrpmlib(PayloadFilesHavePrefix)rpmlib(CompressedFileNames)rpmlib(PayloadIsBzip2)3.0.3-18.11.1-12.6.32-504.12.2.el64.0-13.0.4-13.0.5-1pppisdn4k-utilsnfs-utilse2fsprogsutil-linuxjfsutilsreiserfs-utilsxfsprogsprocpsoprofileinitscriptsiptablesipw2200-firmwareiwl4965-firmwareselinux-policy-targetedsquashfs-toolswireless-toolsbfa-firmware2.4.3-33.2-321.0.7-121.37-42.121.1.7-23.6.19-22.6.13-43.2.5-6.30.9.1-27.231.3.2-12.4228.57.21.25.3-144.029-33.2.21.1-24.8.0T@Tr@T}T@Tq@T@T@T@T}Tk4Td@T_W@T7@T&@TT @T Tk@Tk@S0S@SSہ@S׌S@Si@S#@S@S@SSh@SsS"@S@SS@S@SDSDSS@S[S @SSg@S@SS8@S|@S{CS{CSt@Sr @SpShSg}@S_@SW@SO@SKSFSCSB@S=M@S9XS1oS*@S&S"@S@Sz@S 4@S@R@Ry@R@RR@RRw@R1@R@RR@R@R@Ru@RxRt@RpRnQRnQRe@R[RVRR@RIgR@-@R1R/ R)R7RRR R R@R6R@QQ@QMQ@QQY@QdQp@Q*@Q@Qޞ@QLQکQQzQɆ@Q@@Q@QQbQ@QQ@Q@Q?@QQV@Q@QQQ'@Q'@Q>@Q@QQzl@QvwQu&@Qm=@QT0QT0QHS@QGQC @Q/FQ-@Q+R@QQ@Q@QQh@P-PDP@PPrPPZP @PPPPP@P@P*P6@P@P@PP{@P5@P@P@P~P{Px@PvPvPtPtPtPr@Pp@PnPnPnPmz@Pmz@Pl(Pl(Pj@Pe@Pe@Pd?PaP\VPYPWPPy@PIPH@P@@P?UP;a@P7lP4P.2@P.2@P+@P*=P#@P"TPPPPP@P A@O~@N=,N:N:N:N98@N7N6@N5CN/N/N.@N(N%qN +N7@NNN@N N @N|@N|@N@MAMMM@M@M@M@M@ML@MWM@MM@MM(M(M?MMK@M@M@MMb@M@MMMy@M'M'M>M@M@MMx@Mx@Mx@M=MTMTMwkMwkMtMlMbSMZjMY@MQ0@MOMK@MIG@MGMGMD@MBMA^@M@ M>@M>@M:M9u@M8#M6@M0:M.@M-M,F@M'@M@M PMM\@M@L!L!L~LL8LfLr@LLeLLL@L@L@LL{LL@L~@@LuLs@LrbLnn@LjyLi(@Le3La?@La?@L[@L[@LYV@LXLXLRLQm@LN@LMxLELEL>@L=L [2.6.32-504.12.2.el6]Radomir Vrbovsky [2.6.32-504.12.1.el6]Radomir Vrbovsky [2.6.32-504.11.1.el6]Radomir Vrbovsky [2.6.32-504.10.1.el6]Radomir Vrbovsky [2.6.32-504.9.1.el6]Radomir Vrbovsky [2.6.32-504.8.1.el6]Radomir Vrbovsky [2.6.32-504.7.1.el6]Radomir Vrbovsky [2.6.32-504.6.1.el6]Radomir Vrbovsky [2.6.32-504.5.1.el6]Radomir Vrbovsky [2.6.32-504.4.1.el6]Radomir Vrbovsky [2.6.32-504.3.1.el6]Radomir Vrbovsky [2.6.32-504.2.1.el6]Radomir Vrbovsky [2.6.32-504.1.1.el6]Rafael Aquini [2.6.32-504.el6]Rafael Aquini [2.6.32-503.el6]Rafael Aquini [2.6.32-502.el6]Rafael Aquini [2.6.32-501.el6]Rafael Aquini [2.6.32-500.el6]Rafael Aquini [2.6.32-499.el6]Rafael Aquini [2.6.32-498.el6]Rafael Aquini [2.6.32-497.el6]Rafael Aquini [2.6.32-496.el6]Rafael Aquini [2.6.32-495.el6]Rafael Aquini [2.6.32-494.el6]Rafael Aquini [2.6.32-493.el6]Rafael Aquini [2.6.32-492.el6]Rafael Aquini [2.6.32-491.el6]Rafael Aquini [2.6.32-490.el6]Rafael Aquini [2.6.32-489.el6]Rafael Aquini [2.6.32-488.el6]Rafael Aquini [2.6.32-487.el6]Rafael Aquini [2.6.32-486.el6]Rafael Aquini [2.6.32-485.el6]Rafael Aquini [2.6.32-484.el6]Rafael Aquini [2.6.32-483.el6]Rafael Aquini [2.6.32-482.el6]Rafael Aquini [2.6.32-481.el6]Rafael Aquini [2.6.32-480.el6]Rafael Aquini [2.6.32-479.el6]Rafael Aquini [2.6.32-478.el6]Rafael Aquini [2.6.32-477.el6]Rafael Aquini [2.6.32-476.el6]Rafael Aquini [2.6.32-475.el6]Rafael Aquini [2.6.32-474.el6]Rafael Aquini [2.6.32-473.el6]Rafael Aquini [2.6.32-472.el6]Rafael Aquini [2.6.32-471.el6]Rafael Aquini [2.6.32-470.el6]Rafael Aquini [2.6.32-469.el6]Rafael Aquini [2.6.32-468.el6]Rafael Aquini [2.6.32-467.el6]Rafael Aquini [2.6.32-466.el6]Rafael Aquini [2.6.32-465.el6]Rafael Aquini [2.6.32-464.el6]Rafael Aquini [2.6.32-463.el6]Rafael Aquini [2.6.32-462.el6]Rafael Aquini [2.6.32-461.el6]Rafael Aquini [2.6.32-460.el6]Rafael Aquini [2.6.32-459.el6]Rafael Aquini [2.6.32-458.el6]Rafael Aquini [2.6.32-457.el6]Rafael Aquini [2.6.32-456.el6]Rafael Aquini [2.6.32-455.el6]Rafael Aquini [2.6.32-454.el6]Rafael Aquini [2.6.32-453.el6]Rafael Aquini [2.6.32-452.el6]Rafael Aquini [2.6.32-451.el6]Rafael Aquini [2.6.32-450.el6]Rafael Aquini [2.6.32-449.el6]Rafael Aquini [2.6.32-448.el6]Rafael Aquini [2.6.32-447.el6]Rafael Aquini [2.6.32-446.el6]Rafael Aquini [2.6.32-445.el6]Rafael Aquini [2.6.32-444.el6]Rafael Aquini [2.6.32-443.el6]Rafael Aquini [2.6.32-442.el6]Rafael Aquini [2.6.32-441.el6]Rafael Aquini [2.6.32-440.el6]Rafael Aquini [2.6.32-439.el6]Rafael Aquini [2.6.32-438.el6]Rafael Aquini [2.6.32-437.el6]Rafael Aquini [2.6.32-436.el6]Rafael Aquini [2.6.32-435.el6]Rafael Aquini [2.6.32-434.el6]Rafael Aquini [2.6.32-433.el6]Rafael Aquini [2.6.32-432.el6]Rafael Aquini [2.6.32-431.el6]Rafael Aquini [2.6.32-430.el6]Rafael Aquini [2.6.32-429.el6]Rafael Aquini [2.6.32-428.el6]Rafael Aquini [2.6.32-427.el6]Rafael Aquini [2.6.32-426.el6]Rafael Aquini [2.6.32-425.el6]Rafael Aquini [2.6.32-424.el6]Rafael Aquini [2.6.32-423.el6]Rafael Aquini [2.6.32-422.el6]Rafael Aquini [2.6.32-421.el6]Rafael Aquini [2.6.32-420.el6]Rafael Aquini [2.6.32-419.el6]Rafael Aquini [2.6.32-418.el6]Rafael Aquini [2.6.32-417.el6]Rafael Aquini [2.6.32-416.el6]Rafael Aquini [2.6.32-415.el6]Rafael Aquini [2.6.32-414.el6]Rafael Aquini [2.6.32-413.el6]Rafael Aquini [2.6.32-412.el6]Rafael Aquini [2.6.32-411.el6]Rafael Aquini [2.6.32-410.el6]Rafael Aquini [2.6.32-409.el6]Rafael Aquini [2.6.32-408.el6]Rafael Aquini [2.6.32-407.el6]Rafael Aquini [2.6.32-406.el6]Rafael Aquini [2.6.32-405.el6]Rafael Aquini [2.6.32-404.el6]Rafael Aquini [2.6.32-403.el6]Rafael Aquini [2.6.32-402.el6]Rafael Aquini [2.6.32-401.el6]Rafael Aquini [2.6.32-400.el6]Rafael Aquini [2.6.32-399.el6]Rafael Aquini [2.6.32-398.el6]Jarod Wilson [2.6.32-397.el6]Jarod Wilson [2.6.32-396.el6]Jarod Wilson [2.6.32-395.el6]Jarod Wilson [2.6.32-394.el6]Jarod Wilson [2.6.32-393.el6]Jarod Wilson [2.6.32-392.el6]Jarod Wilson [2.6.32-391.el6]Jarod Wilson [2.6.32-390.el6]Jarod Wilson [2.6.32-389.el6]Jarod Wilson [2.6.32-388.el6]Jarod Wilson [2.6.32-387.el6]Jarod Wilson [2.6.32-386.el6]Jarod Wilson [2.6.32-385.el6]Jarod Wilson [2.6.32-384.el6]Jarod Wilson [2.6.32-383.el6]Jarod Wilson [2.6.32-382.el6]Jarod Wilson [2.6.32-381.el6]Jarod Wilson [2.6.32-380.el6]Jarod Wilson [2.6.32-379.el6]Jarod Wilson [2.6.32-378.el6]Jarod Wilson [2.6.32-377.el6]Jarod Wilson [2.6.32-376.el6]Jarod Wilson [2.6.32-375.el6]Jarod Wilson [2.6.32-374.el6]Jarod Wilson [2.6.32-373.el6]Jarod Wilson [2.6.32-372.el6]Jarod Wilson [2.6.32-371.el6]Jarod Wilson [2.6.32-370.el6]Jarod Wilson [2.6.32-369.el6]Jarod Wilson [2.6.32-368.el6]Jarod Wilson [2.6.32-367.el6]Jarod Wilson [2.6.32-366.el6]Jarod Wilson [2.6.32-365.el6]Jarod Wilson [2.6.32-364.el6]Jarod Wilson [2.6.32-363.el6]Jarod Wilson [2.6.32-362.el6]Jarod Wilson [2.6.32-361.el6]Jarod Wilson [2.6.32-360.el6]Jarod Wilson [2.6.32-359.el6]Jarod Wilson [2.6.32-358.el6]Jarod Wilson [2.6.32-357.el6]Jarod Wilson [2.6.32-356.el6]Jarod Wilson [2.6.32-355.el6]Jarod Wilson [2.6.32-354.el6]Jarod Wilson [2.6.32-353.el6]Jarod Wilson [2.6.32-352.el6]Jarod Wilson [2.6.32-351.el6]Jarod Wilson [2.6.32-350.el6]Jarod Wilson [2.6.32-349.el6]Jarod Wilson [2.6.32-348.el6]Jarod Wilson [2.6.32-347.el6]Jarod Wilson [2.6.32-346.el6]Jarod Wilson [2.6.32-345.el6]Jarod Wilson [2.6.32-344.el6]Jarod Wilson [2.6.32-343.el6]Jarod Wilson [2.6.32-342.el6]Jarod Wilson [2.6.32-341.el6]Jarod Wilson [2.6.32-340.el6]Jarod Wilson [2.6.32-339.el6]Jarod Wilson [2.6.32-338.el6]Jarod Wilson [2.6.32-337.el6]Jarod Wilson [2.6.32-336.el6]Jarod Wilson [2.6.32-335.el6]Jarod Wilson [2.6.32-334.el6]Jarod Wilson [2.6.32-333.el6]Jarod Wilson [2.6.32-332.el6]Jarod Wilson [2.6.32-331.el6]Jarod Wilson [2.6.32-330.el6]Jarod Wilson [2.6.32-329.el6]Jarod Wilson [2.6.32-328.el6]Jarod Wilson [2.6.32-327.el6]Jarod Wilson [2.6.32-326.el6]Jarod Wilson [2.6.32-325.el6]Jarod Wilson [2.6.32-324.el6]Jarod Wilson [2.6.32-323.el6]Jarod Wilson [2.6.32-322.el6]Jarod Wilson [2.6.32-321.el6]Jarod Wilson [2.6.32-320.el6]Jarod Wilson [2.6.32-319.el6]Jarod Wilson [2.6.32-318.el6]Jarod Wilson [2.6.32-317.el6]Jarod Wilson [2.6.32-316.el6]Jarod Wilson [2.6.32-315.el6]Jarod Wilson [2.6.32-314.el6]Jarod Wilson [2.6.32-313.el6]Jarod Wilson [2.6.32-312.el6]Jarod Wilson [2.6.32-311.el6]Jarod Wilson [2.6.32-310.el6]Jarod Wilson [2.6.32-309.el6]Jarod Wilson [2.6.32-308.el6]Jarod Wilson [2.6.32-307.el6]Jarod Wilson [2.6.32-306.el6]Jarod Wilson [2.6.32-305.el6]Jarod Wilson [2.6.32-304.el6]Jarod Wilson [2.6.32-303.el6]Jarod Wilson [2.6.32-302.el6]Jarod Wilson [2.6.32-301.el6]Jarod Wilson [2.6.32-300.el6]Jarod Wilson [2.6.32-299.el6]Jarod Wilson [2.6.32-298.el6]Jarod Wilson [2.6.32-297.el6]Jarod Wilson [2.6.32-296.el6]Jarod Wilson [2.6.32-295.el6]Jarod Wilson [2.6.32-294.el6]Jarod Wilson [2.6.32-293.el6]Jarod Wilson [2.6.32-292.el6]Jarod Wilson [2.6.32-291.el6]Jarod Wilson [2.6.32-290.el6]Jarod Wilson [2.6.32-289.el6]Jarod Wilson [2.6.32-288.el6]Jarod Wilson [2.6.32-287.el6]Jarod Wilson [2.6.32-286.el6]Jarod Wilson [2.6.32-285.el6]Jarod Wilson [2.6.32-284.el6]Jarod Wilson [2.6.32-283.el6]Jarod Wilson [2.6.32-282.el6]Jarod Wilson [2.6.32-281.el6]Jarod Wilson [2.6.32-280.el6]Jarod Wilson [2.6.32-279.el6]Jarod Wilson [2.6.32-278.el6]Jarod Wilson [2.6.32-277.el6]Jarod Wilson [2.6.32-276.el6]Jarod Wilson [2.6.32-275.el6]Jarod Wilson [2.6.32-274.el6]Jarod Wilson [2.6.32-273.el6]Jarod Wilson [2.6.32-272.el6]Jarod Wilson [2.6.32-271.el6]Jarod Wilson [2.6.32-270.el6]Jarod Wilson [2.6.32-269.el6]Jarod Wilson [2.6.32-268.el6]Aristeu Rozanski [2.6.32-267.el6]Aristeu Rozanski [2.6.32-266.el6]Aristeu Rozanski [2.6.32-265.el6]Aristeu Rozanski [2.6.32-264.el6]Aristeu Rozanski [2.6.32-263.el6]Aristeu Rozanski [2.6.32-262.el6]Aristeu Rozanski [2.6.32-261.el6]Aristeu Rozanski [2.6.32-260.el6]Aristeu Rozanski [2.6.32-259.el6]Aristeu Rozanski [2.6.32-258.el6]Aristeu Rozanski [2.6.32-257.el6]Aristeu Rozanski [2.6.32-256.el6]Aristeu Rozanski [2.6.32-255.el6]Aristeu Rozanski [2.6.32-254.el6]Aristeu Rozanski [2.6.32-253.el6]Aristeu Rozanski [2.6.32-252.el6]Aristeu Rozanski [2.6.32-251.el6]Aristeu Rozanski [2.6.32-250.el6]Aristeu Rozanski [2.6.32-249.el6]Aristeu Rozanski [2.6.32-248.el6]Aristeu Rozanski [2.6.32-247.el6]Aristeu Rozanski [2.6.32-246.el6]Aristeu Rozanski [2.6.32-245.el6]Aristeu Rozanski [2.6.32-244.el6]Aristeu Rozanski [2.6.32-243.el6]Aristeu Rozanski [2.6.32-242.el6]Aristeu Rozanski [2.6.32-241.el6]Aristeu Rozanski [2.6.32-240.el6]Aristeu Rozanski [2.6.32-239.el6]Aristeu Rozanski [2.6.32-238.el6]Aristeu Rozanski [2.6.32-237.el6]Aristeu Rozanski [2.6.32-236.el6]Aristeu Rozanski [2.6.32-235.el6]Aristeu Rozanski [2.6.32-234.el6]Aristeu Rozanski [2.6.32-233.el6]Aristeu Rozanski [2.6.32-232.el6]Aristeu Rozanski [2.6.32-231.el6]Aristeu Rozanski [2.6.32-230.el6]Aristeu Rozanski [2.6.32-229.el6]Aristeu Rozanski [2.6.32-228.el6]Aristeu Rozanski [2.6.32-227.el6]Aristeu Rozanski [2.6.32-226.el6]Aristeu Rozanski [2.6.32-225.el6]Aristeu Rozanski [2.6.32-224.el6]Aristeu Rozanski [2.6.32-223.el6]Aristeu Rozanski [2.6.32-222.el6]Aristeu Rozanski [2.6.32-221.el6]Aristeu Rozanski [2.6.32-220.el6]Aristeu Rozanski [2.6.32-219.el6]Aristeu Rozanski [2.6.32-218.el6]Aristeu Rozanski [2.6.32-217.el6]Aristeu Rozanski [2.6.32-216.el6]Aristeu Rozanski [2.6.32-215.el6]Aristeu Rozanski [2.6.32-214.el6]Aristeu Rozanski [2.6.32-213.el6]Aristeu Rozanski [2.6.32-212.el6]Aristeu Rozanski [2.6.32-211.el6]Aristeu Rozanski [2.6.32-210.el6]Aristeu Rozanski [2.6.32-209.el6]Aristeu Rozanski [2.6.32-208.el6]Aristeu Rozanski [2.6.32-207.el6]Aristeu Rozanski [2.6.32-206.el6]Aristeu Rozanski [2.6.32-205.el6]Kyle McMartin [2.6.32-204.el6]Kyle McMartin [2.6.32-203.el6]Aristeu Rozanski [2.6.32-202.el6]Aristeu Rozanski [2.6.32-201.el6]Aristeu Rozanski [2.6.32-200.el6]Aristeu Rozanski [2.6.32-199.el6]Kyle McMartin [2.6.32-198.el6]Aristeu Rozanski [2.6.32-197.el6]Aristeu Rozanski [2.6.32-196.el6]Aristeu Rozanski [2.6.32-195.el6]Aristeu Rozanski [2.6.32-194.el6]Aristeu Rozanski [2.6.32-193.el6]Aristeu Rozanski [2.6.32-192.el6]Kyle McMartin [2.6.32-191.el6]Aristeu Rozanski [2.6.32-190.el6]Aristeu Rozanski [2.6.32-189.el6]Kyle McMartin [2.6.32-188.el6]Kyle McMartin [2.6.32-187.el6]Aristeu Rozanski [2.6.32-186.el6]Aristeu Rozanski [2.6.32-185.el6]Aristeu Rozanski [2.6.32-184.el6]Kyle McMartin [2.6.32-183.el6]Aristeu Rozanski [2.6.32-182.el6]Kyle McMartin [2.6.32-181.el6]Aristeu Rozanski [2.6.32-180.el6]Aristeu Rozanski [2.6.32-179.el6]Kyle McMartin [2.6.32-178.el6]Aristeu Rozanski [2.6.32-177.el6]Aristeu Rozanski [2.6.32-176.el6]Kyle McMartin [2.6.32-175.el6]Aristeu Rozanski [2.6.32-174.el6]Aristeu Rozanski [2.6.32-173.el6]Kyle McMartin [2.6.32-172.el6]Kyle McMartin [2.6.32-171.el6]Kyle McMartin [2.6.32-170.el6]Aristeu Rozanski [2.6.32-169.el6]Kyle McMartin [2.6.32-168.el6]Aristeu Rozanski [2.6.32-167.el6]Kyle McMartin [2.6.32-166.el6]Aristeu Rozanski [2.6.32-165.el6]Kyle McMartin [2.6.32-164.el6]Aristeu Rozanski [2.6.32-163.el6]Aristeu Rozanski [2.6.32-162.el6]Kyle McMartin [2.6.32-161.el6]Aristeu Rozanski [2.6.32-160.el6]Aristeu Rozanski [2.6.32-159.el6]Aristeu Rozanski [2.6.32-158.el6]Aristeu Rozanski [2.6.32-157.el6]Aristeu Rozanski [2.6.32-156.el6]Aristeu Rozanski [2.6.32-155.el6]Aristeu Rozanski [2.6.32-154.el6]Aristeu Rozanski [2.6.32-153.el6]Aristeu Rozanski [2.6.32-152.el6]Aristeu Rozanski [2.6.32-151.el6]Aristeu Rozanski [2.6.32-150.el6]Aristeu Rozanski [2.6.32-149.el6]Aristeu Rozanski [2.6.32-148.el6]Aristeu Rozanski [2.6.32-147.el6]Aristeu Rozanski [2.6.32-146.el6]Aristeu Rozanski [2.6.32-145.el6]Aristeu Rozanski [2.6.32-144.el6]Aristeu Rozanski [2.6.32-143.el6]Aristeu Rozanski [2.6.32-142.el6]Aristeu Rozanski [2.6.32-141.el6]Aristeu Rozanski [2.6.32-140.el6]Aristeu Rozanski [2.6.32-139.el6]Aristeu Rozanski [2.6.32-138.el6]Aristeu Rozanski [2.6.32-137.el6]Aristeu Rozanski [2.6.32-136.el6]Aristeu Rozanski [2.6.32-135.el6]Aristeu Rozanski [2.6.32-134.el6]Aristeu Rozanski [2.6.32-133.el6]Aristeu Rozanski [2.6.32-132.el6]Aristeu Rozanski [2.6.32-131.el6]Aristeu Rozanski [2.6.32-130.el6]Aristeu Rozanski [2.6.32-129.el6]Aristeu Rozanski [2.6.32-128.el6]Aristeu Rozanski [2.6.32-127.el6]Aristeu Rozanski [2.6.32-126.el6]Aristeu Rozanski [2.6.32-125.el6]Aristeu Rozanski [2.6.32-124.el6]Aristeu Rozanski [2.6.32-123.el6]Aristeu Rozanski [2.6.32-122.el6]Aristeu Rozanski [2.6.32-121.el6]Aristeu Rozanski [2.6.32-120.el6]Aristeu Rozanski [2.6.32-119.el6]Aristeu Rozanski [2.6.32-118.el6]Aristeu Rozanski [2.6.32-117.el6]Aristeu Rozanski [2.6.32-116.el6]Aristeu Rozanski [2.6.32-115.el6]Aristeu Rozanski [2.6.32-114.el6]Aristeu Rozanski [2.6.32-113.el6]Aristeu Rozanski [2.6.32-112.el6]Aristeu Rozanski [2.6.32-111.el6]Aristeu Rozanski [2.6.32-110.el6]Aristeu Rozanski [2.6.32-109.el6]Aristeu Rozanski [2.6.32-108.el6]Aristeu Rozanski [2.6.32-107.el6]Aristeu Rozanski [2.6.32-106.el6]Aristeu Rozanski [2.6.32-105.el6]Aristeu Rozanski [2.6.32-104.el6]Aristeu Rozanski [2.6.32-103.el6]Aristeu Rozanski [2.6.32-102.el6]Aristeu Rozanski [2.6.32-101.el6]Aristeu Rozanski [2.6.32-100.el6]Aristeu Rozanski [2.6.32-99.el6]Aristeu Rozanski [2.6.32-98.el6]Aristeu Rozanski [2.6.32-97.el6]Aristeu Rozanski [2.6.32-96.el6]Aristeu Rozanski [2.6.32-95.el6]Aristeu Rozanski [2.6.32-94.el6]Aristeu Rozanski [2.6.32-93.el6]Aristeu Rozanski [2.6.32-92.el6]Aristeu Rozanski [2.6.32-91.el6]Aristeu Rozanski [2.6.32-90.el6]Aristeu Rozanski [2.6.32-89.el6]Aristeu Rozanski [2.6.32-88.el6]Aristeu Rozanski [2.6.32-87.el6]Aristeu Rozanski [2.6.32-86.el6]Aristeu Rozanski [2.6.32-85.el6]Aristeu Rozanski [2.6.32-84.el6]Aristeu Rozanski [2.6.32-83.el6]Aristeu Rozanski [2.6.32-82.el6]Aristeu Rozanski [2.6.32-81.el6]Aristeu Rozanski [2.6.32-80.el6]Aristeu Rozanski [2.6.32-79.el6]Aristeu Rozanski [2.6.32-78.el6]Aristeu Rozanski [2.6.32-77.el6]Aristeu Rozanski [2.6.32-76.el6]Aristeu Rozanski [2.6.32-75.el6]Aristeu Rozanski [2.6.32-74.el6]Aristeu Rozanski [2.6.32-73.el6]Aristeu Rozanski [2.6.32-72.el6]Aristeu Rozanski [2.6.32-71.el6]Aristeu Rozanski [2.6.32-70.el6]Aristeu Rozanski [2.6.32-69.el6]Aristeu Rozanski [2.6.32-68.el6]Aristeu Rozanski [2.6.32-67.el6]Aristeu Rozanski [2.6.32-66.el6]Aristeu Rozanski [2.6.32-65.el6]Aristeu Rozanski [2.6.32-64.el6]Aristeu Rozanski [2.6.32-63.el6]Aristeu Rozanski [2.6.32-62.el6]Aristeu Rozanski [2.6.32-61.el6]Aristeu Rozanski [2.6.32-60.el6]Aristeu Rozanski [2.6.32-59.el6]Aristeu Rozanski [2.6.32-58.el6]Aristeu Rozanski [2.6.32-57.el6]Aristeu Rozanski [2.6.32-56.el6]Aristeu Rozanski [2.6.32-55.el6]Aristeu Rozanski [2.6.32-54.el6]Aristeu Rozanski [2.6.32-53.el6]Aristeu Rozanski [2.6.32-52.el6]Aristeu Rozanski [2.6.32-51.el6]Aristeu Rozanski [2.6.32-50.el6]Aristeu Rozanski [2.6.32-49.el6]Aristeu Rozanski [2.6.32-48.el6]Aristeu Rozanski [2.6.32-47.el6]Aristeu Rozanski [2.6.32-46.el6]Aristeu Rozanski [2.6.32-45.el6]Aristeu Rozanski [2.6.32-44.el6]Aristeu Rozanski [2.6.32-43.el6]Aristeu Rozanski [2.6.32-42.el6]Aristeu Rozanski [2.6.32-41.el6]Aristeu Rozanski [2.6.32-40.el6]Aristeu Rozanski [2.6.32-39.el6]Aristeu Rozanski [2.6.32-38.el6]Aristeu Rozanski [2.6.32-37.el6]Aristeu Rozanski [2.6.32-36.el6]Aristeu Rozanski [2.6.32-35.el6]Aristeu Rozanski [2.6.32-34.el6]Aristeu Rozanski [2.6.32-33.el6]Aristeu Rozanski [2.6.32-32.el6]Aristeu Rozanski [2.6.32-31.el6]Aristeu Rozanski [2.6.32-30.el6]Aristeu Rozanski [2.6.32-29.el6]Aristeu Rozanski [2.6.32-28.el6]Aristeu Rozanski [2.6.32-27.el6]Aristeu Rozanski [2.6.32-26.el6]Aristeu Rozanski [2.6.32-25.el6]Aristeu Rozanski [2.6.32-24.el6]Aristeu Rozanski [2.6.32-23.el6]Aristeu Rozanski [2.6.32-22.el6]Aristeu Rozanski [2.6.32-21.el6]Aristeu Rozanski [2.6.32-20.el6]Aristeu Rozanski [2.6.32-19.el6]Aristeu Rozanski [2.6.32-18.el6]Aristeu Rozanski [2.6.32-17.el6]Aristeu Rozanski [2.6.32-16.el6]Aristeu Rozanski [2.6.32-15.el6]Aristeu Rozanski [2.6.32-14.el6]Aristeu Rozanski [2.6.32-13.el6]Aristeu Rozanski [2.6.32-12.el6]Aristeu Rozanski [2.6.32-11.el6]Aristeu Rozanski [2.6.32-10.el6]Aristeu Rozanski [2.6.32-9.el6]Aristeu Rozanski [2.6.32-8.el6]Aristeu Rozanski [2.6.32-7.el6]Aristeu Rozanski [2.6.32-6.el6]Aristeu Rozanski [2.6.32-5.el6]Aristeu Rozanski [2.6.32-4.el6]Aristeu Rozanski [2.6.32-3.el6]Aristeu Rozanski [2.6.32-2.el6]Aristeu Rozanski [2.6.32-1.el6]Aristeu Rozanski [2.6.32-0.54.el6]Aristeu Rozanski [2.6.32-0.53.el6]Aristeu Rozanski [2.6.32-0.52.el6]Aristeu Rozanski [2.6.32-0.51.el6]Aristeu Rozanski [2.6.32-0.50.el6]- [infiniband] core: Prevent integer overflow in ib_umem_get address arithmetic (Doug Ledford) [1181173 1179327] {CVE-2014-8159}- [fs] splice: perform generic write checks (Eric Sandeen) [1163798 1155900] {CVE-2014-7822}- [virt] kvm: excessive pages un-pinning in kvm_iommu_map error path (Jacob Tanenbaum) [1156520 1156521] {CVE-2014-8369} - [x86] crypto: Add support for 192 & 256 bit keys to AESNI RFC4106 (Jarod Wilson) [1184332 1176211] - [block] nvme: Clear QUEUE_FLAG_STACKABLE (David Milburn) [1180555 1155715] - [net] netfilter: conntrack: disable generic tracking for known protocols (Daniel Borkmann) [1182071 1114697] {CVE-2014-8160} - [xen] pvhvm: Fix vcpu hotplugging hanging (Vitaly Kuznetsov) [1179343 1164278] - [xen] pvhvm: Don't point per_cpu(xen_vpcu, 33 and larger) to shared_info (Vitaly Kuznetsov) [1179343 1164278] - [xen] enable PVHVM VCPU placement when using more than 32 CPUs (Vitaly Kuznetsov) [1179343 1164278] - [xen] support large numbers of CPUs with vcpu info placement (Vitaly Kuznetsov) [1179343 1164278]- [netdrv] tg3: Change nvram command timeout value to 50ms (Ivan Vecera) [1182903 1176230]- [net] ipv6: increase ip6_rt_max_size to 16384 (Hannes Frederic Sowa) [1177581 1112946] - [net] ipv6: don't set DST_NOCOUNT for remotely added routes (Hannes Frederic Sowa) [1177581 1112946] - [net] ipv6: don't count addrconf generated routes against gc limit (Hannes Frederic Sowa) [1177581 1112946] - [net] ipv6: Don't put artificial limit on routing table size (Hannes Frederic Sowa) [1177581 1112946] - [scsi] bnx2fc: fix tgt spinlock locking (Maurizio Lombardi) [1179098 1079656]- [crypto] crc32c: Kill pointless CRYPTO_CRC32C_X86_64 option (Jarod Wilson) [1175509 1036212] - [crypto] testmgr: add larger crc32c test vector to test FPU path in crc32c_intel (Jarod Wilson) [1175509 1036212] - [crypto] tcrypt: Added speed test in tcrypt for crc32c (Jarod Wilson) [1175509 1036212] - [crypto] crc32c: Optimize CRC32C calculation with PCLMULQDQ instruction (Jarod Wilson) [1175509 1036212] - [crypto] crc32c: Rename crc32c-intel.c to crc32c-intel_glue.c (Jarod Wilson) [1175509 1036212]- [kernel] ipc/sem: Fully initialize sem_array before making it visible (Rik van Riel) [1172029 1165277] - [kernel] ipc/sem: synchronize semop and semctl with IPC_RMID (Rik van Riel) [1172029 1165277] - [kernel] ipc/sem: update sem_otime for all operations (Larry Woodman) [1172025 1168588] - [fs] fuse: prevent null nd panic on dentry revalidate (Brian Foster) [1172022 1162782] - [net] netfilter: ipset: timeout values corrupted on set resize (Marcelo Leitner) [1172764 1152754] - [net] netfilter: fix xt_TCPOPTSTRIP in forwarding path (Marcelo Leitner) [1172027 1135650] - [usb] ehci: Fix panic on hotplug race condition (Don Zickus) [1172024 1107010] - [usb] usb_wwan: replace release and disconnect with a port_remove hook (Stanislaw Gruszka) [1172030 1148615] - [x86] traps: stop using IST for #SS (Petr Matousek) [1172810 1172811] {CVE-2014-9322}- [fs] ext4: don't count external journal blocks as overhead (Eric Sandeen) [1168504 1163811] - [net] sctp: fix NULL pointer dereference in af->from_addr_param on malformed packet (Daniel Borkmann) [1163090 1153980] {CVE-2014-7841} - [netdrv] e100: fix typo in MDI/MDI-X eeprom check in e100_phy_init (John Greene) [1165985 1156417] - [powerpc] Add smp_mb()s to arch_spin_unlock_wait() (Gustavo Duarte) [1165986 1136224] - [powerpc] Add smp_mb() to arch_spin_is_locked() (Gustavo Duarte) [1165986 1136224] - [kernel] cpuset: PF_SPREAD_PAGE and PF_SPREAD_SLAB should be atomic flags (Aaron Tomlin) [1165002 1045310] - [documentation] cpuset: Update the cpuset flag file (Aaron Tomlin) [1165002 1045310] - [alsa] control: Make sure that id->index does not overflow (Jacob Tanenbaum) [1149140 1117312] {CVE-2014-4656} - [alsa] control: Handle numid overflow (Jacob Tanenbaum) [1149140 1117312] {CVE-2014-4656} - [s390] mm: fix SIGBUS handling (Hendrik Brueckner) [1169433 1145070] - [fs] gfs2: fix bad inode i_goal values during block allocation (Abhijith Das) [1165001 1130684] - [md] dm-thin: fix pool_io_hints to avoid looking at max_hw_sectors (Mike Snitzer) [1161420 1161421 1142773 1145230]- [fs] nfsd: don't halt scanning the DRC LRU list when there's an RC_INPROG entry (J. Bruce Fields) [1168129 1150675]- [fs] nfs: Make sure pre_change_attr is initialized correctly (Scott Mayhew) [1163214 1160042] - [usb] ehci: Fix a regression in the ISO scheduler (Gustavo Duarte) [1162072 1145805]- [s390] zcrypt: toleration of new crypto adapter hardware (Hendrik Brueckner) [1158311 1134984] - [s390] zcrypt: support for extended number of ap domains (Hendrik Brueckner) [1158311 1134984] - [md] dm-thin: fix potential for infinite loop in pool_io_hints (Mike Snitzer) [1161420 1161421 1142773 1145230]- [fs] udf: Avoid infinite loop when processing indirect ICBs (Jacob Tanenbaum) [1142319 1142320] {CVE-2014-6410} - [fs] isofs: unbound recursion when processing relocated directories (Jacob Tanenbaum) [1142268 1142269] {CVE-2014-5472 CVE-2014-5471} - [net] ipv6: delete expired route in ip6_pmtu_deliver (Hannes Frederic Sowa) [1161418 1156137] - [net] sctp: fix remote memory pressure from excessive queueing (Daniel Borkmann) [1155746 1154676] {CVE-2014-3688} - [net] sctp: fix panic on duplicate ASCONF chunks (Daniel Borkmann) [1155733 1154676] {CVE-2014-3687} - [net] sctp: fix skb_over_panic when receiving malformed ASCONF chunks (Daniel Borkmann) [1147857 1154676] {CVE-2014-3673} - [net] sctp: handle association restarts when the socket is closed (Daniel Borkmann) [1147857 1154676] - [md] dm-thin: refactor requeue_io to eliminate spinlock bouncing (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: optimize retry_bios_on_resume (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: sort the deferred cells (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: direct dispatch when breaking sharing (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: remap the bios in a cell immediately (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: defer whole cells rather than individual bios (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: factor out remap_and_issue_overwrite (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: performance improvement to discard processing (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: grab a virtual cell before looking up the mapping (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: implement thin_merge (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm: improve documentation and code clarity in dm_merge_bvec (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: adjust max_sectors_kb based on thinp blocksize (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] block: fix alignment_offset math that assumes io_min is a power-of-2 (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: throttle incoming IO (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: prefetch missing metadata pages (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-transaction-manager: add support for prefetching blocks of metadata (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin-metadata: change dm_thin_find_block to allow blocking, but not issuing, IO (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-bio-prison: switch to using a red black tree (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-bufio: evict buffers that are past the max age but retain some buffers (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-bufio: switch from a huge hash table to an rbtree (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-bufio: update last_accessed when relinking a buffer (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-bufio: use kzalloc when allocating dm_bufio_client (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin-metadata: do not allow the data block size to change (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: cleanup noflush_work to use a proper completion (Mike Snitzer) [1161420 1161421 1142773 1145230] - [md] dm-thin: fix DMERR typo in pool_status error path (Mike Snitzer) [1161420 1161421 1142773 1145230] - [fs] xfs: xlog_cil_force_lsn doesn't always wait correctly (Eric Sandeen) [1158325 1133304] - [netdrv] ixgbe: allow TXDCTL.WRTHRESH to be 1 will small ITR values (John Greene) [1158326 1132267] - [netdrv] ixgbe: Intel Change to allow itr changes without CONFIG_BQL support (John Greene) [1158326 1132267] - [video] offb: Fix setting of the pseudo-palette for >8bpp (Gerd Hoffmann) [1158328 1142450] - [video] offb: Add palette hack for qemu "standard vga" framebuffer (Gerd Hoffmann) [1158328 1142450] - [video] offb: Fix bug in calculating requested vram size (Gerd Hoffmann) [1158328 1142450] - [net] sock_queue_err_skb() dont mess with sk_forward_alloc (Jiri Benc) [1155427 1148257] - [net] guard tcp_set_keepalive() to tcp sockets (Florian Westphal) [1141744 1141746] {CVE-2012-6657} - Revert: [net] revert "bridge: Set vlan_features to allow offloads on vlans" (Vlad Yasevich) [1144442 1121991] - [x86] kvm: fix PIT timer race condition (mguzik) [1149592 1149593] {CVE-2014-3611} - [x86] kvm: vmx: handle invept and invvpid vm exits gracefull (mguzik) [1144826 1144837 1144827 1144838] {CVE-2014-3646 CVE-2014-3645}- [fs] call d_op->d_hash on last component of umount path (Abhijith Das) [1145193 1129712] - [usb] serial: memory corruption flaw (Jacob Tanenbaum) [1141401 1141402] {CVE-2014-3185} - [char] ipmi: Clear drvdata when interface is removed (Tony Camuso) [1149578 1135910] - [char] ipmi: init shadow_ipmi_smi_handlers early in ipmi_si_intf (Tony Camuso) [1149580 1139464] - [net] ipsec: update MAX_AH_AUTH_LEN to support sha512 (Herbert Xu) [1149083 1140103] - [net] revert "bridge: Set vlan_features to allow offloads on vlans" (Vlad Yasevich) [1144442 1121991] - [netdrv] virtio-net: fix big buffer receiving (Jason Wang) [1148693 1144073] - [netdrv] tg3: prevent ifup/ifdown during PCI error recovery (Ivan Vecera) [1142570 1117009]- [netdrv] revert "cxgb4: set skb->rxhash" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Use netif_set_real_num_rx/tx_queues()" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Turn on delayed ACK" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Use ULP_MODE_TCPDDP" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Debugfs dump_qp() updates" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Drop peer_abort when no endpoint found" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Detect DB FULL events and notify RDMA ULD" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Common platform specific changes for DB Drop Recovery" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: DB Drop Recovery for RDMA and LLD queues" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Add debugfs RDMA memory stats" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Add DB Overflow Avoidance" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: DB Drop Recovery for RDMA and LLD queues" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Use vmalloc() for debugfs QP dump" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Remove kfifo usage" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Include vmalloc.h for vmalloc and vfree" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: set maximal number of default RSS queues" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Remove duplicate register definitions" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Update RDMA/cxgb4 due to macro definition removal in cxgb4 driver" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Move dereference below NULL test" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fix incorrect values for MEMWIN*_APERTURE and MEMWIN*_BASE" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add functions to read memory via PCIE memory window" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Code cleanup to enable T4 Configuration File support" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add support for T4 configuration file" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add support for T4 hardwired driver configuration settings" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Don't attempt to upgrade T4 firmware when cxgb4 will end up as a slave" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix error handling in create_qp()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Dynamically allocate memory in t4_memory_rw() and get_vpd_params()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fix build error due to missing linux/vmalloc.h include" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: allocate enough data in t4_memory_rw()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Address various sparse warnings" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Remove unnecessary #ifdef condition" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Don't free chunk that we have failed to allocate" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fix unable to get UP event from the LLD" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fix initialization of SGE_CONTROL register" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: use WARN" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Chelsio FCoE offload driver submission" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: remove __dev* attributes" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add T4 filter support" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add LE hash collision bug fix path in LLD driver" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix LE hash collision bug for active open connection" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix LE hash collision bug for passive open connection" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix bug for active and passive LE hash collision path" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Use netdev_ and pr_" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fix incorrect PFVF CMASK" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Abort connections that receive unexpected streaming mode data" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Abort connections when moving to ERROR state" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Display streaming mode error only if detected in RTS" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Keep QP referenced until TID released" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Always log async errors" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Only log rx_data warnings if cpl status is non-zero" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix endpoint timeout race condition" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Don't reconnect on abort for mpa_rev 1" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Don't wakeup threads for MPAv2" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Insert hwtid in pass_accept_req instead in pass_establish" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Address sparse warnings" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: "cookie" can stay in host endianness" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix cast warning" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Allow for backward compatibility with new VPD scheme" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add register definations for T5" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add macros, structures and inline functions for T5" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Initialize T5" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Dump T5 registers" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add T5 write combining support" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Enable doorbell drop recovery only for T4 adapter" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add T5 debugfs support" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add T5 PCI ids" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Update driver version and description" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Disable SR-IOV support for PF4-7 for T5" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Add Support for Chelsio T5 adapter" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Turn off db coalescing when RDMA QPs are in use" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Add module_params to enable DB FC & Coalescing on T5" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Use DSGLs for fastreg and adapter memory writes for T5" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Map pbl buffers for dma if using DSGL" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Bump tcam_full stat and WR reply timeout" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix onchip queue support for T5" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix error return code in create_qp()" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix SQ allocation when on-chip SQ is disabled" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fix pci_device_id structure initialization with correct PF number" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Support CPL_SGE_EGR_UPDATEs encapsulated in a CPL_FW4_MSG" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Support CPL_SGE_EGR_UPDATEs encapsulated in a CPL_FW4_MSG" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: fix error recovery when t4_fw_hello returns a positive value" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Force uninitialized state if FW_ON_ADAPTER is < FW_VERSION and we're the MASTER_PF" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Correct comparisons and calculations using skb->tail and skb-transport_header" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Do not set net_device::dev_id to VI index" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix stack info leak in c4iw_create_qp()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add routines to create and remove listening IPv6 servers" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add CLIP support to store compressed IPv6 address" (Prarit Bhargava) [1140743] - [infiniband] revert "cma: Add IPv6 support for iWARP" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Add support for active and passive open connection with IPv6 address" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Handle newer firmware changes" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Use correct bit shift macros for vlan filter tuples" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix QP flush logic" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix accounting for unsignaled SQ WRs to deal with wrap" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Set arp error handler for PASS_ACCEPT_RPL messages" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Always do GTS write if cidx_inc == CIDXINC_MASK" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Advertise ~0ULL as max MR size" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Issue RI.FINI before closing when entering TERM" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: remove workqueue when driver registration fails" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: remove unnecessary pci_set_drvdata()" (Prarit Bhargava) [1140743] - [netdrv] revert "cgxb4: remove duplicate include in cxgb4.h" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Much cleaner implementation of is_t4()/is_t5()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: added much cleaner implementation of is_t4()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add new scheme to update T4/T5 firmware" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix formatting of physical address" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Make _c4iw_write_mem_dma() static" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: calls skb_set_hash" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Reserve stid 0 for T4/T5 adapters" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Include TCP as protocol when creating server filters" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Assign filter server TIDs properly" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Account for stid entries properly in case of IPv6" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add API to correctly calculate tuple fields" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: make functions static and remove dead code" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Calculate the filter server TID properly" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Server filters are supported only for IPv4" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Use cxgb4_select_ntuple to correctly calculate ntuple fields" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: allow large buffer size to have page size" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Changed FW check version to match FW binary version" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: silence shift wrapping static checker warning" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Avoid disabling PCI device for towice" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Don't retrieve stats during recovery" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix gcc warning on 32-bit arch" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fix referencing freed adapter" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Add missing neigh_release in LE-Workaround path" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Use pci_enable_msix_range() instead of pci_enable_msix()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add support to recognize 40G links" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Print adapter VPD Part Number instead of Engineering Change field" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Allow >10G ports to have multiple queues" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: LE-Workaround is not atomic in firmware" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Query firmware for T5 ULPTX MEMWRITE DSGL capabilities" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Remove unused registers and add missing ones" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Don't assume LSO only uses SGL path in t4_eth_xmit()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add more PCI device ids" (Prarit Bhargava) [1140743] - [netdrv] revert "cgxb4: Stop using ethtool SPEED_* constants" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: use remove handler as shutdown handler" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fix some small bugs in t4_sge_init_soft() when our Page Size is 64KB" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add code to dump SGE registers when hitting idma hangs" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Rectify emitting messages about SGE Ingress DMA channels being potentially stuck" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Updates for T5 SGE's Egress Congestion Threshold" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Calculate len properly for LSO path" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Treat CPL_ERR_KEEPALV_NEG_ADVICE as negative advice" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Doorbell Drop Avoidance Bug Fixes" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix underflows in c4iw_create_qp()" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix four byte info leak in c4iw_create_cq()" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Cap CQ size at T4_MAX_IQ_SIZE" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Allow loopback connections" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Always release neigh entry" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix incorrect BUG_ON conditions" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Mind the sq_sig_all/sq_sig_type QP attributes" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Default peer2peer mode to 1" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Save the correct map length for fast_reg_page_lists" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Don't leak skb in c4iw_uld_rx_handler()" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix possible memory leak in RX_PKT processing" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Ignore read reponse type 1 CQEs" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Connect_request_upcall fixes" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Update snd_seq when sending MPA messages" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Call dev_kfree/consume_skb_any instead of kfree_skb" (Prarit Bhargava) [1140743] - [netdrv] revert "cxbg4: Remove addressof casts to same type" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Adds device ID for few more Chelsio Adapters" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: set error code on kmalloc() failure" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Lock around accept/reject downcalls" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Drop RX_DATA packets if the endpoint is gone" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: rx_data() needs to hold the ep mutex" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Disable DSGL use by default" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Use the BAR2/WC path for kernel QPs and T5 devices" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Endpoint timeout fixes" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: rmb() after reading valid gen bit" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: SQ flush fix" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Max fastreg depth depends on DSGL support" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Use pr_warn_ratelimited" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Initialize reserved fields in a FW work request" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Add missing debug stats" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Use uninitialized_var()" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix over-dereference when terminating" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Save the correct mac addr for hw-loopback connections in the L2T" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: use the correct max size for firmware flash" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix endpoint mutex deadlocks" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Force T5 connections to use TAHOE congestion control" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Only allow kernel db ringing for T4 devs" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Update Kconfig to include Chelsio T5 adapter" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Decode PCIe Gen3 link speed" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix memory leaks in c4iw_alloc() error paths" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Fix vlan support" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: Add missing padding at end of struct c4iw_create_cq_resp" (Prarit Bhargava) [1140743] - [infiniband] revert "cxgb4: add missing padding at end of struct c4iw_alloc_ucontext_resp" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Decode the firmware port and module type a bit more for ethtool" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Check if rx checksum offload is enabled, while reading hardware calculated checksum" (Prarit Bhargava) [1140743] - [netdrv] revert "iw_cxgb4: Allocate and use IQs specifically for indirect interrupts" (Prarit Bhargava) [1140743] - [netdrv] revert "iw_cxgb4: Choose appropriate hw mtu index and ISS for iWARP connections" (Prarit Bhargava) [1140743] - [netdrv] revert "iw_cxgb4: don't truncate the recv window size" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Change default Interrupt Holdoff Packet Count Threshold" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fixes cxgb4 probe failure in VM when PF is exposed through PCI Passthrough" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Use FW interface to get BAR0 value" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Replaced the backdoor mechanism to access the HW memory with PCIe Window method" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Adds device ID for few more Chelsio T4 Adapters" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: remove unnecessary null test before debugfs_remove_recursive" (Prarit Bhargava) [1140743] - [netdrv] revert "iw_cxgb4: Detect Ing. Padding Boundary at run-time" (Prarit Bhargava) [1140743] - [netdrv] revert "iw_cxgb4: use firmware ord/ird resource limits" (Prarit Bhargava) [1140743] - [netdrv] revert "iw_cxgb4: display TPTE on errors" (Prarit Bhargava) [1140743] - [netdrv] revert "iw_cxgb4: work request logging feature" (Prarit Bhargava) [1140743] - [netdrv] revert "iw_cxgb4: Move common defines to cxgb4" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Add the MC1 registers to read in the interrupt handler" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fixed incorrect check for memory operation in t4_memory_rw" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: only free allocated fls" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Fix possible race condition in cleanup" (Prarit Bhargava) [1140743] - [infiniband] revert "iw_cxgb4: fix for 64-bit integer division" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Add core T4 PCI-E SR-IOV Virtual Function hardware definitions and device communication code" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Add T4 Virtual Function Scatter-Gather Engine DMA code" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Add main T4 PCI-E SR-IOV Virtual Function driver for cxgb4vf" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Add new Makefile for T4 PCI-E SR-IOV Virtual Function driver cxgb4vf" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Stitch new T4 PCI-E SR-IOV Virtual Function driver into the build" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Remove obsolete comment about the lack of a TX Timer Callback" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Use correct shift factor for extracting the SGE DMA Ingress Padding Boundary" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: remove obsolete DECLARE_PCI_UNMAP_ADDR usage" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Implement "Unhandled Interrupts" statistic" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: fix TX Queue restart" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: fix SGE resource resource deallocation bug" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Fix off-by-one error checking for the end of the mailbox delay array" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Fix bug where we were only allocating one queue in MSI mode" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: do not use PCI resources before pci_enable_device()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Use netif_set_real_num_rx/tx_queues()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: make single bit signed bitfields unsigned" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: remove call to stop TX queues at load time" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: don't implement trivial (and incorrect) ndo_select_queue()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: fix bug in Generic Receive Offload" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: fix some errors in Gather List to skb conversion" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: flesh out PCI Device ID Table" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Fail open if link_start() fails" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: add call to Firmware to reset VF State" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: minor comment/symbolic name cleanup" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: add ethtool statistics for GRO" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: fix up "Section Mismatch" compiler warning" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Advertise NETIF_F_TSO_ECN" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: fix setting unicast/multicast addresses" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Ingress Queue Entry Size needs to be 64 bytes" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: fix mailbox data/control coherency domain race" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: recover from failure in cxgb4vf_open()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Check driver parameters in the right place" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Behave properly when CONFIG_DEBUG_FS isn't defined" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Quiesce Virtual Interfaces on shutdown" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Use defined Mailbox Timeout" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: improve Kconfig dependencies" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: do vlan cleanup" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: remove __dev* attributes" (Prarit Bhargava) [1140743] - [netdrv] revert "chelsio: Use netdev_ and pr_" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Fix extraction of cpl_rx_pkt from the response queue descriptor" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Fix VLAN extraction counter increment" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Add support for Chelsio T5 adapter" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Support CPL_SGE_EGR_UPDATEs encapsulated in a CPL_FW4_MSG" (Prarit Bhargava) [1140743] - [netdrv] revert "net: cxgb4vf: Staticize local symbols" (Prarit Bhargava) [1140743] - [netdrv] revert "net: cxgb4vf: remove unnecessary pci_set_drvdata()" (Prarit Bhargava) [1140743] - [netdrv] revert "net: cxgb4vf: use DEFINE_PCI_DEVICE_TABLE" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: added much cleaner implementation of is_t4()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: make functions static and remove dead code" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Remove superfluous call to pci_disable_msix()" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4vf: Adds device Id for few more Chelsio adapters" (Prarit Bhargava) [1140743] - [netdrv] revert "cxgb4: Export symbols required by cxgb4i for ipv6 support and required defines" (Prarit Bhargava) [1140743] - [scsi] revert "libcxgbi: Add ipv6 api to driver" (Prarit Bhargava) [1140743] - [scsi] revert "cxgb4i: Add ipv6 code to driver, call into libcxgbi ipv6 api" (Prarit Bhargava) [1140743] - [scsi] revert "cxgb4i: Fix ipv6 build failure caught with randconfig" (Prarit Bhargava) [1140743] - [scsi] revert "cxgb4i: remove spurious use of rcu" (Prarit Bhargava) [1140743] - [scsi] revert "cxgb4i: Guard ipv6 code with a config check" (Prarit Bhargava) [1140743]- [kernel] futex: Fix errors in nested key ref-counting (Denys Vlasenko) [1094458] {CVE-2014-0205} - [fs] vfs: add missing __putname() in patch_mountpoint() (Ian Kent) [1135165] - [fs] nfs: Don't busy-wait on SIGKILL in __nfs_iocounter_wait (Benjamin Coddington) [1113269] - [netdrv] mlx4: add vlan_rx_register to the master ops (Doug Ledford) [1133506] - [infiniband] ocrdma: use right macro in query ah (Doug Ledford) [1133506] - [infiniband] ocrdma: resolve L2 address when creating user AH (Doug Ledford) [1133506] - [infiniband] ocrdma: get vlan tag from ib_qp_attrs (Doug Ledford) [1133506] - [infiniband] ocrdma: add default gid at index 0 (Doug Ledford) [1133506] - [infiniband] ocrdma: obtain sl from deivce structure (Doug Ledford) [1133506] - [infiniband] ocrdma: do not skip setting deffered_arm (Doug Ledford) [1133506] - [infiniband] ocrdma: Initialize the GID table while registering the device (Doug Ledford) [1133506] - [infiniband] ocrdma: Increase the size of STAG array in dev structure to 16K (Doug Ledford) [1133506] - [infiniband] ocrdma: Add missing adapter mailbox opcodes (Doug Ledford) [1133506] - [infiniband] ocrdma: Return proper value for max_mr_size (Doug Ledford) [1133506] - [infiniband] ocrdma: Allow only SEND opcode in case of UD QPs (Doug Ledford) [1133506] - [infiniband] ocrdma: Avoid reporting wrong completions in case of error CQEs (Doug Ledford) [1133506] - [infiniband] ocrdma: Query and initalize the PFC SL (Doug Ledford) [1133506] - [infiniband] ocrdma: Avoid posting DPP requests for RDMA READ (Doug Ledford) [1133506] - [infiniband] core: When marsheling uverbs path, clear unused fields (Amir Vadai) [1130394] - [infiniband] mlx4: Avoid executing gid task when device is being removed (Amir Vadai) [1130394] - [infiniband] mlx4: Fix lockdep splat for the iboe lock (Amir Vadai) [1130394] - [infiniband] mlx4: Get upper dev addresses as RoCE GIDs when port comes up (Amir Vadai) [1130394] - [infiniband] mlx4: Reorder steps in RoCE GID table initialization (Amir Vadai) [1130394] - [infiniband] mlx4: Don't duplicate the default RoCE GID (Amir Vadai) [1130394] - [infiniband] mlx4: Avoid null pointer dereference in mlx4_ib_scan_netdevs() (Amir Vadai) [1130394] - [netdrv] b43: fix the wrong assignment of status.freq in b43_rx() (John Greene) [1132160] - [lib] lzo: properly check for overruns (Denys Vlasenko) [1113901] {CVE-2014-4608} - [lib] lzo: Update LZO compression to current upstream version (Denys Vlasenko) [1113901] {CVE-2014-4608} - [drm] nouveau: add more checks to PRAMIN image fetching (Ben Skeggs) [1133695 1076733] - [drm] nouveau: allow non-optimus setups to load vbios from acpi (Ben Skeggs) [1133695 1076733] - [drm] nouveau: fix a potential NULL deref in the PROM shadowing function (Ben Skeggs) [1133695 1076733] - [drm] nouveau: fetch the vbios from PROM using only aligned 32-bit accesses (Ben Skeggs) [1133695 1076733] - [net] Revert "introduce netif_skb_dev_features" (Florian Westphal) [1029603] - [net] revert "ip, ipv6: handle gso skbs in forwarding path" (Florian Westphal) [1029603]- [kernel] audit: audit_log_start running on auditd should not stop (Richard Guy Briggs) [1019898] - [kernel] audit: drop audit_cmd_lock in AUDIT_USER family of cases (Richard Guy Briggs) [1019898] - [security] selinux: call WARN_ONCE() instead of calling audit_log_start() (Richard Guy Briggs) [1019898] - [crypto] drbg: fix failure of generating multiple of 2**16 bytes (Herbert Xu) [1130529] - [x86] uv: Set n_lshift based on GAM_GR_CONFIG MMR for UV3 (George Beshers) [1096981] - [fs] nfs: Close another NFSv4 recovery race (Steve Dickson) [1093922] - [fs] nfs: Refactor _nfs4_open_and_get_state to set ctx->state (Steve Dickson) [1093922] - [fs] nfs: cleanup: pass the nfs_open_context to nfs4_do_open (Steve Dickson) [1093922] - [fs] sunrpc: Handle EPIPE in xprt_connect_status (Steve Dickson) [1130619] - [fs] sunrpc: Ensure xprt_connect_status handles all potential connection errors (Steve Dickson) [1130619] - [fs] sunrpc: Ensure that we handle ENOBUFS errors correctly (Steve Dickson) [1130619] - [fs] sunrpc: Ensure call_connect_status() deals correctly with SOFTCONN tasks (Steve Dickson) [1130619] - [fs] sunrpc: Ensure that call_connect times out correctly (Steve Dickson) [1130619] - [fs] sunrpc: Handle connect errors ECONNABORTED and EHOSTUNREACH (Steve Dickson) [1130619] - [fs] sunrpc: call_connect_status should recheck bind and connect status on error (Steve Dickson) [1130619] - [fs] sunrpc: Report network/connection errors correctly for SOFTCONN rpc tasks (Steve Dickson) [1130619] - [fs] ext3: Fix fdatasync() for files with only i_size changes (Eric Sandeen) [1127023] - [fs] gfs2: Change maxlen variables to size_t (Robert S Peterson) [1126899] - [mm] hugetlb: add cond_resched_lock() in return_unused_surplus_pages() (Motohiro Kosaki) [1129085] - [mm] hugetlb: fix softlockup when a large number of hugepages are freed (Motohiro Kosaki) [1129085] - [net] fix ipv4: match prefsrc when deleting routes (Jiri Benc) [1056443] - [net] bridge: explictly tag vlan-accelerated frames destined to the host (Vlad Yasevich) [1121991] - [net] ipv4: avoid parallel route cache gc executions (Hannes Frederic Sowa) [1121228] - [net] ipv4: move route garbage collector to work queue (Hannes Frederic Sowa) [1121228] - [net] ethtool: reallow ETHTOOL_SFLAGS to set TX/RX VLAN offloads (Michal Schmidt) [1134359] - [net] tcp: tsq: fix nonagle handling (Jiri Pirko) [1134401] - [kvm] iommu: fix the third parameter of kvm_iommu_put_pages (Radomir Vrbovsky) [1131953] {CVE-2014-3601} - [s390] sysinfo: convert /proc/sysinfo to seqfile (Hendrik Brueckner) [1130987] - [s390] con3215: fix hanging console issue (Hendrik Brueckner) [1130986] - [s390] dasd: validate request size before building CCW/TCW request (Hendrik Brueckner) [1130988] - [scsi] revert "fc: ensure scan_work isn't active when freeing fc_rport" (Maurizio Lombardi) [1135888] - [edac] sb_edac: Modify H/W event reporting policy (Rui Wang) [1129067] - [alsa] control: Fix replacing user controls (Denys Vlasenko) [1117322] {CVE-2014-4654 CVE-2014-4655} - [netdrv] bnx2x: Fix RSS on big-endian (Michal Schmidt) [1119291] - [netdrv] bnx2x: Utilize FW 7.10.51 (Michal Schmidt) [1119291] - [netdrv] firmware: add bnx2x FW 7.10.51 (Michal Schmidt) [1119291] - [security] selinux: fix a problem with IPv6 traffic denials in selinux_ip_postroute() (Paul Moore) [1130082]- [md] revert "raid1: Rewrite the implementation of iobarrier" (Jes Sorensen) [1127231] - [md] revert "raid1: fix request counting bug in new 'barrier' code" (Jes Sorensen) [1127231] - [scsi] hpsa: version string change (Tomas Henzl) [1054631] - [scsi] hpsa: change doorbell reset delay to ten seconds (Tomas Henzl) [1054631] - [scsi] hpsa: add a delay to kdump path (Tomas Henzl) [1054631] - [infiniband] ipoib: No longer use flush as a parameter (Doug Ledford) [1111073] - [infiniband] ipoib: Make ipoib_mcast_stop_thread flush the workqueue (Doug Ledford) [1111073] - [infiniband] ipoib: Use dedicated workqueues per interface (Doug Ledford) [1111073] - [infiniband] ipoib: change init sequence ordering (Doug Ledford) [1111073] - [infiniband] ipoib: fix mcast_dev_flush/mcast_restart_task race (Doug Ledford) [1111073] - [infiniband] ipoib: fix MCAST_FLAG_BUSY usage (Doug Ledford) [1111073] - [infiniband] ipoib: Make the carrier_on_task race aware (Doug Ledford) [1111073] - [infiniband] ipoib: Consolidate rtnl_lock tasks in workqueue (Doug Ledford) [1111073] - [infiniband] ipoib: Avoid multicast join attempts with invalid P_key (Doug Ledford) [1111073] - [infiniband] ipoib: Avoid flushing the workqueue from worker context (Doug Ledford) [1111073] - [infiniband] ipoib: Use P_Key change event instead of P_Key polling mechanism (Doug Ledford) [1111073] - [infiniband] mlx5: Enable "block multicast loopback" for kernel consumers (Doug Ledford) [1128863] - [mm] memory-failure: support use of a dedicated thread to handle SIGBUS BUS_MCEERR_AO (Rui Wang) [1108366] - [mm] memory-failure: don't let collect_procs() skip over processes for MF_ACTION_REQUIRED (Rui Wang) [1108366] - [mm] memory-failure: send right signal code to correct thread (Rui Wang) [1108366] - [x86] mce: Pay no attention to 'F' bit in MCACOD when parsing 'UC' errors (Rui Wang) [1093437] - [x86] kvm: trace kvm_ple_window grow/shrink (Radim Krcmar) [1093208] - [x86] kvm: vmx: dynamise PLE window (Radim Krcmar) [1093208] - [x86] kvm: vmx: make PLE window per-VCPU (Radim Krcmar) [1093208] - [x86] kvm: introduce sched_in to kvm_x86_ops (Radim Krcmar) [1093208] - [virt] kvm: add kvm_arch_sched_in (Radim Krcmar) [1093208] - [fs] Add full_check test before calling add_to_tfile_check() to prevent panic in reverse_path_check_proc() (Larry Woodman) [1130730] - [perf] x86: Fix Silvermont offcore masks (Jiri Olsa) [1036335] - [perf] x86: Add model number for Avoton Silvermont (Jiri Olsa) [1036335] - [perf] x86: Add Silvermont 22nm Atom support (Jiri Olsa) [1036335] - [perf] x86: use INTEL_UEVENT_EXTRA_REG to define MSR_OFFCORE_RSP_X (Jiri Olsa) [1036335] - [perf] x86: Fix Intel shared extra MSR allocation (Jiri Olsa) [1036335] - [x86] amd: perf: Unify AMD's generic and family 15h pmus (Jiri Olsa) [1133680]- [mm] hugetlb: correct missing private flag clearing (Petr Holasek) [1127126] - [mm] hugetlb: return a reserved page to a reserved pool if failed (Petr Holasek) [1127126] - [mm] hugetlb: undo change to page mapcount in fault handler (Petr Holasek) [1127126] - [mm] hugetlb: fix subpool accounting handling (Petr Holasek) [1127126] - [mm] hugetlb: protect reserved pages when soft offlining a hugepage (Petr Holasek) [1127126] - [mm] hugetlb: decrement reserve count if VM_NORESERVE alloc page cache (Petr Holasek) [1127126] - [mm] hugetlb: remove decrement_hugepage_resv_vma() (Petr Holasek) [1127126] - [mm] hugetlb: add VM_NORESERVE check in vma_has_reserves() (Petr Holasek) [1127126] - [mm] hugetlb: do not use a page in page cache for cow optimization (Petr Holasek) [1127126] - [crypto] modsign: crypto_alloc_shash() returns an error code not NULL on failure (David Howells) [1099208] - [drm] nouveau: behave better if ioremap failed (Ben Skeggs) [1076992] - [fs] fuse: ignore entry-timeout LOOKUP_REVAL (Carlos Maiolino) [1127702] - [fs] fuse: Timeout comparison fix (Carlos Maiolino) [1127769] - [fs] ext4: verify block bitmap (Lukas Czerner) [1087584] - [fs] ext4: fix type declaration of ext4_validate_block_bitmap (Lukas Czerner) [1087584] - [fs] ext4: error out if verifying the block bitmap fails (Lukas Czerner) [1087584] - [fs] fsnotify: delay unmounting until all inode are fput (Eric Paris) [886723] - [fs] inotify: determine wd before races are possible (Eric Paris) [886723] - [fs] fsnotify: do not hold notification mutex when putting events (Eric Paris) [886723] - [fs] fsnotify: use GFP_NOFS when allocating event holders (Eric Paris) [886723] - [fs] locks: eliminate BUG() call when there's an unexpected lock on file close (Benjamin Coddington) [1113096] - [fs] gfs2: Request demote when a "try" flock fails (Robert S Peterson) [1129445] - [fs] nfsd: allow turning off nfsv3 readdir_plus (J. Bruce Fields) [1117468] - [powerpc] pseries: Fix kexec regression caused by CPPR tracking (Gustavo Duarte) [1129453] - [scsi] Fix erratic device offline during EH (Gustavo Duarte) [1126088] - [net] openvswitch: fix panic with multiple vlan headers (Jiri Benc) [1122405] - [net] ipvs: extract race fixes for sync daemon setups (Jesper Brouer) [1117536]- [scsi] cxgb4i: Guard ipv6 code with a config check (Sai Vemuri) [1122829] - [scsi] cxgb4i: remove spurious use of rcu (Sai Vemuri) [1122829] - [scsi] cxgb4i: Fix ipv6 build failure caught with randconfig (Sai Vemuri) [1122829] - [scsi] cxgb4i: Add ipv6 code to driver, call into libcxgbi ipv6 api (Sai Vemuri) [1122829] - [scsi] libcxgbi: Add ipv6 api to driver (Sai Vemuri) [1122829] - [netdrv] cxgb4: Export symbols required by cxgb4i for ipv6 support and required defines (Sai Vemuri) [1122829] - [netdrv] cxgb4vf: Adds device Id for few more Chelsio adapters (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Remove superfluous call to pci_disable_msix() (Sai Vemuri) [1112417] - [netdrv] cxgb4: make functions static and remove dead code (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: added much cleaner implementation of is_t4() (Sai Vemuri) [1112417] - [netdrv] net: cxgb4vf: use DEFINE_PCI_DEVICE_TABLE (Sai Vemuri) [1112417] - [netdrv] net: cxgb4vf: remove unnecessary pci_set_drvdata() (Sai Vemuri) [1112417] - [netdrv] net: cxgb4vf: Staticize local symbols (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Support CPL_SGE_EGR_UPDATEs encapsulated in a CPL_FW4_MSG (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Add support for Chelsio T5 adapter (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Fix VLAN extraction counter increment (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Fix extraction of cpl_rx_pkt from the response queue descriptor (Sai Vemuri) [1112417] - [netdrv] chelsio: Use netdev_ and pr_ (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: remove __dev* attributes (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: do vlan cleanup (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: improve Kconfig dependencies (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Use defined Mailbox Timeout (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Quiesce Virtual Interfaces on shutdown (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Behave properly when CONFIG_DEBUG_FS isn't defined (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Check driver parameters in the right place (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: recover from failure in cxgb4vf_open() (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: fix mailbox data/control coherency domain race (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Ingress Queue Entry Size needs to be 64 bytes (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: fix setting unicast/multicast addresses (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Advertise NETIF_F_TSO_ECN (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: fix up "Section Mismatch" compiler warning (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: add ethtool statistics for GRO (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: minor comment/symbolic name cleanup (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: add call to Firmware to reset VF State (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Fail open if link_start() fails (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: flesh out PCI Device ID Table (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: fix some errors in Gather List to skb conversion (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: fix bug in Generic Receive Offload (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: don't implement trivial (and incorrect) ndo_select_queue() (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: remove call to stop TX queues at load time (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: make single bit signed bitfields unsigned (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Use netif_set_real_num_rx/tx_queues() (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: do not use PCI resources before pci_enable_device() (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Fix bug where we were only allocating one queue in MSI mode (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Fix off-by-one error checking for the end of the mailbox delay array (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: fix SGE resource resource deallocation bug (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: fix TX Queue restart (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Implement "Unhandled Interrupts" statistic (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: remove obsolete DECLARE_PCI_UNMAP_ADDR usage (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Use correct shift factor for extracting the SGE DMA Ingress Padding Boundary (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Remove obsolete comment about the lack of a TX Timer Callback (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Stitch new T4 PCI-E SR-IOV Virtual Function driver into the build (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Add new Makefile for T4 PCI-E SR-IOV Virtual Function driver cxgb4vf (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Add main T4 PCI-E SR-IOV Virtual Function driver for cxgb4vf (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Add T4 Virtual Function Scatter-Gather Engine DMA code (Sai Vemuri) [1112417] - [netdrv] cxgb4vf: Add core T4 PCI-E SR-IOV Virtual Function hardware definitions and device communication code (Sai Vemuri) [1112417] - [infiniband] iw_cxgb4: fix for 64-bit integer division (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fix possible race condition in cleanup (Sai Vemuri) [1121803] - [netdrv] cxgb4: only free allocated fls (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fixed incorrect check for memory operation in t4_memory_rw (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add the MC1 registers to read in the interrupt handler (Sai Vemuri) [1121803] - [netdrv] iw_cxgb4: Move common defines to cxgb4 (Sai Vemuri) [1121803] - [netdrv] iw_cxgb4: work request logging feature (Sai Vemuri) [1121803] - [netdrv] iw_cxgb4: display TPTE on errors (Sai Vemuri) [1121803] - [netdrv] iw_cxgb4: use firmware ord/ird resource limits (Sai Vemuri) [1121803] - [netdrv] iw_cxgb4: Detect Ing. Padding Boundary at run-time (Sai Vemuri) [1121803] - [netdrv] cxgb4: remove unnecessary null test before debugfs_remove_recursive (Sai Vemuri) [1121803] - [netdrv] cxgb4: Adds device ID for few more Chelsio T4 Adapters (Sai Vemuri) [1121803] - [netdrv] cxgb4: Replaced the backdoor mechanism to access the HW memory with PCIe Window method (Sai Vemuri) [1121803] - [netdrv] cxgb4: Use FW interface to get BAR0 value (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fixes cxgb4 probe failure in VM when PF is exposed through PCI Passthrough (Sai Vemuri) [1121803] - [netdrv] cxgb4: Change default Interrupt Holdoff Packet Count Threshold (Sai Vemuri) [1121803] - [netdrv] iw_cxgb4: don't truncate the recv window size (Sai Vemuri) [1121803] - [netdrv] iw_cxgb4: Choose appropriate hw mtu index and ISS for iWARP connections (Sai Vemuri) [1121803] - [netdrv] iw_cxgb4: Allocate and use IQs specifically for indirect interrupts (Sai Vemuri) [1121803] - [netdrv] cxgb4: Check if rx checksum offload is enabled, while reading hardware calculated checksum (Sai Vemuri) [1121803] - [netdrv] cxgb4: Decode the firmware port and module type a bit more for ethtool (Sai Vemuri) [1121803] - [infiniband] cxgb4: add missing padding at end of struct c4iw_alloc_ucontext_resp (Sai Vemuri) [1121803] - [infiniband] cxgb4: Add missing padding at end of struct c4iw_create_cq_resp (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix vlan support (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix memory leaks in c4iw_alloc() error paths (Sai Vemuri) [1121803] - [netdrv] cxgb4: Decode PCIe Gen3 link speed (Sai Vemuri) [1121803] - [infiniband] cxgb4: Update Kconfig to include Chelsio T5 adapter (Sai Vemuri) [1121803] - [infiniband] cxgb4: Only allow kernel db ringing for T4 devs (Sai Vemuri) [1121803] - [infiniband] cxgb4: Force T5 connections to use TAHOE congestion control (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix endpoint mutex deadlocks (Sai Vemuri) [1121803] - [netdrv] cxgb4: use the correct max size for firmware flash (Sai Vemuri) [1121803] - [netdrv] cxgb4: Save the correct mac addr for hw-loopback connections in the L2T (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix over-dereference when terminating (Sai Vemuri) [1121803] - [infiniband] cxgb4: Use uninitialized_var() (Sai Vemuri) [1121803] - [infiniband] cxgb4: Add missing debug stats (Sai Vemuri) [1121803] - [infiniband] cxgb4: Initialize reserved fields in a FW work request (Sai Vemuri) [1121803] - [infiniband] cxgb4: Use pr_warn_ratelimited (Sai Vemuri) [1121803] - [infiniband] cxgb4: Max fastreg depth depends on DSGL support (Sai Vemuri) [1121803] - [infiniband] cxgb4: SQ flush fix (Sai Vemuri) [1121803] - [infiniband] cxgb4: rmb() after reading valid gen bit (Sai Vemuri) [1121803] - [infiniband] cxgb4: Endpoint timeout fixes (Sai Vemuri) [1121803] - [infiniband] cxgb4: Use the BAR2/WC path for kernel QPs and T5 devices (Sai Vemuri) [1121803] - [infiniband] cxgb4: Disable DSGL use by default (Sai Vemuri) [1121803] - [infiniband] cxgb4: rx_data() needs to hold the ep mutex (Sai Vemuri) [1121803] - [infiniband] cxgb4: Drop RX_DATA packets if the endpoint is gone (Sai Vemuri) [1121803] - [infiniband] cxgb4: Lock around accept/reject downcalls (Sai Vemuri) [1121803] - [infiniband] cxgb4: set error code on kmalloc() failure (Sai Vemuri) [1121803] - [netdrv] cxgb4: Adds device ID for few more Chelsio Adapters (Sai Vemuri) [1121803] - [netdrv] cxbg4: Remove addressof casts to same type (Sai Vemuri) [1121803] - [netdrv] cxgb4: Call dev_kfree/consume_skb_any instead of kfree_skb (Sai Vemuri) [1121803] - [infiniband] cxgb4: Update snd_seq when sending MPA messages (Sai Vemuri) [1121803] - [infiniband] cxgb4: Connect_request_upcall fixes (Sai Vemuri) [1121803] - [infiniband] cxgb4: Ignore read reponse type 1 CQEs (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix possible memory leak in RX_PKT processing (Sai Vemuri) [1121803] - [infiniband] cxgb4: Don't leak skb in c4iw_uld_rx_handler() (Sai Vemuri) [1121803] - [infiniband] cxgb4: Save the correct map length for fast_reg_page_lists (Sai Vemuri) [1121803] - [infiniband] cxgb4: Default peer2peer mode to 1 (Sai Vemuri) [1121803] - [infiniband] cxgb4: Mind the sq_sig_all/sq_sig_type QP attributes (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix incorrect BUG_ON conditions (Sai Vemuri) [1121803] - [infiniband] cxgb4: Always release neigh entry (Sai Vemuri) [1121803] - [infiniband] cxgb4: Allow loopback connections (Sai Vemuri) [1121803] - [infiniband] cxgb4: Cap CQ size at T4_MAX_IQ_SIZE (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix four byte info leak in c4iw_create_cq() (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix underflows in c4iw_create_qp() (Sai Vemuri) [1121803] - [netdrv] cxgb4: Doorbell Drop Avoidance Bug Fixes (Sai Vemuri) [1121803] - [netdrv] cxgb4: Treat CPL_ERR_KEEPALV_NEG_ADVICE as negative advice (Sai Vemuri) [1121803] - [netdrv] cxgb4: Calculate len properly for LSO path (Sai Vemuri) [1121803] - [netdrv] cxgb4: Updates for T5 SGE's Egress Congestion Threshold (Sai Vemuri) [1121803] - [netdrv] cxgb4: Rectify emitting messages about SGE Ingress DMA channels being potentially stuck (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add code to dump SGE registers when hitting idma hangs (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fix some small bugs in t4_sge_init_soft() when our Page Size is 64KB (Sai Vemuri) [1121803] - [netdrv] cxgb4: use remove handler as shutdown handler (Sai Vemuri) [1121803] - [netdrv] cgxb4: Stop using ethtool SPEED_* constants (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add more PCI device ids (Sai Vemuri) [1121803] - [netdrv] cxgb4: Don't assume LSO only uses SGL path in t4_eth_xmit() (Sai Vemuri) [1121803] - [netdrv] cxgb4: Remove unused registers and add missing ones (Sai Vemuri) [1121803] - [netdrv] cxgb4: Query firmware for T5 ULPTX MEMWRITE DSGL capabilities (Sai Vemuri) [1121803] - [netdrv] cxgb4: LE-Workaround is not atomic in firmware (Sai Vemuri) [1121803] - [netdrv] cxgb4: Allow >10G ports to have multiple queues (Sai Vemuri) [1121803] - [netdrv] cxgb4: Print adapter VPD Part Number instead of Engineering Change field (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add support to recognize 40G links (Sai Vemuri) [1121803] - [netdrv] cxgb4: Use pci_enable_msix_range() instead of pci_enable_msix() (Sai Vemuri) [1121803] - [infiniband] cxgb4: Add missing neigh_release in LE-Workaround path (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fix referencing freed adapter (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix gcc warning on 32-bit arch (Sai Vemuri) [1121803] - [netdrv] cxgb4: Don't retrieve stats during recovery (Sai Vemuri) [1121803] - [netdrv] cxgb4: Avoid disabling PCI device for towice (Sai Vemuri) [1121803] - [netdrv] cxgb4: silence shift wrapping static checker warning (Sai Vemuri) [1121803] - [netdrv] cxgb4: Changed FW check version to match FW binary version (Sai Vemuri) [1121803] - [netdrv] cxgb4: allow large buffer size to have page size (Sai Vemuri) [1121803] - [infiniband] cxgb4: Use cxgb4_select_ntuple to correctly calculate ntuple fields (Sai Vemuri) [1121803] - [infiniband] cxgb4: Server filters are supported only for IPv4 (Sai Vemuri) [1121803] - [infiniband] cxgb4: Calculate the filter server TID properly (Sai Vemuri) [1121803] - [netdrv] cxgb4: make functions static and remove dead code (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add API to correctly calculate tuple fields (Sai Vemuri) [1121803] - [netdrv] cxgb4: Account for stid entries properly in case of IPv6 (Sai Vemuri) [1121803] - [netdrv] cxgb4: Assign filter server TIDs properly (Sai Vemuri) [1121803] - [netdrv] cxgb4: Include TCP as protocol when creating server filters (Sai Vemuri) [1121803] - [netdrv] cxgb4: Reserve stid 0 for T4/T5 adapters (Sai Vemuri) [1121803] - [netdrv] cxgb4: calls skb_set_hash (Sai Vemuri) [1121803] - [infiniband] cxgb4: Make _c4iw_write_mem_dma() static (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix formatting of physical address (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add new scheme to update T4/T5 firmware (Sai Vemuri) [1121803] - [netdrv] cxgb4: added much cleaner implementation of is_t4() (Sai Vemuri) [1121803] - [netdrv] cxgb4: Much cleaner implementation of is_t4()/is_t5() (Sai Vemuri) [1121803] - [netdrv] cgxb4: remove duplicate include in cxgb4.h (Sai Vemuri) [1121803] - [netdrv] cxgb4: remove unnecessary pci_set_drvdata() (Sai Vemuri) [1121803] - [netdrv] cxgb4: remove workqueue when driver registration fails (Sai Vemuri) [1121803] - [infiniband] cxgb4: Issue RI.FINI before closing when entering TERM (Sai Vemuri) [1121803] - [infiniband] cxgb4: Advertise ~0ULL as max MR size (Sai Vemuri) [1121803] - [infiniband] cxgb4: Always do GTS write if cidx_inc == CIDXINC_MASK (Sai Vemuri) [1121803] - [infiniband] cxgb4: Set arp error handler for PASS_ACCEPT_RPL messages (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix accounting for unsignaled SQ WRs to deal with wrap (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix QP flush logic (Sai Vemuri) [1121803] - [infiniband] cxgb4: Use correct bit shift macros for vlan filter tuples (Sai Vemuri) [1121803] - [infiniband] cxgb4: Handle newer firmware changes (Sai Vemuri) [1121803] - [infiniband] cxgb4: Add support for active and passive open connection with IPv6 address (Sai Vemuri) [1121803] - [infiniband] cma: Add IPv6 support for iWARP (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add CLIP support to store compressed IPv6 address (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add routines to create and remove listening IPv6 servers (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix stack info leak in c4iw_create_qp() (Sai Vemuri) [1121803] - [netdrv] cxgb4: Do not set net_device::dev_id to VI index (Sai Vemuri) [1121803] - [netdrv] cxgb4: Correct comparisons and calculations using skb->tail and skb-transport_header (Sai Vemuri) [1121803] - [netdrv] cxgb4: Force uninitialized state if FW_ON_ADAPTER is < FW_VERSION and we're the MASTER_PF (Sai Vemuri) [1121803] - [netdrv] cxgb4: fix error recovery when t4_fw_hello returns a positive value (Sai Vemuri) [1121803] - [netdrv] cxgb4: Support CPL_SGE_EGR_UPDATEs encapsulated in a CPL_FW4_MSG (Sai Vemuri) [1121803] - [netdrv] cxgb4: Support CPL_SGE_EGR_UPDATEs encapsulated in a CPL_FW4_MSG (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fix pci_device_id structure initialization with correct PF number (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix SQ allocation when on-chip SQ is disabled (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix error return code in create_qp() (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix onchip queue support for T5 (Sai Vemuri) [1121803] - [infiniband] cxgb4: Bump tcam_full stat and WR reply timeout (Sai Vemuri) [1121803] - [infiniband] cxgb4: Map pbl buffers for dma if using DSGL (Sai Vemuri) [1121803] - [infiniband] cxgb4: Use DSGLs for fastreg and adapter memory writes for T5 (Sai Vemuri) [1121803] - [infiniband] cxgb4: Add module_params to enable DB FC & Coalescing on T5 (Sai Vemuri) [1121803] - [infiniband] cxgb4: Turn off db coalescing when RDMA QPs are in use (Sai Vemuri) [1121803] - [infiniband] cxgb4: Add Support for Chelsio T5 adapter (Sai Vemuri) [1121803] - [netdrv] cxgb4: Disable SR-IOV support for PF4-7 for T5 (Sai Vemuri) [1121803] - [netdrv] cxgb4: Update driver version and description (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add T5 PCI ids (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add T5 debugfs support (Sai Vemuri) [1121803] - [netdrv] cxgb4: Enable doorbell drop recovery only for T4 adapter (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add T5 write combining support (Sai Vemuri) [1121803] - [netdrv] cxgb4: Dump T5 registers (Sai Vemuri) [1121803] - [netdrv] cxgb4: Initialize T5 (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add macros, structures and inline functions for T5 (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add register definations for T5 (Sai Vemuri) [1121803] - [netdrv] cxgb4: Allow for backward compatibility with new VPD scheme (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix cast warning (Sai Vemuri) [1121803] - [infiniband] cxgb4: "cookie" can stay in host endianness (Sai Vemuri) [1121803] - [infiniband] cxgb4: Address sparse warnings (Sai Vemuri) [1121803] - [infiniband] cxgb4: Insert hwtid in pass_accept_req instead in pass_establish (Sai Vemuri) [1121803] - [infiniband] cxgb4: Don't wakeup threads for MPAv2 (Sai Vemuri) [1121803] - [infiniband] cxgb4: Don't reconnect on abort for mpa_rev 1 (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix endpoint timeout race condition (Sai Vemuri) [1121803] - [infiniband] cxgb4: Only log rx_data warnings if cpl status is non-zero (Sai Vemuri) [1121803] - [infiniband] cxgb4: Always log async errors (Sai Vemuri) [1121803] - [infiniband] cxgb4: Keep QP referenced until TID released (Sai Vemuri) [1121803] - [infiniband] cxgb4: Display streaming mode error only if detected in RTS (Sai Vemuri) [1121803] - [infiniband] cxgb4: Abort connections when moving to ERROR state (Sai Vemuri) [1121803] - [infiniband] cxgb4: Abort connections that receive unexpected streaming mode data (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fix incorrect PFVF CMASK (Sai Vemuri) [1121803] - [netdrv] cxgb4: Use netdev_ and pr_ (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix bug for active and passive LE hash collision path (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix LE hash collision bug for passive open connection (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix LE hash collision bug for active open connection (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add LE hash collision bug fix path in LLD driver (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add T4 filter support (Sai Vemuri) [1121803] - [netdrv] cxgb4: remove __dev* attributes (Sai Vemuri) [1121803] - [netdrv] cxgb4: Chelsio FCoE offload driver submission (Sai Vemuri) [1121803] - [infiniband] cxgb4: use WARN (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fix initialization of SGE_CONTROL register (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fix unable to get UP event from the LLD (Sai Vemuri) [1121803] - [infiniband] cxgb4: Don't free chunk that we have failed to allocate (Sai Vemuri) [1121803] - [netdrv] cxgb4: Remove unnecessary #ifdef condition (Sai Vemuri) [1121803] - [netdrv] cxgb4: Address various sparse warnings (Sai Vemuri) [1121803] - [netdrv] cxgb4: allocate enough data in t4_memory_rw() (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fix build error due to missing linux/vmalloc.h include (Sai Vemuri) [1121803] - [netdrv] cxgb4: Dynamically allocate memory in t4_memory_rw() and get_vpd_params() (Sai Vemuri) [1121803] - [infiniband] cxgb4: Fix error handling in create_qp() (Sai Vemuri) [1121803] - [netdrv] cxgb4: Don't attempt to upgrade T4 firmware when cxgb4 will end up as a slave (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add support for T4 hardwired driver configuration settings (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add support for T4 configuration file (Sai Vemuri) [1121803] - [netdrv] cxgb4: Code cleanup to enable T4 Configuration File support (Sai Vemuri) [1121803] - [netdrv] cxgb4: Add functions to read memory via PCIE memory window (Sai Vemuri) [1121803] - [netdrv] cxgb4: Fix incorrect values for MEMWIN*_APERTURE and MEMWIN*_BASE (Sai Vemuri) [1121803] - [infiniband] cxgb4: Move dereference below NULL test (Sai Vemuri) [1121803] - [infiniband] cxgb4: Update RDMA/cxgb4 due to macro definition removal in cxgb4 driver (Sai Vemuri) [1121803] - [netdrv] cxgb4: Remove duplicate register definitions (Sai Vemuri) [1121803] - [netdrv] cxgb4: set maximal number of default RSS queues (Sai Vemuri) [1121803] - [infiniband] cxgb4: Include vmalloc.h for vmalloc and vfree (Sai Vemuri) [1121803] - [infiniband] cxgb4: Remove kfifo usage (Sai Vemuri) [1121803] - [infiniband] cxgb4: Use vmalloc() for debugfs QP dump (Sai Vemuri) [1121803] - [infiniband] cxgb4: DB Drop Recovery for RDMA and LLD queues (Sai Vemuri) [1121803] - [infiniband] cxgb4: Add DB Overflow Avoidance (Sai Vemuri) [1121803] - [infiniband] cxgb4: Add debugfs RDMA memory stats (Sai Vemuri) [1121803] - [netdrv] cxgb4: DB Drop Recovery for RDMA and LLD queues (Sai Vemuri) [1121803] - [netdrv] cxgb4: Common platform specific changes for DB Drop Recovery (Sai Vemuri) [1121803] - [netdrv] cxgb4: Detect DB FULL events and notify RDMA ULD (Sai Vemuri) [1121803] - [infiniband] cxgb4: Drop peer_abort when no endpoint found (Sai Vemuri) [1121803] - [infiniband] cxgb4: Debugfs dump_qp() updates (Sai Vemuri) [1121803] - [infiniband] cxgb4: Use ULP_MODE_TCPDDP (Sai Vemuri) [1121803] - [infiniband] cxgb4: Turn on delayed ACK (Sai Vemuri) [1121803] - [netdrv] cxgb4: Use netif_set_real_num_rx/tx_queues() (Sai Vemuri) [1121803] - [netdrv] cxgb4: set skb->rxhash (Sai Vemuri) [1121803]- [drm] i915: fix backport typo (Rob Clark) [1131218] - [net] revert: bridge: Provide VLAN registration and GRO acceleration for ports (Jiri Pirko) [1121991] - [net] revert: bridge: Correctly receive hw-accelerated vlan traffic (Jiri Pirko) [1121991] - [net] revert: vlan: Allow accelerated packets to flow through the bridge (Jiri Pirko) [1121991] - [net] ipv6: fix calculation of option len in ip6_append_data (Hannes Frederic Sowa) [1127225] - [net] ipv6: pmtudisc setting not respected with UFO/CORK (Hannes Frederic Sowa) [1127225] - [net] ipv4: fix DO and PROBE pmtu mode regarding local fragmentation with UFO/CORK (Hannes Frederic Sowa) [1127225] - [net] rtnetlink: fix VF info size (Jiri Benc) [1126761] - [scsi] fc: ensure scan_work isn't active when freeing fc_rport (Maurizio Lombardi) [1120036] - [netdrv] bnx2x: Safe bnx2x_panic_dump() (Michal Schmidt) [1121539] - [netdrv] bnx2x: Enlarge the dorq threshold for VFs (Michal Schmidt) [1123412] - [netdrv] bnx2x: Fix 1G-baseT link (Michal Schmidt) [1123412] - [netdrv] bnx2x: Fix link for KR with swapped polarity lane (Michal Schmidt) [1123412] - [md] raid: avoid data corruption during recovery of double-degraded RAID6 (Jes Sorensen) [1090423] - [perf] tools: Show better error message in case we fail to open counters due to EBUSY error (Jiri Olsa) [1103196] - [perf] tools: Add filename__read_str util function (Jiri Olsa) [1103196] - [kvm] revert "x86: increase VCPU limit to 240" (Radim Krcmar) [864242] - [virt] revert "virtio-net: initialize vlan_features" (Nikolay Aleksandrov) [1132588]- [net] ipv6: fix headroom calculation in udp6_ufo_fragment (Nikolay Aleksandrov) [1121522] - [net] udp6: Fix udp fragmentation for tunnel traffic (Nikolay Aleksandrov) [1121522] - [net] sctp: inherit auth_capable on INIT collisions (Daniel Borkmann) [1123760] {CVE-2014-5077} - [net] sctp: only warn in proc_sctp_do_alpha_beta if write (Daniel Borkmann) [1081372] - [net] sctp: fix permissions for rto_alpha and rto_beta knobs (Daniel Borkmann) [1081372] - [scsi] scsi_lib: remove the description string in scsi_io_completion() (Maurizio Lombardi) [710111] - [scsi] qla2xxx: Update version number to 8.07.00.08.06.6-k1 (Chad Dupuis) [919831 990690] - [scsi] qla2xxx: Remove restriction on starting remote device discovery on port update (Chad Dupuis) [990690] - [scsi] qla2xxx: Move mailbox failure messages to a default debug level (Chad Dupuis) [919831] - [netdrv] mlx4_core: Keep only one driver entry release mlx4_priv (Amir Vadai) [1121531] - [netdrv] be2net: fix qnq mode detection on VFs (Ivan Vecera) [1123790] - [netdrv] be2net: ignore get/set profile FW cmd failures (Ivan Vecera) [1110417] - [netdrv] be2net: use adapter->flags to track SRIOV state (Ivan Vecera) [1110417] - [netdrv] be2net: avoid SRIOV config for BE2 chip (Ivan Vecera) [1110417] - [netdrv] be2net: use be_max_vfs() macro to access max-vfs (Ivan Vecera) [1110417] - [netdrv] be2net: create optimal number of queues on SR-IOV config (Ivan Vecera) [1110417] - [netdrv] be2net: read VF's capabilities from GET_PROFILE_CONFIG cmd (Ivan Vecera) [1110417] - [netdrv] be2net: remove be_cmd_get_profile_config_mbox/mccq() variants (Ivan Vecera) [1110417] - [x86] perf: Fix AMD NB and L2I "uncore" support (Prarit Bhargava) [922929] - [x86] perf: Remove old-style NB counter support from perf_event_amd.c (Prarit Bhargava) [922929] - [x86] perf: Add support for AMD NB and L2I "uncore" counters (Prarit Bhargava) [922929] - [x86] Add cpu_has_topoext (Prarit Bhargava) [922929] - [x86] perf: Enable northbridge performance counters on AMD family 15h (Prarit Bhargava) [922929] - [x86] perf: add global get_ibs_caps() (Prarit Bhargava) [922929] - [x86] perf: Share IBS macros between perf and oprofile (Prarit Bhargava) [922929] - [x86] perf: Generalize northbridge constraints code for family 15h (Prarit Bhargava) [922929] - [x86] perf: Allow for architecture specific RDPMC indexes (Prarit Bhargava) [922929] - [x86] perf: Move MSR address offset calculation to architecture specific files (Prarit Bhargava) [922929] - [x86] perf: Use rdpmc() rather than rdmsr() when possible in the kernel (Prarit Bhargava) [922929] - [x86] Add rdpmcl() (Prarit Bhargava) [922929] - [x86] efi: Properly pre-initialize table pointers (Laszlo Ersek) [1129282] - [md] raid1, raid10: always abort recover on write error (Jes Sorensen) [1124351]- [xen] smp: Unifiy some of the PVs and PVHVM offline CPU path (Vitaly Kuznetsov) [1123370] - [xen] smp: Fix leakage of the spinlock interrupt line for every CPU online/offline (Vitaly Kuznetsov) [1123370] - [xen] disable PV spinlocks on HVM (Vitaly Kuznetsov) [1123370] - [xen] smp: initialize IPI vectors before marking CPU online (Vitaly Kuznetsov) [1123370] - [xen] Do not enable PV IPIs when vector callback not present (Vitaly Kuznetsov) [1123370] - [xen] pv on hvm support PV spinlocks and IPIs (Vitaly Kuznetsov) [1123370] - [xen] percpu: make percpu symbols in xen unique (Vitaly Kuznetsov) [1123370] - [kernel] sched: Fix possible divide by zero in avg_atom() calculation (Mateusz Guzik) [1109489] - [kernel] add div64_ul() (Mateusz Guzik) [1109489] - [kernel] sched: Move idle_balance() stats back where they were instead of at the end of the sched_domain (Larry Woodman) [1119156] - [perf] x86: ignore CondChgd bit to avoid false NMI handling (Don Zickus) [1116947] - [s390] fix restore of invalid floating-point-control (Hendrik Brueckner) [1121962] - [s390] sclp_vt220: Enable ASCII console per default (Hendrik Brueckner) [1112743] - [x86] apic: Remove noisy zero-mask warning from default_send_IPI_mask_logical() (Prarit Bhargava) [745124] - [drm] i915: lock around link status and link training (Dave Airlie) [1126640] - [drm] i915: only hook up hpd pulse for DP outputs (Dave Airlie) [1126640] - [alsa] control: Don't access controls outside of protected regions (Radomir Vrbovsky) [1117329] {CVE-2014-4653} - [md] dm-thin: set minimum_io_size to pool's data block size (Mikulas Patocka) [1121779] - [md] dm: allocate a special workqueue for deferred device removal (Mike Snitzer) [1109431] - [kernel] coredump: redefine SIGNAL_GROUP_COREDUMP to fix the conflict with SIGNAL_CLD_STOPPED (Oleg Nesterov) [1106519] - [powerpc] pseries: Track previous CPPR values to correctly EOI interrupts (Gustavo Duarte) [1089977] - [netdrv] tg3: Modify tg3_tso_bug() to handle multiple TX rings (Ivan Vecera) [1123530] - [netdrv] bna: fix performance regression (Ivan Vecera) [1121039] - [netdrv] bna: fill the magic in bnad_get_eeprom() instead of validating (Ivan Vecera) [1119123] - [netdrv] e1000e: implement 82577/579 MDI setting support (Ivan Vecera) [1105604] - [netdrv] igb: update to allow reading/setting MDI state (Ivan Vecera) [1105604] - [netdrv] e1000e: implement MDI/MDI-X control (Ivan Vecera) [1105604] - [netdrv] e1000: configure and read MDI settings (Ivan Vecera) [1105604] - [netdrv] ethtool: MDI setting support (Ivan Vecera) [1105604] - [netdrv] bna: remove use of ndo_set_multicast_list in drivers (Ivan Vecera) [1120510] - [netdrv] bna: fix vlan tag stripping and implement its toggling (Ivan Vecera) [1120510] - [netdrv] bna: convert to hw_features (Ivan Vecera) [1120510]- [powerpc] pci: Improve device hotplug initialization (Gustavo Duarte) [1084398] - [powerpc] pci: fix PCI-e devices rescan issue on powerpc platform (Gustavo Duarte) [1084398] - [powerpc] pci: Cleanup device dma setup code (Gustavo Duarte) [1084398] - [pci] Add pcibios_add_device (Gustavo Duarte) [1084398] - [pci] fix undefined reference to 'pci_fixup_final_inited' (Gustavo Duarte) [1084398] - [pci] call final fixups hot-added devices (Gustavo Duarte) [1084398] - [mm] vmscan: Fix memcg forced scan of anonymous pages (Jerome Marchand) [1124895] - [mm] try_to_unmap_cluster() should lock_page() before mlocking (Jacob Tanenbaum) [1093081] {CVE-2014-3122} - [video] fbmem: convert fb_mmap to vm_iomap_memory() helper (Jacob Tanenbaum) [1035242] {CVE-2013-2596} - [s390] add dummy io_remap_pfn_range() to asm/pgtable.h (Jacob Tanenbaum) [1035242] {CVE-2013-2596} - [mm] add vm_iomap_memory() helper function (Jacob Tanenbaum) [1035242] {CVE-2013-2596} - [hv] hv_fcopy: fix a race condition for SMP guest (Jason Wang) [1118123] - [hv] util: Fix a bug in the KVP code (Jason Wang) [1118123] - [hv] vmbus: Fix a bug in the channel callback dispatch code (Jason Wang) [1118123] - [scsi] virtio_scsi: fix memory leak on full queue condition (Fam Zheng) [1111485] - [scsi] storvsc: Correctly handle TEST_UNIT_READY failure (Jason Wang) [1120468] - [scsi] storvsc: Set srb_flags in all cases (Jason Wang) [1120468] - [scsi] storvsc: Implement a eh_timed_out handler (Jason Wang) [1120468] - [scsi] storvsc: Fix a bug in handling VMBUS protocol version (Jason Wang) [1120468] - [scsi] storvsc: Filter commands based on the storage protocol version (Jason Wang) [1120468] - [scsi] storvsc: Set cmd_per_lun to reflect value supported by the Host (Jason Wang) [1120468] - [scsi] storvsc: Change the limits to reflect the values on the host (Jason Wang) [1120468] - [fs] xfs: always do log forces via the workqueue (Eric Sandeen) [1028831] - [fs] xfs: Do background CIL flushes via a workqueue (Eric Sandeen) [1028831] - [fs] vfs: fix ELOOP error handling in path_mountpoint() (Ian Kent) [1121323] {CVE-2014-5045} - [fs] vfs: fix ref count leak in path_mountpoint() (Ian Kent) [1121323] {CVE-2014-5045} - [fs] xfs: remove xfs_itruncate_data (Brian Foster) [1113418] - [fs] xfs: split xfs_itruncate_finish (Brian Foster) [1113418] - [fs] xfs: kill xfs_itruncate_start (Brian Foster) [1113418] - [fs] xfs: factor extent map manipulations out of xfs_bmapi (Brian Foster) [1113418] - [fs] gfs2: Allow caching of glocks for flock (Robert S Peterson) [1110421] - [fs] gfs2: Allow flocks to use normal glock dq rather than dq_wait (Robert S Peterson) [1110421] - [fs] xfs: don't log dummy transaction on frozen fs (Eric Sandeen) [1076286] - [fs] ext4: set extents flag when migrating file to use extents (Eric Sandeen) [952005]- [netdrv] sfc: Add 40G link capability decoding (Nikolay Aleksandrov) [1111076] - [netdrv] sfc: Adding PCI ID for Solarflare 7000 series 40G network adapter (Nikolay Aleksandrov) [1111076] - [scsi] ibmvscsi: Add memory barriers for send / receive (Gustavo Duarte) [1099590] - [scsi] ibmvscsi: Abort init sequence during error recovery (Gustavo Duarte) [1099590] - [driver] core: fix addition of delayed probe infrastructure (Doug Ledford) [1116871] - [uapi] rdma_user_cm.h: include socket.h (Doug Ledford) [1072857] - [netdrv] bnx2x: fix set_setting for some PHYs (Michal Schmidt) [1009332] - [net] bridge: unregister rtnl message types correctly (Jiri Benc) [1114445]- [drm] nouveau: backport display fixes from upstream (Ben Skeggs) [1105194] - [drivers] platform: use always ->name for uevent (Prarit Bhargava) [1120675] - [hv] remove meaningless pr_err() in vmbus_recvpacket_raw() (Jason Wang) [1112076] - [x86] mm: fix crash when booting as a hyperv NUMA guest (Luiz Capitulino) [979364] - [powerpc] kexec: fix access to kexec_state table (Gustavo Duarte) [1118904] - [powerpc] Dynamic update cache list during suspend and resume (Gustavo Duarte) [1087793] - [netdrv] qlcnic: Initialize mailbox cmd structure to zero (Chad Dupuis) [1115438] - [netdrv] qlcnic: Fix NULL pointer dereference bug (Chad Dupuis) [1110938] - [x86] hpet: Fix bogus error check in hpet_assign_irq() (Prarit Bhargava) [1117874] - [pci] dmar: Fix return value check of create_irq() (Prarit Bhargava) [1117874] - [md] dm-thin: relax external origin size constraints (Mike Snitzer) [1030411] - [md] dm-thin: switch to an atomic_t for tracking pending new block preparations (Mike Snitzer) [1030411] - [scsi] ibmvfc: Fix for offlining devices during error recovery (Gustavo Duarte) [1108718] - [scsi] ibmvfc: Suppress ABTS if target gone (Gustavo Duarte) [1108718] - [scsi] ibmvfc: Send cancel when link is down (Gustavo Duarte) [1108718] - [scsi] ibmvfc: Support FAST_IO_FAIL in EH handlers (Gustavo Duarte) [1108718] - [scsi] ibmvfc: Properly set cancel flags when cancelling abort (Gustavo Duarte) [1108718] - [scsi] bnx2i: Update driver version to 2.7.10.1 (Maurizio Lombardi) [1120723] - [net] l2tp: don't fall back on UDP getsockopt / setsockopt (Petr Matousek) [1119462] {CVE-2014-4943}- [crypto] md5: Set statesize (Mike Snitzer) [1114137] - [crypto] hash: Fix async import on shash algorithm (Mike Snitzer) [1114137] - [crypto] drbg: Enable DRBG by default (Herbert Xu) [1105601] - [crypto] drbg: drbg_exit() can be static (Herbert Xu) [1105601] - [crypto] drbg: HMAC-SHA1 DRBG has crypto strength of 128 bits (Herbert Xu) [1105601] - [crypto] drbg: Mix a time stamp into DRBG state (Herbert Xu) [1105601] - [crypto] drbg: Select correct DRBG core for stdrng (Herbert Xu) [1105601] - [crypto] drbg: Call CTR DRBG DF function only once (Herbert Xu) [1105601] - [crypto] drbg: Fix format string for debugging statements (Herbert Xu) [1105601] - [crypto] drbg: cleanup of preprocessor macros (Herbert Xu) [1105601] - [crypto] drbg: Use Kconfig to ensure at least one RNG option is set (Herbert Xu) [1105601] - [crypto] drbg: use of kernel linked list (Herbert Xu) [1105601] - [crypto] drbg: fix memory corruption for AES192 (Herbert Xu) [1105601] - [crypto] drbg: simplify ordering of linked list in drbg_ctr_df (Herbert Xu) [1105601] - [crypto] drbg: Add DRBG test code to testmgr (Herbert Xu) [1105601] - [crypto] drbg: DRBG testmgr test vectors (Herbert Xu) [1105601] - [crypto] drbg: compile the DRBG code (Herbert Xu) [1105601] - [crypto] drbg: DRBG kernel configuration options (Herbert Xu) [1105601] - [crypto] drbg: header file for DRBG (Herbert Xu) [1105601] - [crypto] drbg: SP800-90A Deterministic Random Bit Generator (Herbert Xu) [1105601]- [crypto] fips: only panic on bad/missing crypto mod signatures (Jarod Wilson) [1105596] - [kernel] futex: avoid race between requeue and wake (Larry Woodman) [1118434] - [kernel] futex: revert back to the explicit waiter counting code (Larry Woodman) [1118434] - [kernel] futex: Avoid taking the hb->lock if there's nothing to wake up (Larry Woodman) [1118434] - [fs] epoll: do not take the nested ep->mtx on EPOLL_CTL_DEL (Larry Woodman) [1100855] - [fs] epoll: do not take global 'epmutex' for simple topologies (Larry Woodman) [1100855] - [fs] epoll: fix spurious lockdep warnings (Larry Woodman) [1100855] - [usb] ehci: fix HUB TT scheduling issue with iso transfer (Gopal) [1092967] - [usb] ehci: reorganize isochronous scheduler routine (Gopal) [1092967] - [usb] ehci: add missing frame -> microframe conversion (Gopal) [1092967] - [usb] ehci: simplify remainder computations (Gopal) [1092967] - [usb] ehci: fix audio record functionality for some Full speed sound blaster devices (Gopal) [1092967] - [usb] ehci: Respect IST when scheduling new split iTDs (Gopal) [1092967] - [usb] ehci: Minor constant fix for SCHEDULE_SLOP (Gopal) [1092967] - [scsi] ipr: Add new CCIN definition for Grand Canyon support (Gustavo Duarte) [1054284] - [scsi] ipr: Format HCAM overlay ID 0x21 (Gustavo Duarte) [1054284] - [scsi] ipr: Handle early EEH (Gustavo Duarte) [1054284] - [scsi] ipr: Add new CCIN definition for new hardware support (Gustavo Duarte) [1054284] - [scsi] ipr: Remove extended delay bit on GSCSI reads/writes ops (Gustavo Duarte) [1054284] - [scsi] ipr: increase dump size in ipr driver (Gustavo Duarte) [1054284] - [scsi] ipr: Increase msi-x interrupt vectors to 16 (Gustavo Duarte) [1054284] - [scsi] ipr: Add sereral new CCIN definitions for new adapters support (Gustavo Duarte) [1054284] - [powerpc] pseries: Add backward compatibilty to read old kernel oops-log (Gustavo Duarte) [929309] - [powerpc] pseries: Read common partition via pstore (Gustavo Duarte) [929309] - [powerpc] pseries: Read of-config partition via pstore (Gustavo Duarte) [929309] - [powerpc] pseries: Distinguish between a os-partition and non-os partition (Gustavo Duarte) [929309] - [powerpc] pseries: Read rtas partition via pstore (Gustavo Duarte) [929309] - [powerpc] pseries: Read/Write oops nvram partition via pstore (Gustavo Duarte) [929309] - [powerpc] pseries: Add version and timestamp to oops header (Gustavo Duarte) [929309] - [powerpc] pseries: Introduce generic read function to read nvram-partitions (Gustavo Duarte) [929309] - [s390] crypto: Fix aes-cbc IV corruption (Herbert Xu) [1003528] - [s390] crypto: Don't panic after crypto instruction failures (Herbert Xu) [1003528] - [s390] crypto: cleanup DES code (Herbert Xu) [1003528] - [s390] crypto: des_s390 use generic weak key check (Herbert Xu) [1003528] - [s390] crypto: remove des3_ede128 mode (Herbert Xu) [1003528] - [s390] af_iucv: correct cleanup if listen backlog is full (Hendrik Brueckner) [1112347] - [kernel] auditsc: audit_krule mask accesses need bounds checking (Denys Vlasenko) [1102705] {CVE-2014-3917} - [acpi] Fix bug when ACPI reset register is implemented in system memory (Nigel Croxon) [1102955] - [net] gro: fix deliver of trunk packets to VLAN interfaces (Marcelo Ricardo Leitner) [1112324] - [block] blk-cgroup: Accept tab as valid field delimiter (Vivek Goyal) [788580]- [kernel] utrace: force IRET path after utrace_finish_vfork() (Oleg Nesterov) [1115933] {CVE-2014-4699} - [kernel] ipc: fix race with LSMs (Paul Moore) [1115477] - [kernel] ipc: ipc_rcu_alloc() cacheline align allocation (Paul Moore) [1115477] - [kernel] ipc: ipc_schedule_free() can do vfree() directly now (Paul Moore) [1115477] - [mm] make vfree() safe to call from interrupt contexts (Paul Moore) [1115477] - [kernel] ipc: Convert ipc_immediate_free() RCU callback to kfree_rcu() (Paul Moore) [1115477] - [mm] hugetlb: ensure hugepage access is denied if hugepages are not supported (Gustavo Duarte) [1086450] - [block] rsxx: Fix possible kernel panic with invalid config (Gustavo Duarte) [1054285] - [crypto] nx: rework Kconfig (Gustavo Duarte) [1053844] - [crypto] nx: fix SHA-2 for chunks bigger than block size (Gustavo Duarte) [1053844] - [crypto] nx: fix GCM for zero length messages (Gustavo Duarte) [1053844] - [crypto] nx: fix XCBC for zero length messages (Gustavo Duarte) [1053844] - [crypto] nx: fix limits to sg lists for AES-CCM (Gustavo Duarte) [1053844] - [crypto] nx: fix limits to sg lists for AES-XCBC (Gustavo Duarte) [1053844] - [crypto] nx: fix limits to sg lists for AES-GCM (Gustavo Duarte) [1053844] - [crypto] nx: fix limits to sg lists for AES-CTR (Gustavo Duarte) [1053844] - [crypto] nx: fix limits to sg lists for AES-CBC (Gustavo Duarte) [1053844] - [crypto] nx: fix limits to sg lists for AES-ECB (Gustavo Duarte) [1053844] - [crypto] nx: add offset to nx_build_sg_lists() (Gustavo Duarte) [1053844] - [crypto] nx: fix nx-aes-gcm verification (Gustavo Duarte) [1053844] - [crypto] nx: fix concurrency issue (Gustavo Duarte) [1053844] - [crypto] nx: saves chaining value from co-processor (Gustavo Duarte) [1053844] - [crypto] nx: fix limits to sg lists for SHA-2 (Gustavo Duarte) [1053844] - [crypto] nx: fix physical addresses added to sg lists (Gustavo Duarte) [1053844] - [crypto] nx: fix typo in nx driver config option (Gustavo Duarte) [1053844] - [powerpc] pseries: Add pseries update notifier for OFDT prop changes (Gustavo Duarte) [1053844] - [netdrv] i40e: fix receive of VLAN packets (Stefan Assmann) [1113513] - [hv] Handle the case when the target file exists correctly (Jason Wang) [1102259] - [hv] Implement the file copy service (Jason Wang) [1102259] - [kernel] uuid: add uuid.h to exported header list (Jason Wang) [1102259] - [block] rename blk_get_queue to blk_get_request_queue (Mike Snitzer) [1098658] - [block] misc updates to blk_get_queue() (Mike Snitzer) [1098658] - [module] add support for soft module dependencies (Neil Horman) [968872] - [crypto] crct10dif: Simple correctness and speed test for CRCT10DIF hash (Neil Horman) [968872] - [crypto] crct10dif: Glue code to cast accelerated CRCT10DIF assembly as a crypto transform (Neil Horman) [968872] - [crypto] crct10dif: Accelerated CRC T10 DIF computation with PCLMULQDQ instruction (Neil Horman) [968872] - [crypto] crct10dif: Wrap crc_t10dif function all to use crypto transform framework (Neil Horman) [968872] - [crypto] testmgr: remove empty element from alg_test_descs (Jan Stancek) [1114983] - [block] revert "block: improve queue_should_plug() by looking at IO depths" (Jeff Moyer) [1003678] - [hv] balloon: Ensure pressure reports are posted regularly (Luiz Capitulino) [1102275] - [kvm] iommu: fix releasing unmapped page (Alex Williamson) [1110977]- [fs] sunrpc: refactor rpcauth_checkverf error returns (Scott Mayhew) [786463] - [fs] nfs: avoid expired credential keys for buffered writes (Scott Mayhew) [786463] - [fs] sunrpc: new rpc_credops to test credential expiry (Scott Mayhew) [786463] - [fs] sunrpc: don't map EKEYEXPIRED to EACCES in call_refreshresult (Scott Mayhew) [786463] - [fs] sunrpc: set gss gc_expiry to full lifetime (Scott Mayhew) [786463] - [fs] sunrpc: handle EKEYEXPIRED in call_refreshresult (Scott Mayhew) [786463] - [fs] sunrpc: Use __func__ in dprintk() in auth_gss.c (Scott Mayhew) [786463] - [fs] sunrpc: Fix machine creds in generic_create_cred and generic_match (Scott Mayhew) [786463] - [fs] sunrpc: Clean up the RPCSEC_GSS service ticket requests (Scott Mayhew) [786463] - [fs] sunrpc: Reduce switch/case indent (Scott Mayhew) [786463] - [fs] nfsd: fix minor memory leak (Scott Mayhew) [786463] - [fs] nfs: Don't mark the data cache as invalid if it has been flushed (Scott Mayhew) [1109365] - [fs] nfs: Clear NFS_INO_REVAL_PAGECACHE when we update the file size (Scott Mayhew) [1109365] - [fs] nfs: Fix cache_validity check in nfs_write_pageuptodate() (Scott Mayhew) [1109365] - [fs] vfs: plug dentry leak in mountpoint_last (Mateusz Guzik) [1114387] - [fs] nfsd: Don't hand out delegations for 30 seconds after recalling them (J. Bruce Fields) [998024] - [scsi] pm8001: Fix potential null pointer dereference and memory leak (Rich Bono) [1054927] - [scsi] pm80xx: Fix missing NULL pointer checks and memory leaks (Rich Bono) [1054927] - [scsi] pm80xx: Spinlock fix (Rich Bono) [1054927] - [scsi] pm80xx: Fixed return value issue (Rich Bono) [1054927] - [scsi] pm80xx: Removing redundant code snippets (Rich Bono) [1054927] - [scsi] pm80xx: Tasklets synchronization fix (Rich Bono) [1054927] - [scsi] pm80xx: Resetting the phy state (Rich Bono) [1054927] - [scsi] pm80xx: Fix for direct attached device (Rich Bono) [1054927] - [scsi] pm80xx: Firmware logging support (Rich Bono) [1054927] - [scsi] pm80xx: Phy settings support for motherboard controller (Rich Bono) [1054927] - [scsi] pm80xx: IButton security feature support for motherboard controllers (Rich Bono) [1054927] - [scsi] pm80xx: Print SAS address of IO failed device (Rich Bono) [1054927] - [scsi] pm80xx: 4G boundary fix (Rich Bono) [1054927] - [scsi] pm80xx: Set device state response logic fix (Rich Bono) [1054927] - [scsi] pm80xx: Display controller BIOS version (Rich Bono) [1054927] - [scsi] pm80xx: Indirect SMP request fix (Rich Bono) [1054927] - [scsi] pm80xx: Device id changes to support series 8 controllers (Rich Bono) [1054927] - [scsi] pm80xx: Fix for 32 bit compilation warning (Rich Bono) [1054927] - [security] keys: Increase root_maxkeys and root_maxbytes sizes (Steve Dickson) [1113607] - [net] ipv4: fix route cache rebuilds (Jiri Pirko) [1111631] - [net] sch_tbf: handle too small burst (Florian Westphal) [1103694] - [net] don't account for udp header size when computing seglen (Florian Westphal) [1103694] - [net] sctp: Fix sk_ack_backlog wrap-around problem (Daniel Borkmann) [1085932] {CVE-2014-4667} - [net] neigh: set nud_state to NUD_INCOMPLETE when probing router reachability (Hannes Frederic Sowa) [1110192] - [scsi] dual scan thread bug fix (David Milburn) [1079922] - [scsi] fix our current target reap infrastructure (David Milburn) [1079922] - [netdrv] sfc: Demote "MC Scheduler error" messages (Nikolay Aleksandrov) [805817] - [input] wacom: fix regression on X220 tablets (Aristeu Rozanski) [1112852] - [doc] procfs: fix incorrect formula to calculate CommitLimit value (Petr Oros) [1050174] - [netdrv] tg3: Clear NETIF_F_TSO6 flag before doing software GSO (Ivan Vecera) [1108572] - [fs] devpts: Add ctl_names back to moved proc files' ctl_tables (Prarit Bhargava) [1105533]- [drm] i915: backport fixes from upstream (Dave Airlie) [1110555] - [acpi] acpi_pad: power_saving_thread() call schedule() when need_resched is true (Tony Camuso) [831828] - [x86] apic: Plug racy xAPIC access of CPU hotplug code (Igor Mammedov) [1075145] - [x86] intel_pstate: Add CPU IDs for Broadwell processors (Steve Best) [1109389] - [x86] exec: fix leak of 32-bit libary mapping behavior to 64-bit children (Denys Vlasenko) [1064475] - [mm] memcg: fix race condition between memcg teardown and swapin (Johannes Weiner) [1001197] - [netdrv] vmxnet3: adjust ring sizes when interface is down (Neil Horman) [1079060] - [x86] kvm: expose ADX feature to guest (Don Dugger) [1097017] - [x86] kvm: expose new instruction RDSEED to guest (Don Dugger) [1097017] - [x86] cpufeature: Add the RDSEED and ADX features (Don Dugger) [1097017] - [x86] avx-512: Enable AVX-512 States Context Switch (Rui Wang) [1036233] - [x86] avx-512: AVX-512 Feature Detection (Rui Wang) [1036233] - [acpi] emca: Combine eMCA/EDAC event reporting priority (Rui Wang) [1032255] - [edac] Add an edac_report parameter to EDAC (Rui Wang) [1032255] - [x86] Export 'boot_cpu_physical_apicid' to modules (Rui Wang) [1032255] - [acpi] Fix extended error log driver to depend on CONFIG_X86_LOCAL_APIC (Rui Wang) [1032255] - [dmi] Avoid unaligned memory access in save_mem_devices() (Rui Wang) [1032255] - [acpi] Move cper.c from drivers/acpi/apei to drivers/firmware/efi (Rui Wang) [1032255] - [acpi] cper: Cleanup CPER memory error output format (Rui Wang) [1032255] - [acpi] cper: Enhance memory reporting capability (Rui Wang) [1032255] - [acpi] cper: Add UEFI 2.4 support for memory error (Rui Wang) [1032255] - [x86] mce: Add validation check before GHES error is recorded (Rui Wang) [1032255] - [dmi] Parse memory device type 17 in SMBIOS (Rui Wang) [1032255] - [dmi] Add DMI entry types to the headers (Rui Wang) [1032255] - [acpi] Extended error log driver for x86 platform (Rui Wang) [1032255] - [edac] bitops: Introduce a more generic BITMASK macro (Rui Wang) [1032255] - [acpi] cper: Update cper info (Rui Wang) [1032255] - [acpi] cper: Fix status check during error printing (Rui Wang) [1032255] - [acpi] ghes: add the needed hooks for EDAC error report (Rui Wang) [1032255] - [acpi] ghes: move structures/enum to a header file (Rui Wang) [1032255] - [lib] ratelimit: fix the return value when __ratelimit() fails to acquire the lock (Jiri Pirko) [1082772] - [lib] ratelimit: Fix/allow use in atomic contexts (Jiri Pirko) [1082772]- [fs] fuse: fix nlink after unlink (Brian Foster) [1054351] - [fs] fuse: fix fallocate vs. ftruncate race (Brian Foster) [1035422] - [fs] fuse: wait for writeback in fuse_file_fallocate() (Brian Foster) [1035422] - [fs] fuse: use list_for_each_entry() for list traversing (Brian Foster) [1035422] - [fs] fuse: readdir: check for slash in names (Brian Foster) [1035422] - [fs] fuse: hotfix truncate_pagecache() issue (Brian Foster) [1035422] - [fs] fuse: invalidate inode attributes on xattr modification (Brian Foster) [1035422] - [fs] fuse: postpone end_page_writeback() in fuse_writepage_locked() (Brian Foster) [1035422] - [fs] fuse: fix readdirplus Oops in fuse_dentry_revalidate (Brian Foster) [1035422] - [fs] fuse: allocate for_background dio requests based on io->async state (Brian Foster) [1035422] - [fs] fuse: optimize wake_up (Brian Foster) [1035422] - [fs] fuse: implement exclusive wakeup for blocked_waitq (Brian Foster) [1035422] - [fs] fuse: skip blocking on allocations of synchronous requests (Brian Foster) [1035422] - [fs] fuse: add flag fc->initialized (Brian Foster) [1035422] - [fs] fuse: make request allocations for background processing explicit (Brian Foster) [1035422] - [fs] fuse: fix hang of single threaded fuseblk filesystem (Brian Foster) [1035422] - [fs] fuse: allow control of adaptive readdirplus use (Brian Foster) [1035422] - [fs] fuse: avoid out-of-scope stack access (Brian Foster) [1035422] - [fs] fuse: Adapt readdirplus to application usage patterns (Brian Foster) [1035422] - [fs] fuse: delete dead .write_begin and .write_end aops (Brian Foster) [1035422] - [fs] fuse: separate queue for FORGET requests (Brian Foster) [1035422] - [fs] fuse: flush background queue on connection close (Brian Foster) [1035422] - [fs] fuse: support splice() reading from fuse device (Brian Foster) [1035422] - [fs] fuse: export generic_pipe_buf_*() to modules (Brian Foster) [1035422] - [fs] fuse: allow splice to move pages (Brian Foster) [1035422] - [fs] fuse: support splice() writing to fuse device (Brian Foster) [1035422] - [fs] fuse: get page reference for readpages (Brian Foster) [1035422] - [fs] bio: modify __bio_add_page to accept pages that dont start a new segment (Maurizio Lombardi) [885517] - [fs] bio: modify __bio_add_page() to accept pages that don't start a new segment (Maurizio Lombardi) [885517] - [fs] gfs2: Only wait for demote when last holder is dequeued (Robert S Peterson) [1110421] - [fs] btrfs: fix bio rw flag usage (Zach Brown) [1072112] - [fs] nfsd: notify_change needs elevated write count (Mateusz Guzik) [1105057] - [fs] cifs: ensure that srv_mutex is held when dealing with ssocket pointer (Sachin Prabhu) [1010233] - [fs] nfsv4: close needs to handle NFS4ERR_ADMIN_REVOKED (Dave Wysochanski) [1082127] - [fs] ext4: init pagevec in ext4_da_block_invalidatepages (Lukas Czerner) [876803] - [fs] ext4: Report max_batch_time option correctly (Lukas Czerner) [1100523] - [fs] ext4: fix deadlock when writing in ENOSPC conditions (Lukas Czerner) [1075780] - [fs] ext4: set b_blocknr to zero when block_validity fails (Lukas Czerner) [997894] - [fs] nfs: Use error handler on failed GETATTR with successful OPEN (Steve Dickson) [1104292] - [fs] lockd: Ensure that nlmclnt_block resets block->b_status after a server reboot (Steve Dickson) [959006] - [fs] nfs: Handle session reset before lease check (Scott Mayhew) [1090656] - [fs] ext4: Avoid underflow in ext4_trim_fs() (Lukas Czerner) [998785] - [fs] gfs2: When adding a new dir entry, inc link count if it is a subdir (Robert S Peterson) [1092083] - [fs] gfs2: Make gfs2_dir_del update link count when required (Robert S Peterson) [1092083] - [fs] gfs2: Don't use gfs2_change_nlink in link syscall (Robert S Peterson) [1092083] - [netdrv] mlx4_en: Add missing size to net_device_ops_ext structures (Amir Vadai) [1059086] - [netdrv] mlx4_en: Implement ndo_get_phys_port for VF's (Amir Vadai) [1059086]- [infiniband] usnic: fix up Kconfig items (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: drop hpn module option (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Reset RoCE VF gids when guest driver goes down (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Invoke UPDATE_QP for proxy QP1 on MAC changes (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Add UPDATE_QP SRIOV wrapper support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix slave id computation for single port VF (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Adjust port number in qp_attach wrapper when detaching (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: don't use napi_synchronize inside mlx4_en_netpoll (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Defer VF initialization till PF is fully initialized (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Preserve pci_dev_data after __mlx4_remove_one() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Add block multicast loopback support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Unregister inet notifier when unloading ocrdma (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix warnings about pointer <-> integer casts (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Code clean-up (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Display FW version (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Query controller information (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Support non-embedded mailbox commands (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Handle CQ overrun error (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Display proper value for max_mw (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Use non-zero tag in SRQ posting (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Memory leak fix in ocrdma_dereg_mr() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Increment abi version count (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Update version string (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: ABI versioning between ocrdma and be2net (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Allow DPP QP creation (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Read ASIC_ID register to select asic_gen (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: SQ and RQ doorbell offset clean up (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: EQ full catastrophe avoidance (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Don't resolve passive side RoCE L2 address in CMA REQ handler (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Remove overload in ib_sg_dma* (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ehca: Remove ib_sg_dma_address() and ib_sg_dma_len() overloads (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ipath: Remove ib_sg_dma_address() and ib_sg_dma_len() overloads (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Remove ib_sg_dma_address() and ib_sg_dma_len() overloads (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Bump driver version to 1.3 (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Update Mellanox copyright note (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Print QP information once connection is established (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Remove struct iscsi_iser_conn (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Drain the tx cq once before looping on the rx cq (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Fix sector_t format warning (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4_core: Make buffer larger to avoid overflow warning (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4_core: Fix some indenting in mlx4_ib_add() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mad: Check and handle potential DMA mapping errors (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ehca: Returns an error on ib_copy_to_udata() failure (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mthca: Return an error on ib_copy_to_udata() failure (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Add support for CONFIG_DEV command (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: USe one wrapper that returns -EPERM (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: pass pci_device_id.driver_data to __mlx4_init_one during reset (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Use actual number of PCI functions (PF + VFs) for alias GUID logic (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Fix a race condition between failing I/O and I/O completion (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Avoid that writing into "add_target" hangs due to a cable pull (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Make writing into the "add_target" sysfs attribute interruptible (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Avoid duplicate connections (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Add more logging (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Check ib_query_gid return value (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [scsi] scsi_transport_srp: Fix two kernel-doc warnings (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Adapt num_vfs/probed_vf params for single port VF (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Adapt code for N-Port VF (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Add utils for N-Port VFs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Add data structures to support N-Ports per VF (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4_ib: Adapt code to use caps.num_ports instead of a constant (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Cleanup qib_register_observer() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Change SDMA progression mode depending on single- or multi-rail (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Publish T10-PI support to SCSI midlayer (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Implement check_protection (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [scsi] libiscsi: Add check_protection callback for transports (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Support T10-PI operations (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Initialize T10-PI resources (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Introduce pi_enable, pi_guard module parameters (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Generalize fall_to_bounce_buf routine (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Generalize iser_unmap_task_data and finalize_rdma_unaligned_sg (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Replace fastreg descriptor valid bool with indicators container (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Keep IB device attributes under iser_device (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Move fast_reg_descriptor initialization to a function (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Push the decision what memory key to use into fast_reg_mr routine (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Avoid FRWR notation, use fastreg instead (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Suppress completions for fast registration work requests (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Fix a sparse endianness warning (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix compiler warning (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Remove duplicate check in get_a_ctxt() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Remove '0x' when using pa format (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Fix memory leak of recv context when driver fails to initialize (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: fixup indentation in qib_ib_rcv() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: add missing braces in do_qib_user_sdma_queue_create() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Modify software pma counters to use percpu variables (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Add percpu counter replacing qib_devdata int_counter (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Fix debugfs ordering issue with multiple HCAs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ipath: Fix potential buffer overrun in sending diag packet routine (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Fix potential buffer overrun in sending diag packet routine (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Don't receive packets when the napi budget == 0 (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix wrong dump of the vxlan offloads device capability (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Activate RoCE/SRIOV (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_ib: Fix SIDR support of for UD QPs under SRIOV/RoCE (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Implement IP based gids support for RoCE/SRIOV (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Add ref counting to port MAC table for RoCE (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: In RoCE allow guests to have multiple GIDS (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: For RoCE, allow slaves to set the GID entry at that slave's index (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Adjust QP1 multiplexing for RoCE/SRIOV (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5_core: remove unreachable function call in module init (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Expose support for signature MR feature (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Collect signature error completion (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Support IB_WR_REG_SIG_MR (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Keep mlx5 MRs in a radix tree under device (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Remove MTT access mode from umr flags helper function (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Break up wqe handling into begin & finish routines (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Initialize mlx5_ib_qp signature-related members (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Implement create_mr and destroy_mr (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Introduce signature verbs API (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Introduce protected memory regions (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: mlx4_init_slave() shouldn't access comm channel before PF is ready (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix memory access error in mlx4_QUERY_DEV_CAP_wrapper() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: mlx4_en_verify_params() can be static (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Support shutdown() interface (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] Refactor umem to use linear SG table (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Change Connect-X description in kconfig (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Use union for BlueFlame WQE (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix sparse warning (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Fix selftest failing on non 10G link speed (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Replace mlx4_en_mac_to_u64() with mlx4_mac_to_u64() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Move queue stopped/waked counters to be per ring (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Pad ethernet packets smaller than 17 bytes (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Verify mlx4_en module parameters (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Fix UP limit in ieee_ets->prio_tc (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Fix bad use of dev_id (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx: Bump all Mellanox driver versions (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Fix limiting number of IRQ's instead of RSS queues (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Set number of RX rings in a utility function (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix load time panic during GID table init (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix traffic class shift (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Fix use after free in iser_snd_completion() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Avoid dereferencing iscsi_iser conn object when not bound to iser connection (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Fix smatch endianness error (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Use pci_enable_msix_range() instead of pci_enable_msix() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Use pci_enable_msix_range() instead of pci_enable_msix() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Remove dependency on X86 (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Add include of because of kzalloc()/kfree() use (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] Report using RoCE IP based gids in port caps (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Build the port IBoE GID table properly under bonding (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Do IBoE GID table resets per-port (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Do IBoE locking earlier when initializing the GID table (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Move rtnl locking to the right place (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Make sure GID index 0 is always occupied (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Don't allocate range of steerable UD QPs for Ethernet-only device (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Don't set "block multicast loopback" capability (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix binary compatibility with libmlx5 (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix RC transport send queue overhead computation (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Verify reserved fields are cleared (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Remove old field for create mkey mailbox (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Abort driver cleanup if teardown hca fails (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Allow creation of QPs with zero-length work queues (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Fix PowerPC support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: use uintptr_t casts to work around gcc warnings (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Improve debugfs readability (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Add support for resize CQ (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Implement modify CQ (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Make sure doorbell record is visible before doorbell (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Use mlx5 core style warning (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Clear out struct before create QP command (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Fix out arg size in access_register command (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Remove unused includes of (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Fix unused variable warning (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] cma: Handle global/non-linklocal IPv6 addresses in cma_check_linklocal() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Remove unnecessary validation for port number (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Use GFP_ATOMIC under spinlock (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [scsi] scsi_transport_srp: Fix kernel-doc warnings (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [scsi] scsi_transport_srp: Fix a race condition (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [scsi] scsi_transport_srp: Block rport upon TL error even with fast_io_fail_tmo = off (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Add dependency on INET (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Move ocrdma_inetaddr_event outside of "#if CONFIG_IPV6" (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Add dependency INET (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] cm: Fix missing unlock on error in cm_init_qp_rtr_attr() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Make ib_addr a core IB module (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Resolve Ethernet L2 addresses when modifying QP (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Populate GID table with IP based gids (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Handle Ethernet L2 parameters for IP based GID addressing (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Handle Ethernet L2 parameters for IP based GID addressing (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Use IBoE (RoCE) IP based GIDs in the port GID table (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] cma: IBoE (RoCE) IP-based GID addressing (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Fix error return code (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Remove unused variable in usnic_debugfs_exit() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Set userspace/kernel ABI ver to 4 (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Advertise usNIC devices as RDMA_NODE_USNIC_UDP (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Add support for RDMA_NODE_USNIC_UDP (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Add dependency on CONFIG_INET (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Fix endianness-related warnings (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: clean up srq_res_start_move_to() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: clean up cq_res_start_move_to() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Ethernet L2 attributes in verbs/cm structures (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Add support for steerable IB UD QPs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Add mechanism to support flow steering over IB links (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Enable device-managed steering support for IB ports too (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Add support for steerable IB UD QPs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Add support for IB L2 device-managed steering (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Add flow steering support for IPoIB UD traffic (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix micro UAR allocator (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Remove dead code (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Remove unused code in mr.c (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Append documentation to usnic_transport.h and cleanup (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Fix typo "Ignorning" -> "Ignoring" (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Expose flows via debugfs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Use for_each_sg instead of a for-loop (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Remove superflous parentheses (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Add RDMA_TRANSPORT_USNIC_UDP (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Add UDP support in usnic_ib_qp_grp.h, usnic_ib_qp_grp.c (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Add UDP support in u*verbs.c, u*main.c and u*util.h (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Add UDP support to usnic_transport.h, usnice_transport.c (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Add UDP support to usnic_fwd.h, usnic_fwd.c (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Update ABI and Version file for UDP support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Port over sysfs to new usnic_fwd.h (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Port over usnic_ib_qp_grp.* to new usnic_fwd.h (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Port over main.c and verbs.c to the usnic_fwd.h (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Push all forwarding state to usnic_fwd.h & uscnic_fwd.c (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Add struct usnic_transport_spec (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Change WARN_ON to lockdep_assert_held (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] usnic: Add Cisco VIC low-level hardware driver (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix OCRDMA_GEN2_FAMILY macro definition (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix AV_VALID bit position (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Select PTP_1588_CLOCK (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] make sure the src net is infiniband when create new link (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Only cycle port if HW timestamp config changes (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Add PTP hardware clock (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: slight optimization of addr compare (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] uverbs: Check access to userspace response buffer in extended command (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] uverbs: Check input length in flow steering uverbs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] uverbs: Set error code when fail to consume all flow_spec items (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] uverbs: Check reserved fields in create_flow (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] uverbs: Check comp_mask in destroy_flow (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] uverbs: Check reserved field in extended command header (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] uverbs: New macro to set pointers to NULL if length is 0 in INIT_UDATA() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [net] rds: prevent BUG_ON triggered on congestion update to loopback (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Check port number for validity before accessing data (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Add NAPI support for transmit side (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Ignore irrelevant hypervisor events (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Set CQE/EQE size to 64B by default (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Implement ndo_get_phys_port_id (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Expose physical port id as PF/VF capability (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Introduce nic_info new flag in QUERY_FUNC_CAP (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Rename QUERY_FUNC_CAP fields (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Remove zeroed out of explicit QUERY_FUNC_CAP fields (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: const'ify inbuf in struct ib_udata (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iwcm: Don't touch cm_id after deref in rem_ref (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Roll back round robin bitmap allocation commit for CQs, SRQs, and MPTs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: destroy workqueue when driver fails to register (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Remove selftest TX queues empty condition (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Implement the SIOCGHWTSTAMP ioctl (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Re-enable create_flow/destroy_flow uverbs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: extended command an improved infrastructure for uverbs commands (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Remove ib_uverbs_flow_spec structure from userspace (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Use a common header for uverbs flow_specs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Make uverbs flow structure use names like verbs ones (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Rename 'flow' structs to match other uverbs structs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: clarify overflow/underflow checks on ib_create/destroy_flow (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ucma: Convert use of typedef ctl_table to struct ctl_table (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix page shift in create CQ for userspace (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Fix device max capabilities check (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix list_del of empty list (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Remove dead code (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Encorce MR access rights rules on kernel consumers (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Fix endless loop in resize CQ (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ucma: Discard events for IDs not yet claimed by user space (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Add Cisco usNIC rdma node and transport types (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Report receive errors correctly (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Avoid offlining operational SCSI devices (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Remove target from list before freeing Scsi_Host structure (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Add change_queue_depth and change_queue_type support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Make queue size configurable (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Introduce srp_alloc_req_data() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Export sgid to sysfs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Add periodic reconnect functionality (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [scsi] scsi_transport_srp: Add periodic reconnect support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Start timers if a transport layer error occurs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Use SRP transport layer error recovery (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [scsi] scsi_transport_srp: Add transport layer error handling (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Keep rport as long as the IB transport layer (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Make transport layer retry count configurable (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ipath: Convert ipath_user_sdma_pin_pages() to use get_user_pages_fast() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Remove redundant check in ocrdma_build_fr() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix a crash in rmmod (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Silence an integer underflow warning (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Use enum to indicate adapter page size (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Update opt param mask for RTS2RTS (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Remove "Always false" comparison (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Remove dead code in mr.c (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Change optimal_reclaimed_pages for better performance (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Clear reserved area in set_hca_cap() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Support communicating arbitrary host page size to firmware (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Fix cleanup flow when DMA mapping fails (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix srq free in destroy qp (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Simplify mlx5_ib_destroy_srq (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix overflow check in IB_WR_FAST_REG_MR (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Multithreaded create MR (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix check of number of entries in create CQ (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] netlink: Remove superfluous RDMA_NL_GET_OP() masking (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Pass imm_data from ib_uverbs_send_wr to ib_send_wr correctly (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ipoib: Start multicast join process only on active ports (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ipoib: Add path query flushing in ipoib_ib_dev_cleanup (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ipoib: Fix usage of uninitialized multicast objects (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ipoib: Avoid flushing the driver workqueue on dev_down (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ipoib: Fix deadlock between dev_change_flags() and __ipoib_dev_flush() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ipoib: Change CM skb memory allocation to be non-atomic during init (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] ipoib: Fix crash in dev_open error flow (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Datapath structures are allocated per NUMA node (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: ICM pages are allocated on device NUMA node (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Datapath resources allocated dynamically (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Add immediate activate for VGT->VST->VGT (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Initialize all mailbox buffers to zero before use (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Add RFS support in UDP (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] cma: Set IBoE SL (user-priority) by egress map when using vlans (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Implement resource quota enforcement (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix quota handling in the QUERY_FUNC_CAP wrapper (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Structures and init/teardown for VF resource quotas (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix checking order in MR table init (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Don't fail reg/unreg vlan for older guests (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Resource tracker for reg/unreg vlans (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Use vlan id instead of vlan index for unregistration (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix reg/unreg vlan/mac to conform to the firmware spec (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix register/unreg vlan flow (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix call to __mlx4_unregister_mac (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Temporarily disable create_flow/destroy_flow uverbs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Unused local variable in mlx4_opreq_action (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Fix typo, move similar defs to same location (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Clean the code to eliminate trivial build warnings (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] Remove unnecessary semicolons (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Ensure proper synchronization accessing memory (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix alignment of reg umr gather buffers (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix eq names to display nicely in /proc/interrupts (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Fix error code translation from firmware to driver (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix opt param mask according to firmware spec (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Fix opt param mask for sq err to rts transition (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Disable atomic operations (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Fix layout of struct mlx5_init_seg (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Keep polling to reclaim pages while any returned (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Avoid async events on invalid port number (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Decrease memory consumption of mr caches (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Remove checksum on command interface commands (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix memory leak in mlx5_ib_create_srq (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Flush cache workqueue before destroying it (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix send work queue size calculation (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Rename name of mlx4_en_rx_alloc members (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: remove unused MLX5_DEBUG param in Kconfig (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix compiler warning about int/pointer size mismatch (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Fix redundant pointer check in dealloc flow (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Fix possible memory leak in iser_create_frwr_pool() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix passing wrong opcode to modify_srq (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fill PVID in UMC case (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Add ABI versioning support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Consider multiple SGES in case of DPP (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix for displaying proper link speed (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Increase STAG array size (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Dont use PD 0 for userpace CQ DB (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: FRMA code cleanup (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: For ERX2 irrespective of Qid, num_posted offset is 24 (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Fix to work with even a single MSI-X vector (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Remove the MTU check based on Ethernet MTU (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Add support for fast register work requests (FRWR) (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Create IRD queue fix (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Better checking of userspace values for receive flow steering (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: Add receive flow steering support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Export ib_create/destroy_flow through uverbs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Infrastructure for extensible uverbs commands (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Add receive flow steering support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Reduce scope of local variables in mlx4_en_xmit (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Fix handling of dma_map failure (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Notify user when TX ring in error state (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Disable global flow control when PFC enabled (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Coding style cleanup in mlx4_en_dcbnl_ieee_setpfc() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Support MANAGE_PAGES and QUERY_PAGES firmware command changes (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Fixes to XRC reference counting in uverbs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Add locking around event dispatching on XRC target QPs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Fix XRC QPs detection in the resource tracker (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Cache recv DB until QP moved to RTR (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Remove __packed (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Remove driver QP state machine (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Don't allow zero/invalid sgid usage (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Remove redundant dev reference (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] ocrdma: Style and redundant code cleanup (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Introduce fast memory registration model (FRWR) (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Place the fmr pool into a union in iser's IB conn struct (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Handle unaligned SG in separate function (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Generalize rdma memory registration (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Accept session->cmds_max from user space (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Restructure allocation/deallocation of connection resources (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] iser: Use proper debug level value for info prints (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Staticize local functions (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: remove health handler plugin (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: rename CONFIG_NET_LL_RX_POLL to CONFIG_NET_RX_BUSY_POLL (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: VFs must ignore the enable_64b_cqe_eqe module param (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Don't give VFs MAC addresses which are derived from the PF MAC (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Variable may be used uninitialized (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Implement new initialization sequence (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix stack info leak in mlx5_ib_alloc_ucontext() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Fix error return code in init_one() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] cma: Only call cma_save_ib_info() for CM REQs (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] cma: Fix accessing invalid private data for UD (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: fix error return code in mlx5_alloc_uuars() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] cma: Fix gcc warning (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Respond to operation request by firmware (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: use after free in mlx5_cmd_comp_handler() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5 core: Fix __udivdi3 when compiling for 32 bit arches (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5: Return -EFAULT instead of -EPERM (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Adjust hca_cap.uar_page_sz to conform to Connect-IB spec (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Let srp_abort() return FAST_IO_FAIL if TL offline (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] rename ll methods to busy-poll (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] rename include/net/ll_poll.h to include/net/busy_poll.h (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] uverbs: Use get_unused_fd_flags(O_CLOEXEC) instead of get_unused_fd() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx5_core: Fixes for sparse warnings (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Make profile[] static in main.c (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_core: Add HW enforcement to VF link state (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx5: Add driver for Mellanox Connect-IB adapters (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Add reserved values to enums for low-level driver use (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Bump driver version and release date (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Make HCA completion vector configurable (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Maintain a single connection per I_T nexus (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Fail I/O fast if target offline (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Skip host settle delay (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Avoid skipping srp_reset_host() after a transport error (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] srp: Fix remove_one crash due to resource exhaustion (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Remove an unnecessary test (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Fix a race between napi poll function and RX ring cleanup (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Move register_netdev() to the end of initialization function (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] core: Fix error return code in add_port() (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Add VF link state support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4: Add VF MAC spoof checking support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] mlx4: use __netdev_pick_tx instead of __skb_tx_hash in mlx4_en_select_queue (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Low Latency recv statistics (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [netdrv] mlx4_en: Add Low Latency Socket (LLS) support (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] switch infiniband uverbs to anon_inodes (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] qib: Optimize CQ callbacks (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [infiniband] drivers: avoid format string in dev_set_name (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [fs] make get_unused_fd_flags() a function (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [base] drivercore: Add driver probe deferral mechanism (Doug Ledford) [1029861 1030158 1043993 1051207 1053497 1054375 1059083 1059086 1059087 1059089 1062766 1078538 696003 807078 826288] - [net] vlan: Implement vlan_dev_get_egress_qos_mask as an inline (Doug Ledford) [1051207] - [net] vlan: Provide read access to the vlan egress map (Doug Ledford) [1051207] - [net] vlan: fix a race in egress prio management (Doug Ledford) [1051207] - [net] core: Add VF link state control policy (Doug Ledford) [1059086] - [net] core: Add VF link state control (Doug Ledford) [1059086] - [net] rtnetlink: Fix VF IFLA policy (Doug Ledford) [1059086] - [net] if_link: Add additional parameter to IFLA_VF_INFO for spoof checking (Doug Ledford) [1059086] - [firmware] iwlwifi: update firmware for 7260 / 3160 devices (Stanislaw Gruszka) [1054423]- [fs] vfs: fix autofs/afs/etc magic mountpoint breakage (Frantisek Hrbata) [1079347] {CVE-2014-0203} - [kernel] sched_cpupri: Fix memory barriers for vec updates to always be in order (Daniel Bristot de Oliveira) [1079478] - [kernel] sched_cpupri: Remove the vec->lock (Daniel Bristot de Oliveira) [1079478] - [md] always set MD_RECOVERY_INTR when interrupting a reshape thread (Jes Sorensen) [1109782] - [md] always set MD_RECOVERY_INTR when aborting a reshape or other "resync" (Jes Sorensen) [1109782] - [md] avoid possible spinning md thread at shutdown (Jes Sorensen) [1109782] - [netdrv] hyperv: Add hash value into RNDIS Per-packet info (Jason Wang) [1102261] - [netdrv] hyperv: Properly handle checksum offload (Jason Wang) [1102261] - [netdrv] hyperv: Enable sendbuf mechanism on the send path (Jason Wang) [1102261] - [netdrv] hyperv: Simplify the send_completion variables (Jason Wang) [1102261] - [netdrv] hyperv: Remove recv_pkt_list and lock (Jason Wang) [1102261] - [netdrv] hyperv: Add support for virtual Receive Side Scaling vRSS (Jason Wang) [1102261] - [hv] vmbus: Implement per-CPU mapping of relid to channel (Jason Wang) [1102261] - [hv] Eliminate the channel spinlock in the callback path (Jason Wang) [1102261] - [netdrv] hyperv: Address UDP checksum issues (Jason Wang) [1102261] - [netdrv] hyperv: Negotiate suitable ndis version for offload support (Jason Wang) [1102261] - [netdrv] hyperv: Allocate memory for all possible per-pecket information (Jason Wang) [1102261] - [netdrv] hyperv: Enable large send offload (Jason Wang) [1102261] - [netdrv] hyperv: Enable send side checksum offload (Jason Wang) [1102261] - [netdrv] hyperv: Enable receive side IP checksum offload (Jason Wang) [1102261] - [netdrv] hyperv: Enable offloads on the host (Jason Wang) [1102261] - [netdrv] hyperv: Cleanup the send path (Jason Wang) [1102261] - [netdrv] hyperv: Enable scatter gather I/O (Jason Wang) [1102261] - [hv] vmbus: Increase the limit on the number of pfns we can handle (Jason Wang) [1102261] - [netdrv] hyperv: Add latest NetVSP versions to auto negotiation (Jason Wang) [1102261] - [netdrv] hyperv: Cleanup the netvsc receive callback functio (Jason Wang) [1102261] - [netdrv] hyperv: Cleanup the receive path (Jason Wang) [1102261] - [netdrv] hyperv: Get rid of the rndis_filter_packet structure (Jason Wang) [1102261] - [hv] vmbus: Support per-channel driver state (Jason Wang) [1102261] - [kernel] kthread: ensure locality of task_struct allocations (Doug Ledford) [1109975] - [kernel] kthread: make kthread_create() killable (Doug Ledford) [1109975] - [kernel] kthread: NUMA aware kthread_create_on_node() (Doug Ledford) [1109975] - [kernel] NUMA aware alloc_thread_info_node() (Doug Ledford) [1109975] - [kernel] NUMA aware alloc_task_struct_node() (Doug Ledford) [1109975] - [netdrv] sfc: use gso_max_segs and remove RHEL-specific hack (Nikolay Aleksandrov) [1021960] - [block] brd: Fix brd_lookup_page() race (Jeff Moyer) [962593] - [scsi] isci: fix needless ata reset escalation (David Milburn) [1074943] - [acpi] acpica: Add "Windows 2013" string to _OSI support (Lenny Szubowicz) [1093502] - [acpi] acpica: Add Windows8/Server2012 string for _OSI method (Lenny Szubowicz) [1093502] - [acpi] acpica: Add Vista SP2 to supported _OSI strings (Lenny Szubowicz) [1093502] - [x86] Replace left over sti/cli in ia32 audit exit code (Niels de Vos) [1105048] - [kernel] audit: Call tty_audit_push_task() outside preempt disabled (Mateusz Guzik) [1097315] - [kernel] watchdog: touch_nmi_watchdog should only touch local cpu not every one (Don Zickus) [646626] - [kernel] Fix race condition in add_memory_block that can cause kernel panic when ballooning down memory (Larry Woodman) [1102551] - [kernel] percpu: fix this_cpu_sub() subtrahend casting for unsigneds (Doug Ledford) [1105648] - [kernel] percpu: fix __this_cpu_*_return() definition (Doug Ledford) [1105648] - [kernel] percpu: Generic support for this_cpu_add, sub, dec, inc_return (Doug Ledford) [1105648] - [kernel] percpu: make alloc_percpu() handle array types (Doug Ledford) [1105648] - [kernel] this_cpu: Introduce this_cpu_ptr() and generic this_cpu_* operations (Doug Ledford) [1105648] - [net] tcp: syncookies: do not use getnstimeofday() (Florian Westphal) [1084438] - [net] tcp: syncookies: reduce mss table to four values (Florian Westphal) [1084438] - [net] tcp: syncookies: update mss tables (Florian Westphal) [1084438] - [net] tcp: syncookies: reduce cookie lifetime to 128 seconds (Florian Westphal) [1084438] - [net] rate-limit warn-bad-offload splats (Nikolay Aleksandrov) [1103683] - [net] Use device model to get driver name in skb_gso_segment() (Nikolay Aleksandrov) [1103683] - [net] openvswitch: fix use-after-free bug in netns (Flavio Leitner) [1100127] - [net] llc: Fix length check in llc_fixup_skb() (Jiri Benc) [1101053] - [net] unix socket code abuses csum_partial (Hannes Frederic Sowa) [1077296] - [net] fix wrong mac_len calculation for vlans (Nikolay Aleksandrov) [1102044] - [net] tcp: fix a timewait refcnt race (Jiri Benc) [1098048] - [net] filter: add vlan tag access (Jiri Benc) [1082097] - [net] filter: add XOR operation (Jiri Benc) [1082097] - [net] filter: add SKF_AD_RXHASH and SKF_AD_CPU (Jiri Benc) [1082097] - [net] filter: Socket filter ancilliary data access for skb->dev->type (Jiri Benc) [1082097] - [net] filter: Add SKF_AD_QUEUE instruction (Jiri Benc) [1082097] - [net] filter: ingress socket filter by mark (Jiri Benc) [1082097] - [scsi] bnx2i: Make boot_nic entry visible in the sysfs session objects (Maurizio Lombardi) [1101442] - [scsi] hpsa: update driver version to 3.4.4-1-RH1 (Tomas Henzl) [1108346] - [scsi] hpsa: add new Smart Array PCI IDs (May 2014) (Tomas Henzl) [1108346] - [scsi] hpsa: Checking for a NULL return from a kzalloc call (Tomas Henzl) [1108346]- [scsi] Add timeout to avoid infinite command retry (David Milburn) [974583] - [md] dm-thin: update discard_granularity to reflect the thin-pool blocksize (Mike Snitzer) [1108809] - [md] dm-bio-prison: implement per bucket locking in the dm_bio_prison hash table (Mike Snitzer) [1108809] - [md] dm-thin: return ENOSPC instead of EIO when error_if_no_space enabled (Mike Snitzer) [1108809] - [netdrv] i40evf: don't use RESETTING state during reinit (Stefan Assmann) [1038788] - [netdrv] i40evf: remove storm control (Stefan Assmann) [1038788] - [netdrv] i40evf: Remove reserved PCTYPE defines (Stefan Assmann) [1038788] - [netdrv] i40evf: Update check for AQ aliveness (Stefan Assmann) [1038788] - [netdrv] i40evf: Use is_multicast_ether_addr helper (Stefan Assmann) [1038788] - [netdrv] i40evf: remove usless return statements (Stefan Assmann) [1038788] - [netdrv] i40evf: Use pci_enable_msix_range() instead of pci_enable_msix() (Stefan Assmann) [1038788] - [netdrv] i40evf: control auto ITR through ethtool (Stefan Assmann) [1038788] - [netdrv] i40evf: set proper default for ITR registers (Stefan Assmann) [1038788] - [netdrv] i40evf: make ethtool_ops const (Stefan Assmann) [1038788] - [netdrv] i40evf: don't lie to ethtool (Stefan Assmann) [1038788] - [netdrv] i40evf: Use macro param for ethtool stats (Stefan Assmann) [1038788] - [netdrv] i40evf: Fix the headers and update copyright year (Stefan Assmann) [1038788] - [netdrv] i40evf: Remove unused defines (Stefan Assmann) [1038788] - [netdrv] i40evf: Update AdminQ interface (Stefan Assmann) [1038788] - [netdrv] i40evf: get rid of SET_ETHTOOL_OPS (Stefan Assmann) [1038788] - [netdrv] i40evf: enable CONFIG_I40EVF (Stefan Assmann) [1038788] - [netdrv] i40evf: fixes to get i40evf working with RHEL6.6 (Stefan Assmann) [1038788] - [netdrv] i40evf: initial commit (Stefan Assmann) [1038788] - [netdrv] i40e: relax the firmware API version check (Stefan Assmann) [1038787] - [netdrv] i40: disable FCoE for MFP modes (Stefan Assmann) [1038787] - [netdrv] i40e: add clear_pxe AdminQ request (Stefan Assmann) [1038787] - [netdrv] i40e: Clear recovery pending, if reset failed (Stefan Assmann) [1038787] - [netdrv] i40e: Change type to u32 to avoid sparse error (Stefan Assmann) [1038787] - [netdrv] i40e: remove storm control (Stefan Assmann) [1038787] - [netdrv] i40e: Use the new i40e_get_fd_cnt_all function in other places (Stefan Assmann) [1038787] - [netdrv] i40e: Report cmd->data in ETHTOOL_GRXCLSRLCNT instead of ETHTOOL_GRXCLSRULE (Stefan Assmann) [1038787] - [netdrv] i40e: Remove reserved PCTYPE defines (Stefan Assmann) [1038787] - [netdrv] i40e: Tx/Rx rings declaration (Stefan Assmann) [1038787] - [netdrv] i40e: enable descriptor prefetch for VFs (Stefan Assmann) [1038787] - [netdrv] i40e: Update check for AQ aliveness (Stefan Assmann) [1038787] - [netdrv] i40e: remove usless return statements (Stefan Assmann) [1038787] - [netdrv] i40e: fix passing wrong error code to i40e_open() (Stefan Assmann) [1038787] - [netdrv] i40e: Check PCI_IOV config to avoid compile error (Stefan Assmann) [1038787] - [netdrv] i40e: remove Tx work for ptp (Stefan Assmann) [1038787] - [netdrv] i40e: Don't disable SR-IOV when VFs are assigned (Stefan Assmann) [1038787] - [netdrv] i40e: remove hardcode of stats struct size in ethtool (Stefan Assmann) [1038787] - [netdrv] i40e: control auto ITR through ethtool (Stefan Assmann) [1038787] - [netdrv] i40e: set proper default for ITR registers (Stefan Assmann) [1038787] - [netdrv] i40e: add required include (Stefan Assmann) [1038787] - [netdrv] i40e: get rid of SET_ETHTOOL_OPS (Stefan Assmann) [1038787] - [netdrv] i40e: fix Timesync Tx interrupt handler code (Stefan Assmann) [1038787] - [netdrv] i40e: enable CONFIG_I40E (Stefan Assmann) [1038787] - [netdrv] i40e: fixes to get i40e working with RHEL6.6 (Stefan Assmann) [1038787] - [netdrv] i40e: initial commit (Stefan Assmann) [1038787] - [pci] pci_regs: Add PCI bus link speed and width defines (Stefan Assmann) [1038787] - [netdrv] veth: fix NULL dereference in veth_dellink() (Ivan Vecera) [1108641] - [netdrv] veth: fix a NULL deref in netif_carrier_off (Ivan Vecera) [1108641] - [netdrv] veth: avoid a NULL deref in veth_stats_one (Ivan Vecera) [1108641] - [scsi] lpfc: Update version for 10.2.8020.1 driver release (Rob Evers) [1109274] - [scsi] lpfc: Add iotag memory barrier (Rob Evers) [1109274] - [scsi] lpfc 10.2.8001.0: Fix ExpressLane priority setup (Rob Evers) [1109274] - [scsi] lpfc 10.2.8001.0: Fix for initializing RRQ bitmap (Rob Evers) [1109274] - [scsi] lpfc 10.2.8001.0: Fix for cleaning up stale ring flag and sp_queue_event entries (Rob Evers) [1109274]- [kernel] cred: Fix double free in prepare_usermodehelper_creds() error handling (Radomir Vrbovsky) [1087544] - [kernel] cred: Fix memory leak in error handling (Radomir Vrbovsky) [1087544] - [drm] i915: mst topology dumper in debugfs (Dave Airlie) [1074025] - [drm] i915: add DP 1.2 MST support (Dave Airlie) [1074025] - [drm] i915: check connector->encoder before using it (Dave Airlie) [1074025] - [drm] i915: split some DP modesetting code into a separate function (Dave Airlie) [1074025] - [drm] dp_helper: add Displayport multi-stream helper (Dave Airlie) [1074025] - [drm] add a path blob property (Dave Airlie) [1074025] - [drm] fb_helper: allow adding/removing connectors later (Dave Airlie) [1074025] - [drm] crtc: add interface to reinitialise the legacy mode group (Dave Airlie) [1074025] - [drm] fix memory leak around mode_group (Dave Airlie) [1074025] - [drm] i915: add some registers need for displayport MST support (Dave Airlie) [1074025] - [drm] add DP MST encoder type (Dave Airlie) [1074025] - [drm] dp_helper: add defines for DP 1.2 and MST support (Dave Airlie) [1074025] - [drm] i915: support address only i2c-over-aux transactions (Dave Airlie) [1074025] - [drm] i915: use the new drm helpers for dp i2c-over-aux (Dave Airlie) [1074025] - [drm] i915: move dp aux ch register init to aux init (Dave Airlie) [1074025] - [drm] i915: use the new drm helpers for dp aux (Dave Airlie) [1074025] - [drm] i915: move edp vdd enable/disable at a lower level in i2c-over-aux (Dave Airlie) [1074025] - [drm] i915: split edp_panel_vdd_on() for reuse (Dave Airlie) [1074025] - [drm] i915: fix order of dp aux i2c device cleanup (Dave Airlie) [1074025] - [drm] i915: add unregister callback to connector (Dave Airlie) [1074025] - [drm] i915: Enable 5.4Ghz HBR2 link rate for Displayport 1.2-capable devices (Dave Airlie) [1074025] - [drm] dp_helper: don't return EPROTO for defers (Dave Airlie) [1074025] - [drm] dp: Update comments about common i2c over dp assumptions (Dave Airlie) [1074025] - [drm] dp: let drivers specify the name of the I2C-over-AUX adapter (Dave Airlie) [1074025] - [drm] dp: Allow registering AUX channels as I2C busses (Dave Airlie) [1074025] - [drm] dp: Add DisplayPort link helpers (Dave Airlie) [1074025] - [drm] dp: Add drm_dp_dpcd_read_link_status() (Dave Airlie) [1074025] - [drm] dp: Add AUX channel infrastructure (Dave Airlie) [1074025] - [drm] dp_helper: Add DP test sink CRC definition (Dave Airlie) [1074025] - [drm] radeon: fix register typo on si (Rob Clark) [1082803] - [drm] i915: add locking to fixed panel edid probing (Rob Clark) [1082803] - [drm] upstream sync to v3.14.2 (Rob Clark) [1082803] - [drm] upstream sync to v3.13.11 (Rob Clark) [1082801] - [drm] upstream sync to v3.12.18 (Rob Clark) [1082794] - [drm] upstream sync to v3.11.10 (Rob Clark) [1082788] - [drm] upstream sync to v3.10.38 (Rob Clark) [1082786] - [netdrv] bna: Update the Driver Version to 3.2.23.0 (Ivan Vecera) [1054464] - [netdrv] bna: Firmware Patch Simplification (Ivan Vecera) [1054464] - [netdrv] bna: Embed SKB Length in TX Vector (Ivan Vecera) [1054464] - [netdrv] bna: Handle the TX Setup Failures (Ivan Vecera) [1054464] - [netdrv] bna: Add NULL Check Before Dereferencing TCB (Ivan Vecera) [1054464] - [netdrv] bna: CQ Read Fix (Ivan Vecera) [1054464] - [netdrv] bna: RX Processing and Config Changes (Ivan Vecera) [1054464] - [netdrv] bna: Enable Multi Buffer RX (Ivan Vecera) [1054464] - [netdrv] bna: RX Filter Enhancements (Ivan Vecera) [1054464] - [netdrv] bna: Fix Filter Add Del (Ivan Vecera) [1054464] - [netdrv] bna: Set Get IOC fw State (Ivan Vecera) [1054464] - [netdrv] bna: Add software timestamping support (Ivan Vecera) [1054464] - [kernel] tracing: Add BUG_ON when stack end location is over written (Aaron Tomlin) [1094831] - [netdrv] bonding: look for bridge IPs in arp monitoring (Veaceslav Falico) [704190] - [kernel] sched: free per cpu migration threads on suspend (Prarit Bhargava) [1020466] - [ata] ahci: AHCI-mode SATA patch for Intel Coleto Creek DeviceIDs (Prarit Bhargava) [1053911] - [ata] ata_piix: IDE-mode SATA patch for Intel Coleto Creek DeviceIDs (Prarit Bhargava) [1053911] - [i2c] i801: SMBus patch for Intel Coleto Creek DeviceIDs (Prarit Bhargava) [1053911] - [mfd] lpc_ich: iTCO_wdt patch for Intel Coleto Creek DeviceIDs (Prarit Bhargava) [1053911] - [firmware] efi-pstore: Make efi-pstore return a unique id (Tomoki Sekiyama) [1054513] - [firmware] efivars: Hold off deletion of sysfs entry until the scan is completed (Tomoki Sekiyama) [1054514] - [firmware] efi-pstore: Cocci spatch "memdup.spatch" (Tomoki Sekiyama) [1054514] - [firmware] efi-pstore: Read data from variable store before memcpy() (Tomoki Sekiyama) [1054514] - [firmware] efivars: efivar_entry API (Tomoki Sekiyama) [1054514] - [firmware] efivarfs: Return an error if we fail to read a variable (Tomoki Sekiyama) [1054513] - [acpi] acpica: Add a lock to the internal object reference count mechanism (Naoya Horiguchi) [1023242] - [acpi] acpica: Standardize integer output for ACPICA warnings/errors (Naoya Horiguchi) [1023242] - [acpi] acpica: Change package length error message to an info message (Naoya Horiguchi) [1023242] - [acpi] acpica: Use acpi_os_create_lock interface (Naoya Horiguchi) [1023242] - [acpi] osl: add acpi_os_create_lock interface (Naoya Horiguchi) [1023242] - [edac] mce_amd: Add MCE decoding support for Family 16h (Kim Naru) [989776] - [edac] mce_amd: Make MC2 decoding per-family (Kim Naru) [989776] - [edac] mce_amd: Dump error status (Kim Naru) [989776] - [edac] mce_amd: Report decoded error type first (Kim Naru) [989776] - [edac] mce_amd: Dump CPU f/m/s triple with the error (Kim Naru) [989776] - [edac] mce_amd: Remove functional unit references (Kim Naru) [989776] - [edac] Revert "Add error decoding support for AMD Fam16h processors" (Kim Naru) [989776] - [hv] hyperv-fb: kick off efifb early (Jason Wang) [1056676] - [hv] hyperv-fb: add support for generation 2 virtual machines (Jason Wang) [1056676] - [hv] vmbus: use resource for hyperv mmio region (Jason Wang) [1056676] - [hv] vmbus: add missing breaks (Jason Wang) [1056676] - [hv] vmbus: Extract the mmio information from DSDT (Jason Wang) [1056676] - [input] hyperv-keyboard - pass through 0xE1 prefix (Jason Wang) [1056676] - [input] add a driver to support Hyper-V synthetic keyboard (Jason Wang) [1056676] - [x86] Remove useless reinitialization of irq descriptors (Jason Wang) [1056676] - [x86] pic: Fix section mismatch in legacy pic (Jason Wang) [1056676] - [x86] pic: Probe for legacy PIC and set legacy_pic appropriately (Jason Wang) [1056676] - [x86] hyperv: Correctly guard the local APIC calibration code (Jason Wang) [1056676] - [x86] hyperv: Get the local APIC timer frequency from the hypervisor (Jason Wang) [1056676] - [x86] legacy_irq: Remove left over nr_legacy_irqs (Jason Wang) [1056676] - [x86] pic: Make use of legacy_pic abstraction (Jason Wang) [1056676] - [x86] pic: Introduce legacy_pic abstraction (Jason Wang) [1056676] - [x86] apic: Allow use of lapic timer early calibration result (Jason Wang) [1056676] - [edac] sb_edac: add support for Haswell based systems (Aristeu Rozanski) [1010484] - [edac] sb_edac: remove bogus assumption on mc ordering (Aristeu Rozanski) [1010484] - [edac] sb_edac: fix socket detection on Ivy Bridge controllers (Aristeu Rozanski) [1010484] - [edac] sb_edac: update Kconfig description (Aristeu Rozanski) [1010484] - [edac] sb_edac: search devices using product id (Aristeu Rozanski) [1010484] - [edac] sb_edac: make RIR limit retrieval per model (Aristeu Rozanski) [1010484] - [edac] sb_edac: make node id retrieval per model (Aristeu Rozanski) [1010484] - [edac] sb_edac: make memory type detection per memory controller (Aristeu Rozanski) [1010484] - [net] ip_tunnel: fix ip_tunnel_find to return NULL in case the tunnel is not there (Jiri Pirko) [1104503] - [net] ip6ip6: autoload ip6 tunnel (Hannes Frederic Sowa) [1104038] - [net] netlink: Use netlink_ns_capable to verify the permisions of netlink messages (Jiri Benc) [1094267] {CVE-2014-0181} - [net] netlink: Add variants of capable for use on netlink messages (Jiri Benc) [1094267] {CVE-2014-0181} - [net] Add file_ns_capable() helper function for open-time capability checking (Jiri Benc) [1094267] {CVE-2014-0181} - [net] security: remove the security_netlink_recv hook as it is equivalent to capable() (Jiri Benc) [1094267] {CVE-2014-0181} - [net] netlink: rename ssk to sk in struct netlink_skb_params (Jiri Benc) [1094267] {CVE-2014-0181} - [net] netlink: Make the sending netlink socket availabe in NETLINK_CB (Jiri Benc) [1094267] {CVE-2014-0181} - [net] netlink: kill loginuid/sessionid/sid members from struct netlink_skb_parms (Jiri Benc) [1094267] {CVE-2014-0181} - [net] netlink: kill eff_cap from struct netlink_skb_parms (Jiri Benc) [1094267] {CVE-2014-0181} - [net] netlink: Rename netlink_capable netlink_allowed (Jiri Benc) [1094267] {CVE-2014-0181} - [net] netlink: Fix permission check in netlink_connect() (Jiri Benc) [1094267] {CVE-2014-0181} - [net] netlink: fix possible spoofing from non-root processes (Jiri Benc) [1094267] {CVE-2014-0181} - [net] netlink: Make NETLINK_USERSOCK work again (Jiri Benc) [1094267] {CVE-2014-0181}- [netdrv] qlogic: Use time_before() (Chad Dupuis) [1054305] - [netdrv] net: get rid of SET_ETHTOOL_OPS (Chad Dupuis) [1054305] - [netdrv] qlcnic: Do not disable SR-IOV on PF unload when VFs are assigned to VMs (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.3.59 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Collect firmware dump using DMA on 82xx adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add mac learning support to SR-IOV VF (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add support to process commands in atomic context (Chad Dupuis) [1054305] - [netdrv] qlcnic: Allow SR-IOV VF probe in hypervisor (Chad Dupuis) [1054305] - [netdrv] qlcnic: Set real_num_tx_queues, real_num_rx_queues properly (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix panic while dumping TX queues on TX timeout (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.3.58 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Limit vNIC support in legacy interrupt mode (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add driver logs in error path (Chad Dupuis) [1054305] - [netdrv] qlcnic: Allow setting TX interrupt coalescing parameters from VF (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add hwmon-sysfs interface to export board temperature (Chad Dupuis) [1054305] - [netdrv] qlcnic: Optimize MAC learning code (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix memory leak (Chad Dupuis) [1054305] - [netdrv] qlcnic: Reset firmware API lock at driver load time (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix MSI-X initialization code (Chad Dupuis) [1054305] - [netdrv] qlcnic: Do not disable SR-IOV when VFs are assigned in guest OS (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix QLogic application/driver interface for virtual NIC configuration (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix PVID configuration on eSwitch port (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix max ring count calculation (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix to send INIT_NIC_FUNC as first mailbox (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix panic due to uninitialzed delayed_work struct in use (Chad Dupuis) [1054305] - [netdrv] qlcnic: include irq.h for irq definitions (Chad Dupuis) [1054305] - [netdrv] qlcnic: Remove casts of pointer to same type (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.3.57 (Chad Dupuis) [1054305] - [netdrv] qlcnic: fix a couple off-by-one bugs (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix number of rings when we fall back from msix to legacy (Chad Dupuis) [1054305] - [netdrv] qlcnic: Allow any VLAN to be configured from VF (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix function return error check (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.3.56 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enhance semaphore lock access failure error message (Chad Dupuis) [1054305] - [netdrv] qlcnic: Allow vlan0 traffic (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enhance driver message in failed state (Chad Dupuis) [1054305] - [netdrv] qlcnic: Updates to QLogic application/driver interface for virtual NIC configuration (Chad Dupuis) [1054305] - [netdrv] qlcnic: Re-factor firmware minidump template header handling (Chad Dupuis) [1054305] - [netdrv] qlcnic: Cleanup qlcnic_enable_msix() return values (Chad Dupuis) [1054305] - [netdrv] qlcnic: update version to 5.3.55 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix loopback test failure (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix tx timeout (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix initialization of vlan list (Chad Dupuis) [1054305] - [netdrv] qlcnic: Correct off-by-one errors in bounds checks (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enhance logic to calculate msix vectors (Chad Dupuis) [1054305] - [netdrv] qlcnic: Refactor interrupt coalescing code for all adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update poll controller code path (Chad Dupuis) [1054305] - [netdrv] qlcnic: Interrupt code cleanup (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enhance Tx timeout debugging (Chad Dupuis) [1054305] - [netdrv] qlcnic: Use bool for rx_mac_learn (Chad Dupuis) [1054305] - [netdrv] qlcnic: fix sparse warnings (Chad Dupuis) [1054305] - [netdrv] qlcnic: remove unused code (Chad Dupuis) [1054305] - [netdrv] qlcnic: make local functions static (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.3.54 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enable IPv6 LRO even if IP address is not programmed (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix SR-IOV cleanup code path (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enable beaconing for 83xx/84xx Series adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Do MAC learning for SRIOV PF (Chad Dupuis) [1054305] - [netdrv] qlcnic: Turn on promiscous mode for SRIOV PF (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enable VF flood bit on PF (Chad Dupuis) [1054305] - [netdrv] qlcnic: Restrict VF from configuring any VLAN mode (Chad Dupuis) [1054305] - [netdrv] qlcnic: Convert vmalloc/memset to kcalloc (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix ethtool statistics length calculation (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix bug in TX statistics (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix bug in Tx completion path (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix resource allocation for TX queues (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix loopback diagnostic test (Chad Dupuis) [1054305] - [netdrv] qlcnic: Mark functions as static in qlcnic_83xx_hw.c (Chad Dupuis) [1054305] - [netdrv] qlcnic: Mark functions as static in qlcnic_io.c (Chad Dupuis) [1054305] - [netdrv] qlcnic: update version to 5.3.53 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Support for 16 virtual NIC functions (Chad Dupuis) [1054305] - [netdrv] qlcnic: VLAN enhancement for 84XX adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Allow single Tx/Rx queue for all adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Refactor initialize nic code path (Chad Dupuis) [1054305] - [netdrv] qlcnic: Issue INIT_NIC command only once (Chad Dupuis) [1054305] - [netdrv] qlcnic: Disable DCB operations from SR-IOV VFs (Chad Dupuis) [1054305] - [netdrv] qlcnic: Dump mailbox registers when mailbox command times out (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix mailbox processing during diagnostic test (Chad Dupuis) [1054305] - [netdrv] qlcnic: Allow firmware dump collection when auto firmware recovery is disabled (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix memory allocation (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix TSS/RSS validation for 83xx/84xx series adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix TSS/RSS ring validation logic (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix diagnostic test for all adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix usage of netif_tx_wake, netif_tx_stop api during link change (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix typo in printk (Chad Dupuis) [1054305] - [netdrv] qlcnic: update version to 5.3.52 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enable multiple Tx queue support for 83xx/84xx Series adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: refactor Tx/SDS ring calculation and validation in driver (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enhance ethtool Statistics for Multiple Tx queue (Chad Dupuis) [1054305] - [netdrv] qlcnic: Register netdev in FAILED state for 83xx/84xx (Chad Dupuis) [1054305] - [netdrv] qlcnic: Do not read QLCNIC_FW_CAPABILITY_MORE_CAPS bit for 83xx adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Do not force adapter to perform LRO without destination IP check (Chad Dupuis) [1054305] - [netdrv] qlcnic: remove unnecessary pci_set_drvdata() (Chad Dupuis) [1054305] - [netdrv] qlcnic: Validate Tx queue only for 82xx adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: update version to 5.3.51 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Skip unknown entry type while collecting firmware dump (Chad Dupuis) [1054305] - [netdrv] qlcnic: dcb code cleanup and refactoring (Chad Dupuis) [1054305] - [netdrv] qlcnic: Remove redundant eSwitch enable commands (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update ethtool standard pause settings (Chad Dupuis) [1054305] - [netdrv] qlcnic: Firmware dump collection when auto recovery is disabled (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enhance ethtool to display ring indices and interrupt mask (Chad Dupuis) [1054305] - [netdrv] qlcnic: Print informational messages only once during driver load (Chad Dupuis) [1054305] - [netdrv] qlcnic: add missing destroy_workqueue() on error path in qlcnic_probe() (Chad Dupuis) [1054305] - [netdrv] qlcnic: Miscellaneous conversions to ETH_ALEN (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix SR-IOV configuration (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix register device in FAILED state for 82xx (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix VF reset recovery (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix warning reported by kbuild test robot (Chad Dupuis) [1054305] - [netdrv] qlcnic: use standard NAPI weights (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix sparse warning (Chad Dupuis) [1054305] - [netdrv] qlcnic: Convert uses of compare_ether_addr to ether_addr_equal (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.3.50 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add support for per port eswitch configuration (Chad Dupuis) [1054305] - [netdrv] qlcnic: Restructuring of qlc_83xx_fw_info structure (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add AER support for 83xx adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add AER callback handlers (Chad Dupuis) [1054305] - [netdrv] qlcnic: Store firmware dump state in CAMRAM register (Chad Dupuis) [1054305] - [netdrv] qlcnic: Use firmware recommended dump capture mask as default (Chad Dupuis) [1054305] - [netdrv] qlcnic: Remove inline keyword (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enhance PVID handling for 84xx adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Convert dma_alloc_coherent() to dma_zalloc_coherent (Chad Dupuis) [1054305] - [netdrv] qlcnic: underflow in qlcnic_validate_max_tx_rings() (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.3.49 (Chad Dupuis) [1054305] - [netdrv] qlcnic: dcb: Add support for CEE Netlink interface (Chad Dupuis) [1054305] - [netdrv] qlcnic: dcb: Register DCB AEN handler (Chad Dupuis) [1054305] - [netdrv] qlcnic: dcb: Get DCB parameters from the adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: dcb: Query adapter DCB capabilities (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.3.48 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enable diagnostic test for multiple Tx queues (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enable Tx queue changes using ethtool for 82xx Series adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Multi Tx queue support for 82xx Series adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.3.47 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add support for 84xx adapters to load firmware from file (Chad Dupuis) [1054305] - [netdrv] qlcnic: Loopback Inter Driver Communication AEN handler (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add PVID support for 84xx adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enable support for 844X adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.2.46 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Dump mailbox command data when a command times out (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix driver initialization for 83xx adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Flush mailbox command list when mailbox is not available (Chad Dupuis) [1054305] - [netdrv] qlcnic: Reinitialize mailbox data structures after firmware reset (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix diagnostic interrupt test for 83xx adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix beacon state return status handling (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix set driver version command (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.2.45 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enable mailbox interface in poll mode when interrupts are not available (Chad Dupuis) [1054305] - [netdrv] qlcnic: Replace poll mode mailbox interface with interrupt based mailbox interface (Chad Dupuis) [1054305] - [netdrv] qlcnic: Interrupt based driver firmware mailbox mechanism (Chad Dupuis) [1054305] - [netdrv] qlcnic: Enhance diagnostic loopback error codes (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix for flash update failure on 83xx adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix link speed and duplex display for 83xx adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix link speed display for 82xx adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix external loopback test (Chad Dupuis) [1054305] - [netdrv] qlcnic: Removed adapter series name from warning messages (Chad Dupuis) [1054305] - [netdrv] qlcnic: Free up memory in error path (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix ingress MAC learning (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix MAC address filter issue on 82xx adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix diagnostic interrupt test for 83xx adapters (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix setting Guest VLAN (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix operation type and command type (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix initialization of work function (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix guest VLAN (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix releasing of Tx frag which was never mapped (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix dump template version mask (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix ethtool display for 83xx adapter (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix panic while setting VF's MAC address (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix multicast packet handling for PF and VF (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix NULL pointer dereference in VF probe path (Chad Dupuis) [1054305] - [netdrv] qlcnic: Set __QLCNIC_DEV_UP in adapter state before enabling interrupts (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix invalid register offset calculation (Chad Dupuis) [1054305] - [netdrv] qlcnic: Update version to 5.2.44 (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add support for 83xx suspend and resume (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add support for 'set driver version' in 83XX (Chad Dupuis) [1054305] - [netdrv] qlcnic: Cleanup of structure qlcnic_hardware_context (Chad Dupuis) [1054305] - [netdrv] qlcnic: Add support for PEX DMA method to read memory section of adapter dump (Chad Dupuis) [1054305] - [netdrv] qlcnic: Secondary unicast MAC address support (Chad Dupuis) [1054305] - [netdrv] qlcnic: Minimize sleep duration within loopback diagnostic test (Chad Dupuis) [1054305] - [netdrv] qlcnic: Handle qlcnic_alloc_mbx_args() failure (Chad Dupuis) [1054305] - [netdrv] qlcnic: Do not sleep while holding spinlock (Chad Dupuis) [1054305] - [netdrv] qlcnic: replace strict_strtoul() with kstrtoul() (Chad Dupuis) [1054305] - [netdrv] qlcnic: remove redundant D0 power state set (Chad Dupuis) [1054305] - [netdrv] qlcnic: Fix typo in printk (Chad Dupuis) [1054305] - [netdrv] qlcnic: Check for assigned VFs and block remove if VFs are active (Bandan Das) [1016487] - [netdrv] qlcnic: Do not disable SR-IOV when VFs are assigned to VMs (Bandan Das) [1011773] - [netdrv] benet: convert to hw_features - fixup (Ivan Vecera) [1054277] - [netdrv] be2net: re-factor MCCQ error status handling code (Ivan Vecera) [1054277] - [netdrv] be2net: support flashing new regions on Skyhawk-R (Ivan Vecera) [1054277] - [netdrv] be2net: skip multicast promiscuos setting in already set (Ivan Vecera) [1054277] - [netdrv] be2net: enable interrupts in EEH resume (Ivan Vecera) [1054277] - [netdrv] be2net: use MCCQ instead of MBOX in be_cmd_rss_config() (Ivan Vecera) [1054277] - [netdrv] be2net: include rx-compl error counter in ethtool stats (Ivan Vecera) [1054277] - [netdrv] be2net: remove unused code in be_cmd_vlan_config() (Ivan Vecera) [1054277] - [netdrv] be2net: covert vlan array to bit-map (Ivan Vecera) [1054277] - [netdrv] be2net: fix line wrap and function call indentation in be_ethtool.c (Ivan Vecera) [1054277] - [netdrv] be2net: fix function call indentation in be_cmds.c (Ivan Vecera) [1054277] - [netdrv] be2net: fix line wrap and function call indentation in be_main.c (Ivan Vecera) [1054277] - [netdrv] be2net: Support for configurable RSS hash key (Ivan Vecera) [982896 1054277] - [netdrv] ethtool: Support for configurable RSS hash key (Ivan Vecera) [982896 1054277] - [netdrv] be2net: Fix invocation of be_close() after be_clear() (Ivan Vecera) [1054277] - [netdrv] be2net: Fix to reap TX compls till HW doesn't respond for some time (Ivan Vecera) [1054277] - [netdrv] be2net: Add abi version between be2net and ocrdma (Ivan Vecera) [1054277] - [netdrv] be2net: add FW cmds needed for VxLAN offloads (Ivan Vecera) [1054277] - [netdrv] be2net: Call dev_kfree_skby_any instead of kfree_skb (Ivan Vecera) [1054277] - [netdrv] be2net: update driver version to 10.2 (Ivan Vecera) [1054277] - [netdrv] be2net: Fix vlans_added counter (Ivan Vecera) [1054277] - [netdrv] be2net: Create multiple TXQs on RSS capable multi-channel BE3-R interfaces (Ivan Vecera) [1054277] - [netdrv] be2net: fix pmac_id allocation size (Ivan Vecera) [1054277] - [netdrv] be2net: log LPVID used in multi-channel configs (Ivan Vecera) [1054277] - [netdrv] be2net: Use GET_PROFILE_CONFIG cmd for BE3-R to query max-vfs (Ivan Vecera) [1054277] - [netdrv] be2net: do external loopback test only when it is requested (Ivan Vecera) [1054277] - [netdrv] be2net: dma_sync each RX frag before passing it to the stack (Ivan Vecera) [1054277] - [netdrv] be2net: use the dma state API instead of the pci equivalents (Ivan Vecera) [1054277] - [netdrv] be2net: isolate TX workarounds not applicable to Skyhawk-R (Ivan Vecera) [1054277] - [netdrv] be2net: Fix skb double free in be_xmit_wrokarounds() failure path (Ivan Vecera) [1054277] - [netdrv] be2net: clear promiscuous bits in adapter->flags while disabling promiscuous mode (Ivan Vecera) [1054277] - [netdrv] be2net: Fix to reset transparent vlan tagging (Ivan Vecera) [1054277] - [netdrv] be2net: Use pci_enable_msix_range() instead of pci_enable_msix() (Ivan Vecera) [1054277] - [netdrv] be2net: refactor multi-channel config code for Skyhawk-R chip (Ivan Vecera) [1054277] - [netdrv] be2net: fixup log messages (Ivan Vecera) [1054277] - [netdrv] be2net: Update copyright year (Ivan Vecera) [1054277] - [netdrv] be2net: Log a kernel message when UE is detected in BE & Skyhawk (Ivan Vecera) [1054277] - [netdrv] be2net: Fix be_vlan_add/rem_vid() routines (Ivan Vecera) [1054277] - [netdrv] be2net: add dma_mapping_error() check for dma_map_page() (Ivan Vecera) [1054277] - [netdrv] be2net: update driver version to 10.0.x (Ivan Vecera) [1054277] - [netdrv] be2net: cleanup wake-on-lan code (Ivan Vecera) [1054277] - [netdrv] be2net: use GET_MAC_LIST cmd to query mac-address from a pmac-id (Ivan Vecera) [1054277] - [netdrv] be2net: do not use frag index in the RX-compl entry (Ivan Vecera) [1054277] - [netdrv] be2net: Remove "10Gbps" from driver description string (Ivan Vecera) [1054277] - [netdrv] be2net: fix incorrect setting of cmd_privileges for VFs (Ivan Vecera) [1054277] - [netdrv] be2net: do not call be_set/get_fw_log_level() on Skyhawk-R (Ivan Vecera) [1054277] - [netdrv] be2net: Log the profile-id used by FW during driver initialization (Ivan Vecera) [1054277] - [netdrv] be2net: don't set "pport" field when querying "pvid" (Ivan Vecera) [1054277] - [netdrv] be2net: set and query VEB/VEPA mode of the PF interface (Ivan Vecera) [1054277] - [netdrv] be2net: Use MCC_CREATE_EXT_V1 cmd for Skyhawk-R (Ivan Vecera) [1054277] - [netdrv] be2net: fix max_evt_qs calculation for BE3 in SR-IOV config (Ivan Vecera) [1054277] - [netdrv] be2net: disable RSS when number of RXQs is reduced to 1 via set-channels (Ivan Vecera) [1054277] - [netdrv] be2net: slight optimization of addr compare (Ivan Vecera) [1054277] - [netdrv] be2net: calls skb_set_hash (Ivan Vecera) [1054277] - [netdrv] be2net: Free/delete pmacs in be_clear() only if they exist (Ivan Vecera) [1054277] - [netdrv] be2net: Fix Lancer error recovery to distinguish FW download (Ivan Vecera) [1054277] - [netdrv] be2net: call napi_disable() for all event queues (Ivan Vecera) [1054277] - [netdrv] be2net: Avoid programming permenant MAC by BE3-R VFs (Ivan Vecera) [1054277] - [netdrv] be2net: set coalesce-wm in CQ_CREATE_V2 cmd (Ivan Vecera) [1054277] - [netdrv] be2net: Disabling and enabling interrupts in suspend and resume (Ivan Vecera) [1054277] - [netdrv] be2net: Fix unconditional enabling of Rx interface options (Ivan Vecera) [1054277] - [netdrv] be2net: Make lancer_wait_ready() static (Ivan Vecera) [1054277] - [netdrv] be2net: Remove interface type (Ivan Vecera) [1054277] - [netdrv] be2net: add support for ndo_busy_poll (Ivan Vecera) [1054277] - [netdrv] be2net: remove unnecessary pci_set_drvdata() (Ivan Vecera) [1054277] - [netdrv] be2net: Rework PCIe error report log messaging (Ivan Vecera) [1054277] - [netdrv] be2net: change the driver version number to 4.9.224.0 (Ivan Vecera) [1054277] - [netdrv] be2net: Display RoCE specific counters in ethtool -S (Ivan Vecera) [1054277] - [netdrv] be2net: Call version 2 of GET_STATS ioctl for Skyhawk-R (Ivan Vecera) [1054277] - [netdrv] be2net: add a counter for pkts dropped in xmit path (Ivan Vecera) [1054277] - [netdrv] be2net: fix adaptive interrupt coalescing (Ivan Vecera) [1054277] - [netdrv] be2net: Call be_vf_setup() even when VFs are enbaled from previous load (Ivan Vecera) [1054277] - [netdrv] be2net: Fix to display the VLAN priority for a VF (Ivan Vecera) [1054277] - [netdrv] be2net: Fix to configure VLAN priority for a VF interface (Ivan Vecera) [1054277] - [netdrv] be2net: Fix to allow VLAN configuration on VF interfaces (Ivan Vecera) [1054277] - [netdrv] be2net: Fix number of VLANs supported in UMC mode for BE3-R (Ivan Vecera) [1054277] - [netdrv] be2net: Fix VLAN promiscuous mode programming (Ivan Vecera) [1054277] - [netdrv] be2net: Fix the size of be_nic_res_desc structure (Ivan Vecera) [1054277] - [netdrv] be2net: Remove extern from function prototypes (Ivan Vecera) [1054277] - [netdrv] be2net: missing variable initialization (Ivan Vecera) [1054277] - [netdrv] be2net: Convert dma_alloc_coherent() to dma_zalloc_coherent (Ivan Vecera) [1054277] - [netdrv] be2net: Check for POST state in suspend-resume sequence (Ivan Vecera) [1054277] - [netdrv] be2net: update driver version (Ivan Vecera) [1054277] - [netdrv] be2net: Initialize "status" in be_cmd_get_die_temperature() (Ivan Vecera) [1054277] - [netdrv] be2net: fixup log msgs for async events (Ivan Vecera) [1054277] - [netdrv] be2net: Fix displaying supported speeds for BE2 (Ivan Vecera) [1054277] - [netdrv] be2net: Do not call get_die_temperature cmd for VF (Ivan Vecera) [1054277] - [netdrv] be2net: Adding more speeds reported by get_settings (Ivan Vecera) [1054277] - [netdrv] be2net: Staticize local functions (Ivan Vecera) [1054277] - [netdrv] be2net: ignore mac-addr set call for an already programmed mac-addr (Ivan Vecera) [1054277] - [netdrv] be2net: Delete secondary unicast MAC addresses during be_close (Ivan Vecera) [1054277] - [netdrv] be2net: convert to hw_features - fixup (Ivan Vecera) [1054277] - [netdrv] be2net: convert to hw_features (Ivan Vecera) [1054277]- [netdrv] sfc: fix calling of free_irq with already free vector (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: stop PIO for RHEL6 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: get rid of SET_ETHTOOL_OPS (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: On MCDI timeout, issue an FLR and mark MCDI to fail-fast (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Call efx_set_channels() before efx->type->dimension_resources() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Don't receive packets when the napi budget == 0 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: check for NULL efx->ptp_data in efx_ptp_event (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Use pci_enable_msix_range() instead of pci_enable_msix() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add/remove blank lines to taste (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Fail self-test with -EBUSY, not -EIO, if the device is busy (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Cosmetic changes to self-test from the out-of-tree driver (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Update product naming (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Use canonical pointer type for MAC address in efx_set_mac_address() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Rename 'use_options' variable in tso_start() to clearer 'use_opt_desc' (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Preserve rx_frm_trunc counters when resizing DMA rings (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Correct comment about number of TX queues used on EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove unused definitions of EF10 user-mode DMA descriptors (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Rewrite adjustment of PPS event in a clearer way (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Cache skb->data in local variable in efx_ptp_rx() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Removed adhoc scheme to rate limit PTP event queue overflow message (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: fix build warning in ethernet/sfc/tx.c (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Use the correct maximum TX DMA ring size for SFC9100 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Fix transposed ptp_undersize_sync_windows, ptp_oversize_sync_windows statistics (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Change efx_mcdi_reset_port to use ENTITY_RESET MC command (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: fix sparse non static symbol warning (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: calls skb_set_hash (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Fix RX drop filters for EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add PTP counters to ethtool stats (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Changed the statistic name emerg_fetch and emerg_wait to hlb_fetch and hlb_wait (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: remove unused 'enum efx_rx_alloc_method' (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: remove unused 'refcnt' from efx_rx_page_state (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Implement efx_nic_type->filter_clear_rx() operation for EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Allow filter removal only with exactly matching priority (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Don't refer to 'stack' in filter implementation (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Change priority and flags for automatic MAC filters (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Change efx_nic_type->rx_push_indir_table() to push hash key as well (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add more information to many warnings using WARN() and netdev_WARN() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove unnecessary condition for processing the TX timestamp queue (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Don't clear timestamps in efx_ptp_rx() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Enable PTP clock and timestamping for all functions on EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Associate primary and secondary functions of controller (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Store VPD serial number at probe time (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add RX packet timestamping for EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Copy RX prefix into skb head area in efx_rx_mk_skb() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: split setup of hardware timestamping into NIC-type operation (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add support for SFC9100 timestamp format (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Tidy up PTP synchronization code (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: PTP - tidy up unused/useless variables (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove kernel-doc for efx_ptp_data fields not present in this version (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Initialise efx_ptp_data->phc_clock_info() from a static template (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Do not use MAC address as clock name (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Store flags from MC_CMD_DRV_ATTACH for later use (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove dependency of PTP on having a dedicated channel (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Split PTP multicast filter insertion/removal out of efx_ptp_start(), efx_ptp_stop() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Return EBUSY for filter insertion on EF10, matching Falcon/Siena (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Expose NVRAM_PARTITION_TYPE_LICENSE on EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Fold efx_flush_all() into efx_stop_port() and update comments (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Map MCDI error MC_CMD_ERR_ENOTSUP to Linux EOPNOTSUPP (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Log all unexpected MCDI errors (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add new sensor names (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Revise sensor names to be more understandable and consistent (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Report units in sensor warnings (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Correct RX dropped count for drops while interface is down (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Make initial fill of RX descriptors synchronous (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Tighten the check for RX merged completion events (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add MC BISTs to ethtool offline self test on EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Update MCDI protocol definitions (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Poll for MCDI completion once before timeout occurs (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Refactor efx_mcdi_poll() by introducing efx_mcdi_poll_once() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: RX buffer allocation takes prefix size into account in IP header alignment (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: remove unnecessary pci_set_drvdata() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Implement the SIOCGHWTSTAMP ioctl (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: replace dma_set_mask() and dma_set_coherent_mask() with new helper (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Fix DMA unmapping issue with firmware assisted TSO (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Only bind to EF10 functions with the LinkCtrl and Trusted flags (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add PM and RXDP drop counters to ethtool stats (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add definitions for new stats counters and capability flag (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Refactor EF10 stat mask code to allow for more conditional stats (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Fix internal indices of ethtool stats for EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add rmb() between reading stats and generation count to ensure consistency (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Increase MCDI status timeout to 250ms (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Wait for MC reboot to complete before scheduling driver reset (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove extern from function prototypes (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Support ARFS for IPv6 flows (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Use TX PIO for sufficiently small packets (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Introduce inline functions to simplify TX insertion (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Separate out queue-empty check from efx_nic_may_push_tx_desc() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Allocate and link PIO buffers; map them with write-combining (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Implement firmware-assisted TSO for EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Fold tso_get_head_fragment() into tso_start() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add EF10 registers to register dump (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: efx_ef10_filter_update_rx_scatter() can be static (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: efx_ethtool_get_ts_info() can be static (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Reinitialise and re-validate datapath caps after MC reboot (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Clean up validation of datapath capabilities (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Reset derived rx_bad_bytes statistic when EF10 MC is rebooted (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Disable PTP on EF10 until we're ready to handle inline RX timestamps (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Minimal support for 40G link speed (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: check for allocation failure (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Update copyright banners (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add support for Solarflare SFC9100 family (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Make efx_mcdi_init() and efx_mcdi_fini() call efx_mcdi_drv_attach() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Allocate NVRAM partition ID range for PHY images (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add EF10 register and structure definitions (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Extend struct efx_tx_buffer to allow pushing option descriptors (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Use a global count of active queues instead of pending drains (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Prepare for RX scatter on EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Initialise IRQ moderation for all NIC types from efx_init_eventq() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Allow efx_nic_type->dimension_resources() to fail (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Allow event queue initialisation to fail (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Document conditions for multicast replication vs filter replacement (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Implement asynchronous MCDI requests (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove unnecessary use of atomic_t (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Refactor efx_mcdi_rpc_start() and efx_mcdi_copyin() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add support for new board sensors (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Convert dma_alloc_coherent() to dma_zalloc_coherent (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Use extended MC_CMD_SENSOR_INFO and MC_CMD_READ_SENSORS (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Return an error code when a sensor is busy (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add support for reading packet length from prefix (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Generalise packet hash lookup to support EF10 RX prefix (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Rename EFX_PAGE_BLOCK_SIZE to EFX_VI_PAGE_SIZE and adjust comments (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove early call to efx_nic_type->reconfigure_mac() in efx_reset_up() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: use MCDI epoch flag to improve MC reboot detection in the driver (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add EF10 support for TX/RX DMA error events handling (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add a function pointer to abstract write of host time into NIC shared memory (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: PTP MCDI requests need to initialise periph ID field (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Delegate MAC/NIC statistic description to efx_nic_type (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove driver-local struct ethtool_string (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove more left-overs from Falcon GMAC support (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Move MTD operations into efx_nic_type (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Move NIC-type-specific MTD partition date into separate structures (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Eliminate struct efx_mtd (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Rename SPI stuff to show that it is Falcon-specific (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Cleanup Falcon-arch simple MAC filter state (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Define and use MCDI_POPULATE_DWORD_<1-7> (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add flag for stack-owned RX MAC filters (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Refactor Falcon-arch filter removal (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Make most filter operations NIC-type-specific (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Refactor Falcon-arch search limit reset (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Split Falcon-arch-specific and common filter state (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Extend and abstract efx_filter_spec to cover Huntington/EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Name the RX drop queue ID (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Rename Falcon-arch filter implementation types and functions (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove unused filter_flags variables and efx_farch_filter_id_flags() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Do not assume efx_nic_type->ev_fini() is idempotent (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: EFX_WORKAROUND_ALWAYS is really specific to Falcon-architecture (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Get rid of per-NIC-type phys_addr_channels and mem_map_size (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Update and improve kernel-doc for efx_mcdi_state & efx_mcdi_iface (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Fix race in completion handling (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add support for MCDI v2 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Update MCDI protocol definitions for EF10 (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Translate MCDI error numbers received in events (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Move and rename Falcon/Siena common NIC operations (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Refactor queue teardown sequence to allow for EF10 flush behaviour (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove bogus call to efx_release_tx_buffers() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Stop RX refill before flushing RX queues (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Limit scope of a Falcon A1 IRQ workaround (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Rework IRQ enable/disable (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Remove efx_process_channel_now() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Rename Falcon-architecture register definitions (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Make struct efx_special_buffer less special (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add GFP flags to efx_nic_alloc_buffer() and make most callers allow blocking (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Make MCDI independent of Siena (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Make efx_mcdi_init() call efx_mcdi_handle_assertion() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Collect all MCDI port functions into mcdi_port.c (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Move efx_mcdi_mac_reconfigure() to siena.c and rename (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Move siena_reset_hw() and siena_map_reset_reason() into MCDI module (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Add and use MCDI_SET_QWORD() and MCDI_SET_ARRAY_QWORD() (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Ensure MCDI buffers, but not lengths, are dword aligned (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Use proper macros to declare and access MCDI arrays (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Introduce and use MCDI_CTL_SDU_LEN_MAX_V1 macro for Siena-specific code (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Fill out the set of MCDI accessors (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Rationalise MCDI buffer accessors (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Introduce and use MCDI_DECLARE_BUF macro (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Move more Falcon-specific code and definitions into falcon.c (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Move details of a Falcon bug workaround out of ethtool.c (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Use efx_mcdi_mon() to find efx_mcdi_mon structure from efx_nic (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: const-qualify source pointers for MMIO write functions (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Correct MAC filter bitfield definitions (Nikolay Aleksandrov) [1057527] - [netdrv] sfc: Make all MAC statistics consistently 64 bits wide (Nikolay Aleksandrov) [1057527]- [x86] efi: Pass a proper identity mapping in efi_call_phys_prelog (Nigel Croxon) [1044709] - [usb] usbcore: check usb device's state before sending a Set SEL control transfer (Don Zickus) [929314] - [kernel] rename cpu stop machine thread to stopper (Prarit Bhargava) [1022465] - [thermal] intel_powerclamp: Fix cstate counter detection (Steve Best) [1103371] - [thermal] intel_powerclamp: Tidy up error handling in powerclamp_init (Steve Best) [1103371] - [thermal] intel_powerclamp: Add newer CPU models (Steve Best) [1103371] - [netdrv] hyperv: Move state setting for link query (Jason Wang) [1027155] - [netdrv] hyperv: Fix the carrier status setting (Jason Wang) [1027155] - [netdrv] hyperv: Fix race between probe and open calls (Jason Wang) [1027155] - [char] ipmi: Add MODULE_ALIAS for autoloading ipmi driver on ACPI systems (Charles Rose) [825196] - [char] ipmi: Improve error messages on failed irq enable (Charles Rose) [825196] - [char] ipmi: Turn off all activity on an idle ipmi interface (Tony Camuso) [1077493] - [char] ipmi: Fix a race restarting the timer (Tony Camuso) [1098324] - [char] ipmi: Reset the KCS timeout when starting error recovery (Tony Camuso) [1085350] - [scsi] bnx2fc: Updated version to 2.4.2 (Maurizio Lombardi) [1054586] - [scsi] bnx2fc: Fixed the handling for the SCSI retry delay (Maurizio Lombardi) [1054586] - [scsi] bnx2fc: Fixed scsi_remove_target soft lockup when rmmod bnx2x (Maurizio Lombardi) [1054586] - [net] cnic: Update version to 2.5.20 and copyright year (Maurizio Lombardi) [1054561] - [net] cnic: Use proper ulp_ops for per device operations (Maurizio Lombardi) [1054561] - [net] cnic: Add a signature to indicate valid doorbell offset (Maurizio Lombardi) [1054561] - [net] cnic: Remove extern from function prototypes (Maurizio Lombardi) [1054561] - [net] cnic: Update version to 2.5.18 (Maurizio Lombardi) [1054561] - [net] cnic: Eliminate local copy of pfid (Maurizio Lombardi) [1054561] - [net] cnic: Eliminate CNIC_PORT macro and port_mode in local struct (Maurizio Lombardi) [1054561] - [net] cnic: Redefine BNX2X_HW_CID using existing bnx2x macros (Maurizio Lombardi) [1054561] - [net] cnic: Update version to 2.5.17 and copyright year (Maurizio Lombardi) [1054561] - [net] cnic: Add missing error checking for RAMROD_CMD_ID_CLOSE (Maurizio Lombardi) [1054561] - [net] cnic: Update TCP options setup for iSCSI (Maurizio Lombardi) [1054581 1054561] - [net] cnic: Reset tcp_flags during cnic_cm_create() (Maurizio Lombardi) [1054561] - [scsi] cnic: Simplify cnic_release() (Maurizio Lombardi) [1054561] - [scsi] cnic: Simplify netdev events handling (Maurizio Lombardi) [1054561] - [scsi] cnic: bnx2i: bnx2fc: Fix inconsistent use of page size (Maurizio Lombardi) [1054561] - [scsi] be2iscsi: fix bad if expression (Rob Evers) [1054371] - [scsi] be2iscsi: fix memory leak in error path (Rob Evers) [1054371] - [scsi] be2iscsi: Jump to 'free_memory' is apparently missing (Rob Evers) [1054371] - [scsi] be2iscsi: Bump driver version (Rob Evers) [1054371] - [scsi] be2iscsi: Fix destroy MCC-CQ before MCC-EQ is destroyed (Rob Evers) [1054371] - [scsi] be2iscsi: Fix memory corruption in MBX path (Rob Evers) [1054371] - [scsi] be2iscsi: Fix TCP parameters while connection offloading (Rob Evers) [1054371] - [scsi] be2iscsi: Fix interrupt Coalescing mechanism (Rob Evers) [1054371] - [scsi] be2iscsi: Fix exposing Host in sysfs after adapter initialization is complete (Rob Evers) [1054371] - [scsi] be2iscsi: Fix retreving MCCQ_WRB in non-embedded Mbox path (Rob Evers) [1054371] - [scsi] be2iscsi: Fix DMA Out of SW-IOMMU space error (Rob Evers) [1054371] - [scsi] be2iscsi: Fix scsi_cmnd leakage in driver (Rob Evers) [1054371] - [scsi] be2iscsi: Fix the session cleanup when reboot/shutdown happens (Rob Evers) [1054371] - [scsi] be2iscsi: Fix doorbell format for EQ/CQ/RQ s per SLI spec (Rob Evers) [1054371] - [scsi] be2iscsi: Fix port speed typo in driver (Rob Evers) [1054371] - [scsi] be2iscsi: Fix handling timed out MBX completion from FW (Rob Evers) [1054371] - [scsi] be2iscsi: fix memory leak in error path (Rob Evers) [1054371] - [scsi] be2iscsi: Fix SGL posting for unaligned ICD values (Rob Evers) [1054371] - [scsi] be2iscsi: Fix AER handling in driver (Rob Evers) [1054371] - [scsi] be2iscsi: Invalidate WRB in Abort/Reset Path (Rob Evers) [1054371] - [scsi] be2iscsi: Fix Insufficient Buffer Error returned in MBX Completion (Rob Evers) [1054371] - [scsi] be2iscsi: Fix log level for protocol specific logs (Rob Evers) [1054371] - [scsi] be2iscsi: Fix MSIx creation for SKH-R adapter (Rob Evers) [1054371] - [scsi] be2iscsi: Display Port Identifier for each iSCSI function (Rob Evers) [1054371] - [scsi] be2iscsi: Dispaly CID available for connection offload (Rob Evers) [1054371] - [scsi] be2iscsi: Fix chute cleanup during drivers unload (Rob Evers) [1054371] - [scsi] be2iscsi: Fix connection offload to support Dual Chute (Rob Evers) [1054371] - [scsi] be2iscsi: Fix CID allocation/freeing to support Dual chute mode (Rob Evers) [1054371] - [scsi] be2iscsi: Fix WRB_Q posting to support Dual Chute mode (Rob Evers) [1054371] - [scsi] be2iscsi: Fix SGL Initilization and posting Pages for Dual Chute (Rob Evers) [1054371] - [scsi] be2iscsi: Fix Template HDR support for Dual Chute mode (Rob Evers) [1054371] - [scsi] be2iscsi: Fix changes in ASYNC Path for SKH-R adapter (Rob Evers) [1054371] - [scsi] be2iscsi: Config parameters update for Dual Chute Support (Rob Evers) [1054371] - [scsi] be2iscsi: Fix soft lock up issue during UE or if FW taking time to respond (Rob Evers) [1054371] - [scsi] be2iscsi: Fix locking mechanism in Unsol Path (Rob Evers) [1054371] - [scsi] be2iscsi: Fix negotiated parameters upload to FW (Rob Evers) [1054371] - [scsi] be2iscsi: Fix repeated issue of MAC ADDR get IOCTL (Rob Evers) [1054371] - [scsi] be2iscsi: Fix the MCCQ count leakage (Rob Evers) [1054371] - [scsi] be2iscsi: Fix Template HDR IOCTL (Rob Evers) [1054371] - [netdrv] bnx2x: dont reload on GRO change (Michal Schmidt) [1022020 1054563 1054273] - [netdrv] bnx2x: Allow ethtool to enable/disable loopback (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: allow GRO_ENABLE_FLAG (Michal Schmidt) [1022020 1054563 1054273] - [netdrv] bnx2x: fix incorrect busy-poll backport (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: fix backport of bnx2x_low_latency_recv() (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: remove cosmetic differences from upstream (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: drop no longer necessary netdev_printk workaround (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: update MAINTAINERS for bnx2x and e-mail addresses (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Convert return 0 to return rc (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: fix build when BNX2X_SRIOV is not enabled (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: added 'likely' to fast-path skb existence (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: fix crash while ethtool -t (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Support for byte queue limits (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Memory leak during VF removal (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: include irq.h for irqreturn_t definitions (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Don't allow VFs to become promiscuous (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Don't show port statistics for VFs (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix failure to configure VF multicast filters (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix vlan credit issues for VFs (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix possible memory leak on iov error flow (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Remove the sriov VFOP mechanism (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix compilation when CONFIG_BNX2X_SRIOV is not set (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Create workqueue for IOV related tasks (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Support mng. request for driver version (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Don't receive packets when the napi budget == 0 (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Add missing bit in default Tx switching (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: save RAM in kdump kernel by disabling TPA (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: save RAM in kdump kernel by using a single queue (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: clamp num_queues to prevent passing a negative value (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Remove hidden flow control goto from BNX2X_ALLOC macros (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Use pci_enable_msix_range() instead of pci_enable_msix() (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: utilize FW 7.8.19 (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: semantic revise scheduling of sp_rtnl (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix bnx2x_panic_dump for VFs (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Revise IOV vlan/mac validation (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Add support in PF driver for RSC (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Semantic Validate vlan/mac changes (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Remove unnecessary internal mem config (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Remove unused iov code (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: change verbosity of some prints (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Allow VF rss on higher PFs (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Make module parameters readable (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: fix L2-GRE TCP issues (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix generic option settings (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: More Shutdown revisions (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix VF flr flow (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Don't release PCI bars on shutdown (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: fix sparse warning (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Correct default Tx switching behaviour (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: fix DMA unmapping of TSO split BDs (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: prevent WARN during driver unload (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: namespace and dead code cleanups (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: fix VLAN configuration for VFs (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: fix AFEX memory overflow (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Clean before update RSS arrives (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Correct number of MSI-X vectors for VFs (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: limit number of interrupt vectors for 57711 (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix KR2 work-around detection of BCM8073 (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix incorrect link-up report (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix Duplex setting for 54618se (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix passive DAC cable detection (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix 578xx-KR 1G link (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: downgrade "valid ME register value" message level (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: slight optimization of addr compare (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix build with SRIOV disabled (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: add VF Multicast filters support (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Add num of VFs to Management statistics (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: no error when RSS configuration fails (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: add Big-Endian ethtool comment (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Add AER support (missing bits) (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: cleanup skb_set_hash (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: calls skb_set_hash (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: populate skb->l4_rxhash (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: avoid null pointer dereference when enabling SR-IOV (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Prevent "timeout waiting for state X" (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: prevent CFC attention (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Prevent panic during DMAE timeout (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Clean the sp rtnl task upon unload (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: replace dma_set_mask() and dma_set_coherent_mask() with new helper (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: remove unnecessary pci_set_drvdata() (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Add ndo_get_phys_port_id support (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Change variable type to bool (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: skb_is_gso_v6() requires skb_is_gso() (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Add support for EXTPHY2 LED mode (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Change function prototype (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Don't disable/enable SR-IOV when loading (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Correct VF driver info (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Test nvram when interface is down (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Staticize local symbols (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Disable VF access on PF removal (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: prevent FW assert on low mem during unload (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Set NETIF_F_HIGHDMA unconditionally (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Don't pretend during register dump (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Prevent null pointer dereference on error flow (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix config when SR-IOV and iSCSI are enabled (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix Coalescing configuration (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Unlock VF-PF channel on MAC/VLAN config error (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Prevent an illegal pointer dereference during panic (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: record rx queue for LRO packets (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: prevent masked MCP parities from appearing (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: prevent masking error from cnic (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: add missing VF resource allocation during init (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix support for VFs on some PFs (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Prevent mistaken hangup between driver & FW (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix 848xx duplex settings (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: 57840 non-external loopback test fail on 1G (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix bnx2i and bnx2fc regressions (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Use pci_dev pm_cap (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Fix configuration of doorbell block (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Restore a call to config_init (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Add missing braces in bnx2x_link_initialize() (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: fix broken compilation with CONFIG_BNX2X_SRIOV is not set (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: VF RSS support - VF side (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: VF RSS support - PF side (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Convert dma_alloc_coherent() to dma_zalloc_coherent (Michal Schmidt) [1054563 1054273] - [netdrv] bnx2x: Revising locking scheme for MAC configuration (Michal Schmidt) [1054563 1054273] - [netdrv] firmware: add bnx2x FW 7.8.19 (Michal Schmidt) [1054563 1054273] - [net] export physical port id via sysfs (Michal Schmidt) [1098227] - [net] rtnl: export physical port id via RT netlink (Michal Schmidt) [1098227] - [net] add ndo to get id of physical port of the device (Michal Schmidt) [1098227] - [lib] vsprintf: add support of '*ph' (Michal Schmidt) [1098227]- [video] vgacon: clear buffer attributes when we load a 512 character font (Rob Clark) [1082803] - [fs] consolidate the reassignments of ->f_op in ->open() instances (Rob Clark) [1082799] - [video] fbdev: add a MIPI DSI header (Rob Clark) [1082799] - [kernel] kref: Implement kref_get_unless_zero (Rob Clark) [1082791] - [kernel] time: export ktime_get_monotonic_offset (Rob Clark) [1082787] - [kernel] sysfs: Add sysfs_add/remove_files utility functions (Rob Clark) [1082787] - [kernel] Add arch_phys_wc_add, arch_phys_wc_del to manipulate WC MTRRs if needed (Rob Clark) [1082787] - [kernel] mutex: Move ww_mutex definitions to ww_mutex.h (Rob Clark) [1082787] - [base] reservation: cross-device reservation support (Rob Clark) [1082787] - [kernel] locking-selftests: Handle unexpected failures more strictly (Rob Clark) [1082787] - [kernel] mutex: Add more w/w tests to test EDEADLK path handling (Rob Clark) [1082787] - [kernel] mutex: Add more tests to lib/locking-selftest.c (Rob Clark) [1082787] - [kernel] mutex: Add w/w tests to lib/locking-selftest.c (Rob Clark) [1082787] - [kernel] mutex: Add w/w mutex slowpath debugging (Rob Clark) [1082787] - [kernel] mutex: Add support for wound/wait style locks (Rob Clark) [1082787] - [kernel] arch: Make __mutex_fastpath_lock_retval return whether fastpath succeeded or not (Rob Clark) [1082787] - [fs] procfs: add proc_remove_subtree() (Rob Clark) [1082782] - [lib] scatterlist: sg_page_iter support sg lists w/o backing pages (Rob Clark) [1082782] - [lib] scatterlist: use page iterator in the mapping iterator (Rob Clark) [1082782] - [lib] scatterlist: add simple page iterator (Rob Clark) [1082782] - [lib] scatterlist: add sg_alloc_table_from_pages function (Rob Clark) [1082782] - [netdrv] qlge: Update version to 1.00.00.34 (Chad Dupuis) [1054333] - [netdrv] qlge: Fix ethtool statistics (Chad Dupuis) [1054333] - [netdrv] qlge: Update version to 1.00.00.33 (Chad Dupuis) [1054333] - [netdrv] qlge: Enhance nested VLAN Q-in-Q handling (Chad Dupuis) [1054333] - [netdrv] qlge: call ql_core_dump() only if dump memory was allocated (Chad Dupuis) [1054333] - [netdrv] qlge: add missing free_netdev() on error in qlge_probe() (Chad Dupuis) [1054333] - [netdrv] qlge: fix dma map leak when the last chunk is not allocated (Chad Dupuis) [1054333] - [netdrv] bnx2x: Fix kernel crash and data miscompare after EEH recovery (Michal Schmidt) [1029600] - [netdrv] bnx2x: Adapter not recovery from EEH error injection (Michal Schmidt) [1029600] - [netdrv] tg3: Override clock, link aware and link idle mode during NVRAM dump (Ivan Vecera) [1054558] - [netdrv] tg3: Update copyright and version to 3.137 (Ivan Vecera) [1054558] - [netdrv] tg3: Prevent page allocation failure during TSO workaround (Ivan Vecera) [1029192 1054558] - [netdrv] tg3: Don't modify ip header fields when doing GSO (Ivan Vecera) [1029192 1054558] - [netdrv] tg3: remove open-coded skb_cow_head (Ivan Vecera) [1054558] - [netdrv] tg3: remove empty MDIO bus reset function (Ivan Vecera) [1054558] - [netdrv] tg3: Do not include vlan acceleration features in vlan_features (Ivan Vecera) [1054558] - [netdrv] tg3: Call dev_kfree_skby_any instead of dev_kfree_skb (Ivan Vecera) [1054558] - [netdrv] tg3: Don't check undefined error bits in RXBD (Ivan Vecera) [1054558] - [netdrv] tg3: Use pci_enable_msix_range() instead of pci_enable_msix() (Ivan Vecera) [1054558] - [netdrv] tg3: Fix deadlock in tg3_change_mtu() (Ivan Vecera) [1054558] - [netdrv] tg3: cleanup an error path in tg3_phy_reset_5703_4_5() (Ivan Vecera) [1054558] - [netdrv] tg3: delete non-required instances of include linux/init.h (Ivan Vecera) [1054558] - [netdrv] tg3: Update version to 3.136 (Ivan Vecera) [1054558] - [netdrv] tg3: Set the MAC clock to the fastest speed during boot code load (Ivan Vecera) [1054558] - [netdrv] tg3: Add unicast filtering support (Ivan Vecera) [1054558] - [netdrv] tg3: Refactor __tg3_set_mac_addr() (Ivan Vecera) [1054558] - [netdrv] tg3: Initialize REG_BASE_ADDR at PCI config offset 120 to 0 (Ivan Vecera) [1054558] - [netdrv] tg3: Update version to 3.135 (Ivan Vecera) [1054558] - [netdrv] tg3: Expand multicast drop counter miscounting fix to 5762 (Ivan Vecera) [1054558] - [netdrv] tg3: Fix bit definition for the nvram Auto Power Down setting (Ivan Vecera) [1054558] - [netdrv] tg3: Add flag to disable 1G Half Duplex advertisement (Ivan Vecera) [1054558] - [netdrv] tg3: Don't add rxbds_empty to rx_over_errors (Ivan Vecera) [1054558] - [netdrv] tg3: Give up chip reset and carrier loss handling if PCI device is not present (Ivan Vecera) [1054558] - [netdrv] tg3: Implement the SIOCGHWTSTAMP ioctl (Ivan Vecera) [1054558] - [netdrv] tg3: Validate hwtstamp_config completely before applying it (Ivan Vecera) [1054558] - [netdrv] tg3: remove unnecessary pci_set_drvdata() (Ivan Vecera) [1054558] - [netdrv] tg3: Miscellaneous conversions to ETH_ALEN (Ivan Vecera) [1054558] - [netdrv] tg3: use phylib when robo switch is in use (Ivan Vecera) [1054558] - [netdrv] tg3: add support a phy at an address different than 01 (Ivan Vecera) [1054558] - [netdrv] tg3: Update version to 3.134 (Ivan Vecera) [1054558] - [netdrv] tg3: Remove unnecessary spinlock (Ivan Vecera) [1054558] - [netdrv] tg3: Appropriately classify interrupts during request_irq (Ivan Vecera) [1054558] - [netdrv] tg3: Remove redundant if check (Ivan Vecera) [1054558] - [netdrv] tg3: Remove if 0'd code (Ivan Vecera) [1054558] - [netdrv] tg3: LED in shared mode does not blink during traffic (Ivan Vecera) [1054558] - [netdrv] tg3: Add support for new 577xx device ids (Ivan Vecera) [1054558] - [netdrv] tg3: Add function tg3_phy_shdw_write() (Ivan Vecera) [1054558] - [netdrv] tg3: Use pci_dev pm_cap (Ivan Vecera) [1054558] - [netdrv] tg3: Convert dma_alloc_coherent() to dma_zalloc_coherent (Ivan Vecera) [1054558] - [netdrv] tg3: fix NULL pointer dereference in tg3_io_error_detected and tg3_io_slot_reset (Ivan Vecera) [1054558] - [netdrv] tg3: Update version to 3.133 (Ivan Vecera) [1054558] - [netdrv] tg3: Enable support for timesync gpio output (Ivan Vecera) [1054558] - [netdrv] tg3: Implement the shutdown handler (Ivan Vecera) [1054558] - [netdrv] tg3: Allow NVRAM programming when interface is down (Ivan Vecera) [1054558] - [netdrv] tg3: Fix warning from pci_disable_device() (Ivan Vecera) [1054558] - [netdrv] tg3: Fix kernel crash (Ivan Vecera) [1054558] - [netdrv] tg3: Avoid delay during MMIO access (Ivan Vecera) [1054558] - [netdrv] tg3: restore rx_dropped accounting (Ivan Vecera) [1054558] - [netdrv] tg3: Consilidate MAC loopback code (Ivan Vecera) [1054558] - [netdrv] tg3: Allow ethtool to enable/disable loopback (Ivan Vecera) [1054558] - [net] Allow ethtool to set interface in loopback mode (Ivan Vecera) [1054558] - [netdrv] tg3: convert to hw_features (Ivan Vecera) [1054558] - [netdrv] tg3: Do not use legacy PCI power management (Ivan Vecera) [1054558] - [netdrv] tg3: Remove TG3_VLAN_TAG_USED macro (Ivan Vecera) [1054558] - [netdrv] ixgbe: fix ethtool stats (Ivan Vecera) [1098515] - [netdrv] Replace u64_stats_fetch_begin_bh to u64_stats_fetch_begin_irq (Ivan Vecera) [1098515] - [netdrv] vxlan: virtual extensible lan (Ivan Vecera) [1098515] - [netdrv] ifb: convert to 64 bit stats (Ivan Vecera) [1098515] - [netdrv] ppp: make ppp_get_stats64 static (Ivan Vecera) [1098515] - [netdrv] ppp: add 64 bit stats (Ivan Vecera) [1098515] - [netdrv] slip: Use net_device_stats from struct net_device (Ivan Vecera) [1098515] - [netdrv] slip: fix get_stats() method (Ivan Vecera) [1098515] - [netdrv] veth: reduce stat overhead (Ivan Vecera) [1098515] - [netdrv] veth: fix 64bit stats on 32bit arches (Ivan Vecera) [1098515] - [netdrv] veth: convert to 64 bit statistics (Ivan Vecera) [1098515] - [netdrv] net: fix race condition in several drivers when reading stats (Ivan Vecera) [1098515] - [netdrv] virtio-net: fix a race on 32bit arches (Ivan Vecera) [1098515] - [netdrv] virtio-net: Fix panic in virtnet_remove (Ivan Vecera) [1098515] - [netdrv] virtio-net: per cpu 64 bit stats (Ivan Vecera) [1098515] - [netdrv] vmxnet3: convert to 64 bit stats interface (Ivan Vecera) [1098515] - [netdrv] xen: convert to 64 bit stats interface (Ivan Vecera) [1098515] - [netdrv] via-rhine: add 64bit statistics (Ivan Vecera) [1098515] - [netdrv] niu: support 64 bit stats interface (Ivan Vecera) [1098515] - [netdrv] r8169: add 64bit statistics (Ivan Vecera) [1098515] - [netdrv] 8139too: Add 64bit statistics (Ivan Vecera) [1098515] - [netdrv] netxen: convert to 64 bit statistics (Ivan Vecera) [1098515] - [netdrv] forcedeth: account for dropped RX frames (Ivan Vecera) [1098515] - [netdrv] forcedeth: implement ndo_get_stats64() API (Ivan Vecera) [1098515] - [netdrv] forcedeth: fix stats on hardware without extended stats support (Ivan Vecera) [1098515] - [netdrv] forcedeth: Improve stats counters (Ivan Vecera) [1098515] - [netdrv] forcedeth: remove unneeded stats updates (Ivan Vecera) [1098515] - [netdrv] vxge: fix 64 bit access on 32 bit platforms (Ivan Vecera) [1098515] - [netdrv] vxge: Implement 64bit stats (Ivan Vecera) [1098515] - [netdrv] myricom: update to 64 bit stats (Ivan Vecera) [1098515] - [netdrv] sky2: implement 64 bit stats (Ivan Vecera) [1098515] - [netdrv] ixgbevf: provide 64 bit statistics (Ivan Vecera) [1098515] - [netdrv] ixgbe: fix stats handling (Ivan Vecera) [1098515] - [netdrv] igb: fix stats handling (Ivan Vecera) [1098515] - [netdrv] e1000e: convert to stats64 (Ivan Vecera) [1098515] - [netdrv] be2net: use stats-sync to read/write 64-bit stats (Ivan Vecera) [1098515] - [netdrv] enic: update to support 64 bit stats (Ivan Vecera) [1098515] - [netdrv] cxgb4: switch to 64 bit inteface statistics (Ivan Vecera) [1098515] - [netdrv] bna: fix stats handling (Ivan Vecera) [1098515] - [netdrv] tg3: 64 bit stats on all arches (Ivan Vecera) [1098515] - [netdrv] bnx2: 64 bit stats on all arches (Ivan Vecera) [1098515] - [netdrv] b44: add 64 bit stats (Ivan Vecera) [1098515] - [netdrv] dummy: percpu stats and lockless xmit (Ivan Vecera) [1098515] - [netdrv] sfc: Implement 64-bit net device statistics on all architectures (Ivan Vecera) [1098515] - [net] bridge: 64bit rx/tx counters (Ivan Vecera) [1098515] - [net] bridge: per-cpu packet statistics (Ivan Vecera) [1098515] - [net] vlan: lockless transmit path (Ivan Vecera) [1098515] - [net] congestion notifications are not dropped packets (Ivan Vecera) [1098515] - [net] vlan: 64 bit rx counters (Ivan Vecera) [1098515] - [netdrv] macvlan: 64 bit rx counters (Ivan Vecera) [1098515] - [netdrv] loopback driver cleanup (Ivan Vecera) [1098515] - [netdrv] loopback: use u64_stats_sync infrastructure (Ivan Vecera) [1098515] - [netdrv] loopback: Implement 64bit stats on 32bit arches (Ivan Vecera) [1098515] - [net] export netdev_stats_to_stats64 (Ivan Vecera) [1098515] - [netdrv] Enable 64-bit net device statistics on 32-bit architectures (Ivan Vecera) [1098515] - [netdrv] bonding: Remove net_device_stats from bonding struct (Ivan Vecera) [1098515] - [fs] sysfs: don't panic when in different netns (Daniel Borkmann) [1034696 1020145] - [fs] cifs: Check if prefixpath starts with '\' in cifs_parse_mount_options (Sachin Prabhu) [1104268] - [fs] gfs2: Ensure workqueue is scheduled after noexp request (Robert S Peterson) [1101740] - [fs] ext3: Allow quota file use root reservation (Lukas Czerner) [1102234] - [fs] ext4: Allow quota file use root reservation (Lukas Czerner) [802214] - [fs] pipe: skip file_update_time on frozen fs (Eric Sandeen) [1093077] - [fs] ext4: fix ext4_flush_completed_IO wait semantics (Lukas Czerner) [1023141] - [fs] ext4: completed_io locking cleanup (Lukas Czerner) [1023141] - [fs] ext4: fix unwritten counter leakage (Lukas Czerner) [1023141] - [fs] ext4: give i_aiodio_unwritten a more appropriate name (Lukas Czerner) [1023141] - [fs] ext4: ext4_inode_info diet (Lukas Czerner) [1023141] - [fs] ext4: optimize locking for end_io extent conversion (Lukas Czerner) [1023141] - [fs] ext4: remove unnecessary call to waitqueue_active() (Lukas Czerner) [1023141] - [fs] ext4: Use correct locking for ext4_end_io_nolock() (Lukas Czerner) [1023141] - [fs] ext4: don't check io->flag when setting EXT4_STATE_DIO_UNWRITTEN inode state (Lukas Czerner) [1023141] - [md] dm-crypt: fix cpu hotplug crash by removing per-cpu structure (Mike Snitzer) [1076147] - [md] dm-crypt: rename struct convert_context sector field (Mike Snitzer) [1076147] - [md] dm-crypt: store crypt_config instead of dm_target struct (Mike Snitzer) [1076147] - [md] dm-crypt: move cipher data out of per_cpu struct (Mike Snitzer) [1076147] - [md] dm-crypt: rename pending field (Mike Snitzer) [1076147] - [md] dm-crypt: replace simple_strtoul (Mike Snitzer) [1076147] - [md] dm: reject trailing characters in sccanf input (Mike Snitzer) [1076147] - [md] dm-crypt: add missing error handling (Mike Snitzer) [1076147] - [md] dm-crypt: suppress endian warnings (Mike Snitzer) [1076147] - [md] dm-crypt: add loop aes iv generator (Mike Snitzer) [1076147] - [crypto] md5: Add export support (Mike Snitzer) [1076147] - [md] dm-crypt: add multi key capability (Mike Snitzer) [1076147] - [md] dm-crypt: add post iv call to iv generator (Mike Snitzer) [1076147] - [md] dm-crypt: use io thread for reads only if mempool exhausted (Mike Snitzer) [1076147] - [md] dm-crypt: scale to multiple cpus (Mike Snitzer) [1076147] - [md] dm-crypt: simplify compatible table output (Mike Snitzer) [1076147] - [md] dm-thin: add 'no_space_timeout' dm-thin-pool module param (Mike Snitzer) [1098656] - [md] dm-thin: add timeout to stop out-of-data-space mode holding IO forever (Mike Snitzer) [1098656] - [md] dm-thin: allow metadata commit if pool is in PM_OUT_OF_DATA_SPACE mode (Mike Snitzer) [1098655] - [md] dm-cache: always split discards on cache block boundaries (Mike Snitzer) [1103790] - [md] dm-cache: fix writethrough mode quiescing in cache_map (Mike Snitzer) [1103790] - [x86] efi: earlyprintk=efi,keep fix (Rui Wang) [1031867] - [x86] efi: earlyprintk off-by-one bugfix (Rui Wang) [1031867] - [x86] efi: Add EFI framebuffer earlyprintk support (Rui Wang) [1031867] - [powerpc] mm: fix ".__node_distance" undefined (David Milburn) [1091088 1020866] - [nvme] Retry failed commands with non-fatal errors (David Milburn) [1091088 1020866] - [nvme] Fix divide-by-zero in nvme_trans_io_get_num_cmds (David Milburn) [1091088 1020866] - [nvme] Add getgeo to block ops (David Milburn) [1091088 1020866] - [nvme] Start-stop nvme_thread during device add-remove (David Milburn) [1091088 1020866] - [nvme] Make I/O timeout a module parameter (David Milburn) [1091088 1020866] - [nvme] per-cpu io queues (David Milburn) [1091088 1020866] - [nvme] Replace DEFINE_PCI_DEVICE_TABLE (David Milburn) [1091088 1020866] - [nvme] IOCTL path RCU protect queue access (David Milburn) [1091088 1020866] - [nvme] RCU protected access to io queues (David Milburn) [1091088 1020866] - [nvme] Initialize device reference count earlier (David Milburn) [1091088 1020866] - [nvme] Add CONFIG_PM_SLEEP to suspend/resume functions (David Milburn) [1091088 1020866]- [kernel] futex: Always cleanup owner tid in unlock_pi (Jerome Marchand) [1104517] {CVE-2014-3153} - [kernel] futex: Make lookup_pi_state more robust (Jerome Marchand) [1104517] {CVE-2014-3153} - [kernel] futex: Validate atomic acquisition in futex_lock_pi_atomic() (Jerome Marchand) [1104517] {CVE-2014-3153} - [kernel] futex: prevent requeue pi on same futex (Jerome Marchand) [1104517] {CVE-2014-3153} - [alsa] aloop: Close races at restarting the stream (Jaroslav Kysela) [1078592] - [alsa] aloop: Export snd_pcm_constraint_mask64() (Jaroslav Kysela) [1078592] - [alsa] pcm: Warn when buffer preallocation fails (Jaroslav Kysela) [1078592] - [alsa] aloop: Add SNDRV_PCM_STATE_PAUSED case in wait_for_avail function (Jaroslav Kysela) [1078592] - [alsa] jack: Unregister input device at disconnection (Jaroslav Kysela) [1078592] - [alsa] aloop: Optimize module name check (Jaroslav Kysela) [1078592] - [alsa] pcm: Add fallthru comments (Jaroslav Kysela) [1078592] - [alsa] aloop: Fix Oops while PM resume (Jaroslav Kysela) [1078592] - [alsa] aloop: add locking to timer access (Jaroslav Kysela) [1078592] - [mmc] Fix sd/sdio/mmc initialization frequency retries (Neil Horman) [1103848] - [mmc] fix mmc_set_bus_width_ddr() call without bus-width-test cap (Neil Horman) [1103848] - [mmc] Test bus-width for old MMC devices (Neil Horman) [1103848] - [mmc] Fix printing of card DDR type (Neil Horman) [1103848] - [mmc] propagate power save/restore ops return value (Neil Horman) [1103848] - [mmc] refine DDR support (Neil Horman) [1103848] - [mmc] Fixes for Dual Data Rate support (Neil Horman) [1103848] - [mmc] MMC 4.4 DDR support (Neil Horman) [1103848] - [mmc] Make ID freq configurable (Neil Horman) [1103848] - [mmc] Add helper function to check if a card is removable (Neil Horman) [1103848] - [mmc] add erase, secure erase, trim and secure trim operations (Neil Horman) [1103848] - [mmc] only set blockaddressed for > 2GiB cards (Neil Horman) [1103848] - [mmc] recognize CSD structure (Neil Horman) [1103848] - [mmc] fix incorrect interpretation of card type bits (Neil Horman) [1103848] - [mmc] allow for MMC v4.4 (Neil Horman) [1103848] - [mmc] fix all hangs related to mmc/sd card insert/removal during suspend/resume (Neil Horman) [1103848] - [mmc] sdio: recognize io card without powercycle (Neil Horman) [1103848] - [mmc] sdio: introduce API for special power management features (Neil Horman) [1103848] - [mmc] add module parameter to set whether cards are assumed removable (Neil Horman) [1103848] - [usb] xhci: add the meaningful IRQ description if it is empty (Don Zickus) [1103370] - [usb] xhci: Kill streams URBs when the host dies (Don Zickus) [1103370] - [usb] xhci: Refactor command watchdog and fix split string (Don Zickus) [1103370] - [usb] xhci: Handle MaxPSASize == 0 (Don Zickus) [1103370] - [usb] xhci: The trb_address_map radix tree expects 1KB segment memory aligment (Don Zickus) [1103370] - [usb] xhci: xhci_mem_cleanup make sure cmd_ring_reserved_trbs really is 0 (Don Zickus) [1103370] - [usb] xhci: Remove segments from radix tree on failed insert (Don Zickus) [1103370] - [lib] radix-tree: make radix_tree_node_alloc() work correctly within interrupt (Don Zickus) [1103370] - [pci] Move Renesas PCI IDs to a better place (Don Zickus) [1103370] - [usb] xhci: For streams the dequeue ptr must be read from the stream ctx (Don Zickus) [1103370] - [usb] xhci: Set SCT field for Set TR dequeue on streams (Don Zickus) [1103370] - [usb] xhci: For streams the css flag most be read from the stream-ctx on ep stop (Don Zickus) [1103370] - [usb] xhci: Check size rather then number of streams when allocating stream ctxs (Don Zickus) [1103370] - [usb] xhci: Free streams when they are still allocated on a set_interface call (Don Zickus) [1103370] - [usb] xhci: fix usb3 streams (Don Zickus) [1103370] - [usb] xhci: make warnings greppable (Don Zickus) [1103370] - [usb] xhci: Change how we indicate a host supports Link PM (Don Zickus) [1103370] - [usb] xhci: Fix resume issues on Renesas chips in Samsung laptops (Don Zickus) [1103370] - [usb] xhci: Remove unused variable 'addr' in inc_deq() and inc_enq() (Don Zickus) [1103370] - [usb] xhci: Add quirks module option (Don Zickus) [1103370] - [usb] xhci: clarify logging in xhci_setup_device (Don Zickus) [1103370] - [usb] xhci: Limit the spurious wakeup fix only to HP machines (Don Zickus) [1103370] - [usb] xhci: replace xhci_writel() with writel() (Don Zickus) [1103370] - [usb] xhci: replace xhci_readl() with readl() (Don Zickus) [1103370] - [usb] xhci: remove conversion from generic to pci device in xhci_mem.c (Don Zickus) [1103370] - [usb] xhci: fix incorrect type in assignment in xhci_count_num_dropped_endpoints() (Don Zickus) [1103370] - [usb] xhci: fix incorrect type in assignment in xhci_count_num_new_endpoints() (Don Zickus) [1103370] - [usb] xhci: remove unnecessary check in xhci_free_stream_info() (Don Zickus) [1103370] - [usb] xhci: fix SCT_FOR_CTX(p) macro (Don Zickus) [1103370] - [usb] xhci: replace USB_MAXINTERFACES with config->desc.bNumInterface (Don Zickus) [1103370] - [usb] xhci: fix incorrect type in assignment in xhci_address_device() (Don Zickus) [1103370] - [usb] xhci: fix sparse warning in xhci-trace.h (Don Zickus) [1103370] - [usb] xhci: fix derivation of TRB's DMA address in xhci_log_event Trace Event Class (Don Zickus) [1103370] - [usb] xhci: fix incorrect type in assignment in handle_device_notification() (Don Zickus) [1103370] - [usb] xhci: convert TRB_CYCLE to le32 before using it to set Link TRB's cycle bit (Don Zickus) [1103370] - [usb] xhci: remove the unused ->address field (Don Zickus) [1103370] - [usb] xhci: kill a conditional when toggling cycle (Don Zickus) [1103370] - [usb] xhci: replace 'event' with 'cmd_comp_code' in set_deq and reset_ep handlers (Don Zickus) [1103370] - [usb] xhci: add argument 'slot_id' in stop_ep, set_deq and reset_ep cmd handlers (Don Zickus) [1103370] - [usb] xhci: replace 'xhci->cmd_ring->dequeue' with 'trb' in stop_ep cmd handler (Don Zickus) [1103370] - [usb] xhci: add variable 'cmd_type' in handle_cmd_completion() (Don Zickus) [1103370] - [usb] xhci: add variable 'cmd_trb' in handle_cmd_completion() (Don Zickus) [1103370] - [usb] xhci: add variable 'cmd_comp_code' in handle_cmd_completion() (Don Zickus) [1103370] - [usb] xhci: refactor TRB_CONFIG_EP case into function (Don Zickus) [1103370] - [usb] xhci: remove unused 'ep_ring' variable in handle_cmd_completion() (Don Zickus) [1103370] - [usb] xhci: refactor TRB_EVAL_CONTEXT case into function (Don Zickus) [1103370] - [usb] xhci: refactor TRB_NEC_GET_FW case into function (Don Zickus) [1103370] - [usb] xhci: refactor TRB_RESET_DEV case into function (Don Zickus) [1103370] - [usb] xhci: use completion event's slot id rather than dig it out of command (Don Zickus) [1103370] - [usb] xhci: refactor TRB_ADDR_DEV case into function (Don Zickus) [1103370] - [usb] xhci: refactor TRB_DISABLE_SLOT case into function (Don Zickus) [1103370] - [usb] xhci: refactor TRB_ENABLE_SLOT case into function (Don Zickus) [1103370] - [usb] xhci: rename existing Command Completion Event handlers (Don Zickus) [1103370] - [usb] xhci: remove unused argument from xhci_giveback_urb_in_irq() (Don Zickus) [1103370] - [usb] xhci: correct the usage of USB_CTRL_SET_TIMEOUT (Don Zickus) [1103370] - [usb] xhci: Staticize xhci_del_comp_mod_timer (Don Zickus) [1103370] - [usb] xhci: Set L1 device slot on USB2 LPM enable/disable (Don Zickus) [1103370] - [usb] xhci: Fix spurious wakeups after S5 on Haswell (Don Zickus) [1103370] - [usb] xhci: fix write to USB3_PSSEN and XUSB2PRM pci config registers (Don Zickus) [1103370] - [usb] xhci: quirk for extra long delay for S4 (Don Zickus) [1103370] - [usb] xhci: Don't enable/disable RWE on bus suspend/resume (Don Zickus) [1103370] - [usb] xhci: Fix race between ep halt and URB cancellation (Don Zickus) [1103370] - [usb] Fix xHCI host issues on remote wakeup (Don Zickus) [1103370] - [usb] xhci: Ensure a command structure points to the correct trb on the command ring (Don Zickus) [1103370] - [usb] xhci: Fix oops happening after address device timeout (Don Zickus) [1103370] - [usb] xhci: fix port BESL LPM capability checking (Don Zickus) [1103370] - [usb] xhci: fix dma mask setup in xhci.c (Don Zickus) [1103370] - [usb] xhci: trace debug statements related to ring expansion (Don Zickus) [1103370] - [usb] xhci: trace debug messages related to driver initialization and unload (Don Zickus) [1103370] - [usb] xhci: trace debug statements for urb cancellation (Don Zickus) [1103370] - [usb] xhci: add xhci_cmd_completion trace event (Don Zickus) [1103370] - [usb] xhci: add xhci_address_ctx trace event (Don Zickus) [1103370] - [usb] xhci: add trace for debug messages related to endpoint reset (Don Zickus) [1103370] - [usb] xhci: add trace for debug messages related to quirks (Don Zickus) [1103370] - [usb] xhci: add trace for debug messages related to changing contexts (Don Zickus) [1103370] - [usb] xhci: add traces for debug messages in xhci_address_device() (Don Zickus) [1103370] - [usb] xhci: remove CONFIG_USB_XHCI_HCD_DEBUGGING and unused code (Don Zickus) [1103370] - [usb] xhci: replace printk(KERN_DEBUG ...) (Don Zickus) [1103370] - [usb] xhci: replace xhci_info() with xhci_dbg() (Don Zickus) [1103370] - [usb] usb: Add Device Tree support to XHCI Platform driver (Don Zickus) [1103370] - [usb] xhci: add missing dma-mapping.h includes (Don Zickus) [1103370] - [usb] xhci: fix null pointer dereference on ring_doorbell_for_active_rings (Don Zickus) [1103370] - [usb] xhci: Enable XHCI_SPURIOUS_SUCCESS for all controllers with xhci 1.0 (Don Zickus) [1103370] - [usb] xhci: Mark two functions __maybe_unused (Don Zickus) [1103370] - [usb] xhci: Avoid NULL pointer deref when host dies (Don Zickus) [1103370] - [usb] xhci: Correct misplaced newlines (Don Zickus) [1103370] - [usb] xhci: Report USB 2.1 link status for L1 (Don Zickus) [1103370] - [usb] xhci: Refactor port status into a new function (Don Zickus) [1103370] - [usb] xhci: add the suspend/resume functionality (Don Zickus) [1103370] - [usb] xhci: Add missing unlocks on error paths (Don Zickus) [1103370] - [usb] xhci-plat: release mem region while removing module (Don Zickus) [1103370] - [usb] xhci: check for failed dma pool allocation (Don Zickus) [1103370] - [usb] xhci: remove BUG() in xhci_get_endpoint_type() (Don Zickus) [1103370] - [usb] xhci: Remove BUG in xhci_setup_addressable_virt_dev (Don Zickus) [1103370] - [usb] xhci: Remove BUG_ON in xhci_get_input_control_ctx (Don Zickus) [1103370] - [usb] xhci: Remove BUG_ON() in xhci_alloc_container_ctx (Don Zickus) [1103370] - [usb] xhci: add USB2 Link power management BESL support (Don Zickus) [1103370] - [usb] xhci: define port register names and use them instead of magic numbers (Don Zickus) [1103370] - [usb] xhci: check usb2 port capabilities before adding hw link PM support (Don Zickus) [1103370] - [usb] xhci-dbg: Display endpoint number and direction in context dump (Don Zickus) [1103370]- [documentation] sysctl: fix the VM knobs descritpion WRT pdflush (Jerome Marchand) [1024086] - [char] ipmi: implement shadow struct for ipmi_smi_handlers (Tony Camuso) [1063878] - [s390] af_iucv: wrong mapping of sent and confirmed skbs (Hendrik Brueckner) [1102248] - [s390] af_iucv: recvmsg problem for SOCK_STREAM sockets (Hendrik Brueckner) [1102248] - [s390] af_iucv: fix recvmsg by replacing skb_pull() function (Hendrik Brueckner) [1102248] - [scsi] qla2xxx: Update version number to 8.07.00.08.06.6-k (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove wait for online from host reset handler (Chad Dupuis) [1054299] - [scsi] qla2xxx: Do logins from a chip reset in DPC thread instead of the error handler thread (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove mapped vp index iterator macro dead code (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add MBC option for fast SFP data access (Chad Dupuis) [1054299] - [scsi] qla2xxx: Fix beacon blink logic for ISP26xx/83xx (Chad Dupuis) [1054299] - [scsi] qla2xxx: Don't check for firmware hung during the reset context for ISP82XX (Chad Dupuis) [1054299] - [scsi] qla2xxx: Delay driver unload if there is any pending activity going on (Chad Dupuis) [1054299] - [scsi] qla2xxx: Clear loop_id for ports that are marked lost during fabric scanning (Chad Dupuis) [1054299] - [scsi] qla2xxx: Adjust adapter reset routine to the changes in firmware specification for ISPFx00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: IOCB data should be copied to I/O mem using memcpy_toio (Chad Dupuis) [1054299] - [scsi] qla2xxx: Use proper log message for flash lock failed error (Chad Dupuis) [1054299] - [scsi] qla2xxx: Decrease pci access for response queue processing for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Change copyright year to 2014 in all the source files (Chad Dupuis) [1054299] - [scsi] qla2xxx: Introduce fw_dump_flag to track fw dump progress (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove unnecessary delays from fw dump code path (Chad Dupuis) [1054299] - [scsi] qla2xxx: Track the process when the ROM_LOCK failure happens (Chad Dupuis) [1054299] - [scsi] qla2xxx: Issue abort command for outstanding commands during cleanup when only firmware is alive (Chad Dupuis) [1054299] - [scsi] qla2xxx: Do not schedule reset when one is already active when receiving an invalid status handle (Chad Dupuis) [1054299] - [scsi] qla2xxx: Wait for reset completion without lock for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Re-sync module parameter descriptions with the code (Chad Dupuis) [1054299] - [scsi] qla2xxx: fix error handling of qla2x00_mem_alloc() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add IOCB Abort command asynchronous handling (Chad Dupuis) [1054299] - [scsi] qla2xxx: Fix Task Management command asynchronous handling (Chad Dupuis) [1054299] - [scsi] qla2xxx: Read capture firmware dump on mailbox timeout for ISP8044 and ISP82XX (Chad Dupuis) [1054299] - [scsi] qla2xxx: Simplify the ISPFX00 interrupt handler code for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Avoid poisoning in the response queue for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove Marker type IOCB logic for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Properly handle 32 bit mailbox register for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Enable the Flash Access Control (FAC) mailbox command (Chad Dupuis) [1054299] - [scsi] qla2xxx: Select correct request queue for error type IOCB for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove init control block related dead code for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Replace constant value for IOCTL IOCB abort execution status with a macro for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add handling for boot indication progress AENs for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add mutex around optrom calls to serialize accesses (Chad Dupuis) [1054299] - [scsi] qla2xxx: Poll during initialization for ISP25xx and ISP83xx (Chad Dupuis) [1054299] - [scsi] qla2xxx: Replace a constant with a macro definition for host->canqueue assigmnment (Chad Dupuis) [1054299] - [scsi] qla2xxx: Only complete dcbx_comp and lb_portup_comp for virtual port index 0 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Use scnprintf() instead of snprintf() in the sysfs handlers (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add changes to obtain ISPFX00 adapters product information in accordance with firmware update (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add logic to abort BSG commands for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Clear RISC INT reg only for an event and not always while polling (Chad Dupuis) [1054299] - [scsi] qla2xxx: Fix undefined behavior in call to snprintf() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add BSG interface for read/write serdes register (Chad Dupuis) [1054299] - [scsi] qla2xxx: Fix issue with not displaying node name after system reboot (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add BPM support for ISP25xx (Chad Dupuis) [1054299] - [scsi] qla2xxx: Correctly set mailboxes for extended init control block (Chad Dupuis) [1054299] - [scsi] qla2xxx: Disable INTx interrupt for ISP82XX (Chad Dupuis) [1054299] - [scsi] qla2xxx: Honor execute firmware failures (Chad Dupuis) [1054299] - [scsi] qla2xxx: Print proper QLAFX00 product name at probe (Chad Dupuis) [1054299] - [scsi] qla2xxx: Use standard PCIe Capability Link register field names (Chad Dupuis) [1054299] - [scsi] qla2xxx: Use pcie_is_pcie() to simplify code (Chad Dupuis) [1054299] - [scsi] qla2xxx: print MAC via pMR (Chad Dupuis) [1054299] - [scsi] qla2xxx: Correctly print out/in mailbox registers (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add a new interface to update versions (Chad Dupuis) [1054299] - [scsi] qla2xxx: Select link initialization option bits from current operating mode (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add loopback IDC-TIME-EXTEND aen handling support (Chad Dupuis) [1054299] - [scsi] qla2xxx: Set default critical temperature value in cases when ISPFX00 firmware doesn't provide it (Chad Dupuis) [1054299] - [scsi] qla2xxx: QLAFX00 make over temperature AEN handling informational, add log for normal temperature AEN (Chad Dupuis) [1054299] - [scsi] qla2xxx: Correct Interrupt Register offset for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove handling of Shutdown Requested AEN from qlafx00_process_aen() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Send all AENs for ISPFx00 to above layers (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add changes in initialization for ISPFX00 cards with BIOS (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add changes to support extended IOs for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add missing FCP statistics to sysfs interface (Chad Dupuis) [1054299] - [scsi] qla2xxx: Make log message that prints when a completion status requires a port down more readable (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add critical temperature handling for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Notify ISPFX00 firmware when driver is unloaded or system is shut down (Chad Dupuis) [1054299] - [scsi] qla2xxx: Reconfigure thermal temperature (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add setting of driver version string for vendor application (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove QL_DEBUG_LEVEL_17 defines from qla_nx.c (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add ISPFX00 specific bus reset routine (Chad Dupuis) [1054299] - [scsi] qla2xxx: Perform warm reset every 2 minutes if firmware load fails for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Set factory reset recovery timeout to 10 min. for ISPFX00 (Chad Dupuis) [1054299] - [scsi] qla2xxx: Correct multiqueue offset calculations (Chad Dupuis) [1054299] - [scsi] qla2xxx: Fix incorrect test after list_for_each_entry() exits (Chad Dupuis) [1054299] - [scsi] qla2xxx: Print some variables to hexadecimal string via *phN format (Chad Dupuis) [1054299] - [scsi] qla2xxx: Fix sparse warnings in qlafx00_fxdisc_iocb function (Chad Dupuis) [1054299] - [scsi] qla2xxx: Properly set the tagging for commands (Chad Dupuis) [1054299] - [scsi] qla2xxx: Fix a memory leak in an error path of qla2x00_process_els() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove an unused variable from qla2x00_remove_one() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Fix qla2xxx_check_risc_status() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Help Coverity with analyzing ct_sns_pkt initialization (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove redundant assignments (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove a dead assignment in qla24xx_build_scsi_crc_2_iocbs() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove two superfluous tests (Chad Dupuis) [1054299] - [scsi] qla2xxx: Remove dead code in qla2x00_configure_hba() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Clean up qla84xx_mgmt_cmd() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Clean up qla24xx_iidma() (Chad Dupuis) [1054299] - [scsi] qla2xxx: Fix sparse warning from qla_mr.c and qla_iocb.c (Chad Dupuis) [1054299] - [scsi] qla2xxx: Do not take a second firmware dump when intentionally generating one (Chad Dupuis) [1054299] - [scsi] qla2xxx: Do not query FC statistics during chip reset (Chad Dupuis) [1054299] - [scsi] qla2xxx: Move qla2x00_free_device to the correct location (Chad Dupuis) [1054299] - [scsi] qla2xxx: Set the index in outstanding command array to NULL when cmd is aborted when the request timeout (Chad Dupuis) [1054299] - [scsi] qla2xxx: Update firmware link in Kconfig file (Chad Dupuis) [1054299] - [scsi] qla2xxx: qla2x00_sp_compl can be static (Chad Dupuis) [1054299] - [scsi] qla2xxx: fix sparse warning "large integer implicitly truncated to unsigned type" (Chad Dupuis) [1054299] - [scsi] qla2xxx: Add IS_P3P_TYPE macro (Chad Dupuis) [1054299] - [scsi] qla2xxx: Reduce the time we wait for a command to complete during SCSI error handling (Chad Dupuis) [1054299] - [scsi] qla2xxx: Avoid escalating the SCSI error handler if the command is not found in firmware (Chad Dupuis) [1054299] - [scsi] qla2xxx: Set host can_queue value based on available resources (Chad Dupuis) [1054299] - [x86] Fix stack frame warning in check_irq_vectors_for_cpu_disable() (Prarit Bhargava) [1023834] - [x86] Add check for number of available vectors before CPU down (Prarit Bhargava) [1023834] - [x86] Skip migrating IRQF_PER_CPU irqs in fixup_irqs() (Prarit Bhargava) [1023834] - [net] filter: prevent nla extensions to peek beyond the end of the message (Jiri Benc) [1096779] {CVE-2014-3144 CVE-2014-3145} - [net] increase frag hash size (Jesper Brouer) [859249] - [net] frag queue per hash bucket locking (Jesper Brouer) [859249] - [net] inet: frag: make sure forced eviction removes all frags (Jesper Brouer) [859249] - [net] fix possible deadlock in sum_frag_mem_limit (Jesper Brouer) [859249] - [net] use lib/percpu_counter API for fragmentation mem accounting (Jesper Brouer) [859249] - [net] cacheline adjust struct netns_frags for better frag performance (Jesper Brouer) [859249] - [net] frag, avoid several CPUs grabbing same frag queue during LRU evictor loop (Jesper Brouer) [859249] - [net] fix for a race condition in the inet frag code (Jesper Brouer) [859249] - [net] frag, fix race conditions in LRU list maintenance (Jesper Brouer) [859249] - [net] use the frag lru_lock to protect netns_frags.nqueues update (Jesper Brouer) [859249] - [net] kABI workaround for netns_frags LRU list lock (Jesper Brouer) [859249] - [net] frag, move LRU list maintenance outside of rwlock (Jesper Brouer) [859249] - [net] frag helper functions for mem limit tracking (Jesper Brouer) [859249] - [net] ipv6: make ip6_frag_nqueues() and ip6_frag_mem() static inline (Jesper Brouer) [859249] - [net] cacheline adjust struct inet_frag_queue (Jesper Brouer) [859249] - [net] cacheline adjust struct inet_frags for better frag performance (Jesper Brouer) [859249] - [net] ip_frag: struct inet_frags match() method returns a bool (Jesper Brouer) [859249] - [net] ipv6: unify fragment thresh handling code (Jesper Brouer) [859249] - [net] increase fragment memory usage limits (Jesper Brouer) [859249] - [net] ipv6: reassembly: replace calculated magic number with multiplication (Jesper Brouer) [859249] - [net] ipv6: reassembly: replace magic number with macro definitions (Jesper Brouer) [859249] - [net] nf_conntrack_reasm: add fast path for in-order fragments (Jesper Brouer) [859249] - [net] fragment: add fast path for in-order fragments (Jesper Brouer) [859249] - [net] ip_frag: frag_kfree_skb() cleanup (Jesper Brouer) [859249] - [net] ip_frag: Remove some atomic ops (Jesper Brouer) [859249] - [powerpc] Wire up new syscall clock_adjtime (Jiri Benc) [1099152] - [block] xen-blkfront: make blkif_io_lock spinlock per-device (Vitaly Kuznetsov) [1102879] - [x86] mce: Fix CMCI preemption bugs (Rui Wang) [916094] - [x86] cmci: Add proper detection of end of CMCI storms (Rui Wang) [916094] - [x86] mce: Fix mce_start_timer semantics (Rui Wang) [916094] - [x86] mce: Add CMCI poll mode (Rui Wang) [916094] - [x86] mce: Remove the frozen cases in the hotplug code (Rui Wang) [916094] - [x86] mce: Split timer init (Rui Wang) [916094] - [x86] mce: Add the dropped timer interval init back (Rui Wang) [916094] - [x86] mce: Fix the MCE poll timer logic (Rui Wang) [916094] - [x86] mce: Cleanup timer mess (Rui Wang) [916094] - [powercap] Add to drivers Kconfig and Makefile (Steve Best) [1036309] - [powercap] Documentation (Steve Best) [1036309] - [powercap] Fix build error with option -Werror=format-security (Steve Best) [1036309] - [powercap] Introduce Intel RAPL power capping driver (Steve Best) [1036309] - [powercap] Add class driver (Steve Best) [1036309] - [kernel] device: add RW and RO attribute macros (Steve Best) [1036309] - [kernel] sysfs: add __ATTR_RW() macro (Steve Best) [1036309] - [kernel] bitops: Introduce BIT_ULL (Steve Best) [1036309] - [input] wacom: create inputs when wireless connect (Aristeu Rozanski) [1004617] - [input] wacom: wireless monitor framework (Aristeu Rozanski) [1004617] - [input] wacom: LED is only supported through digitizer interface (Aristeu Rozanski) [1004617] - [input] wacom: isolate input registration (Aristeu Rozanski) [1004617] - [input] wacom: add support for three new Intuos Pro devices (Aristeu Rozanski) [1004617] - [input] wacom: use per-device instance of wacom_features (Aristeu Rozanski) [1004617] - [input] wacom: clean up wacom_query_tablet_data (Aristeu Rozanski) [1004617] - [input] synaptics: add min/max quirk for the ThinkPad W540 (Benjamin Tissoires) [1042514] - [input] synaptics: add min/max quirk for ThinkPad Edge E431 (Benjamin Tissoires) [1042514] - [input] synaptics: add min/max quirk for ThinkPad T431s, L440, L540, S1 Yoga and X1 (Benjamin Tissoires) [1042514] - [input] synaptics: report INPUT_PROP_TOPBUTTONPAD property (Benjamin Tissoires) [1042514] - [input] Add INPUT_PROP_TOPBUTTONPAD device property (Benjamin Tissoires) [1042514] - [input] i8042: add firmware_id support (Benjamin Tissoires) [1042514] - [input] serio: add firmware_id sysfs attribute (Benjamin Tissoires) [1042514] - [input] synaptics: add manual min/max quirk for ThinkPad X240 (Benjamin Tissoires) [1042514] - [input] synaptics: add manual min/max quirk (Benjamin Tissoires) [1042514] - [input] synaptics: initialize pointer emulation usage (Benjamin Tissoires) [1042514] - [input] synaptics: add image sensor support (Benjamin Tissoires) [1042514] - [input] synaptics: refactor initialization of abs position axes (Benjamin Tissoires) [1042514] - [input] synaptics: refactor agm packet parsing (Benjamin Tissoires) [1042514] - [input] synaptics: refactor y inversion (Benjamin Tissoires) [1042514] - [input] synaptics: fix reporting of min coordinates (Benjamin Tissoires) [1042514] - [input] synaptics: set minimum coordinates as reported by firmware (Benjamin Tissoires) [1042514] - [input] synaptics: process button bits in AGM packets (Benjamin Tissoires) [1042514] - [input] synaptics: rename set_slot to be more descriptive (Benjamin Tissoires) [1042514] - [input] synaptics: fuzz position for touchpad with reduced filtering (Benjamin Tissoires) [1042514] - [input] synaptics: set resolution for MT_POSITION_X/Y axes (Benjamin Tissoires) [1042514] - [input] synaptics: report clickpad property (Benjamin Tissoires) [1042514] - [input] synaptics: fix incorrect placement of __initconst (Benjamin Tissoires) [1042514] - [input] psmouse: do not carry DMI data around (Benjamin Tissoires) [1042514] - [dmi] add support for exact DMI matches in addition to substring matching (Rob Clark) [1042514] - [netdrv] igb: remove usless return statements (Stefan Assmann) [1038782] - [netdrv] igb: remove return statements for void functions (Stefan Assmann) [1038782] - [netdrv] igb: get rid of SET_ETHTOOL_OPS (Stefan Assmann) [1038782] - [netdrv] igb: Change memcpy to struct assignment (Stefan Assmann) [1038782] - [netdrv] igb: Replace 1/0 return values with true/false (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to remove unneeded extern declaration (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to replace deprecated DEFINE_PCI_DEVICE_TABLE (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to fix static initialization (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to fix msleep warnings (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to fix line length warnings (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to remove return parentheses (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to fix missing break in switch statements (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to fix assignment in if error (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to change comment style on license headers (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to fix for trailing statement (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to fix pointer location error (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to fix incorrect indentation (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups to fix braces location warnings (Stefan Assmann) [1038782] - [netdrv] igb: Cleanups for messaging (Stefan Assmann) [1038782] - [netdrv] igb: fix message terminations (Stefan Assmann) [1038782] - [netdrv] igb: fix stats for i210 rx_fifo_errors (Stefan Assmann) [1038782] - [netdrv] igb: fix last_rx_timestamp usage (Stefan Assmann) [1038782] - [netdrv] igb: remove open-coded skb_cow_head (Stefan Assmann) [1038782] - [netdrv] igb: Convert iounmap to pci_iounmap (Stefan Assmann) [1038782] - [netdrv] igb: fix race conditions on queuing skb for HW time stamp (Stefan Assmann) [1038782] - [netdrv] igb: never generate both software and hardware timestamps (Stefan Assmann) [1038782] - [netdrv] igb: Unset IGB_FLAG_HAS_MSIX-flag when falling back to msi-only (Stefan Assmann) [1038782] - [netdrv] igb: Fix Null-pointer dereference in igb_reset_q_vector (Stefan Assmann) [1038782] - [netdrv] igb: specify phc_index of 82575 for get_ts_info (Stefan Assmann) [1038782] - [netdrv] igb: Fix memory leak in igb_get_module_eeprom() (Stefan Assmann) [1038782] - [netdrv] igb: add register rd/wr for surprise removal (Stefan Assmann) [1038782] - [netdrv] igb: implement SIOCGHWTSTAMP ioctl (Stefan Assmann) [1038782] - [netdrv] igb: Convert uses of __constant_ to (Stefan Assmann) [1038782] - [netdrv] igb: enable VLAN stripping for VMs with i350 (Stefan Assmann) [1038782] - [netdrv] igb: Add register defines needed for time sync functions (Stefan Assmann) [1038782] - [netdrv] igb: remove references to long gone command line parameters (Stefan Assmann) [1038782] - [netdrv] igb: Don't receive packets when the napi budget == 0 (Stefan Assmann) [1038782] - [netdrv] igb: Fix code comment (Stefan Assmann) [1038782] - [netdrv] igb: Fix for devices using ethtool for EEE settings (Stefan Assmann) [1038782] - [netdrv] igb: call skb_set_hash to set the hash and its type in a skbuff (Stefan Assmann) [1038782] - [netdrv] igb: fix warning if !CONFIG_IGB_HWMON (Stefan Assmann) [1038782] - [netdrv] igb: fix array size calculation (Stefan Assmann) [1038782] - [netdrv] igb: Update license text to remove FSF address and update copyright (Stefan Assmann) [1038782] - [netdrv] igb: make local functions static and remove dead code (Stefan Assmann) [1038782] - [netdrv] igb: Change to use statically allocated array for MSIx entries (Stefan Assmann) [1038782] - [netdrv] igb: Fix queue allocation method to accommodate changing during runtime (Stefan Assmann) [1038782] - [netdrv] igb: Fix for issue where values could be too high for udelay function (Stefan Assmann) [1038782] - [netdrv] igb: Start temperature sensor attribute index with 1 (Stefan Assmann) [1038782] - [netdrv] igb: Add new feature Media Auto Sense for 82580 devices only (Stefan Assmann) [1038782] - [netdrv] igb: Support ports mapped in 64-bit PCI space (Stefan Assmann) [1038782] - [netdrv] igb: Add media switching feature for i354 PHY's (Stefan Assmann) [1038782] - [netdrv] igb: Fixed Wake On LAN support (Stefan Assmann) [1038782] - [netdrv] igb: Don't let ethtool try to write to iNVM in i210/i211 (Stefan Assmann) [1038782] - [netdrv] igb: Fix master/slave mode for all m88 i354 PHY's (Stefan Assmann) [1038782] - [netdrv] igb: Miscellaneous conversions to ETH_ALEN (Stefan Assmann) [1038782] - [netdrv] igb: Avoid uninitialized advertised variable in eee_set_cur (Stefan Assmann) [1038782] - [netdrv] igb: Add ethtool support to configure number of channels (Stefan Assmann) [1038782] - [netdrv] igb: Add ethtool offline tests for i354 (Stefan Assmann) [1038782] - [netdrv] igb: Fix ethtool loopback test for 82580 copper (Stefan Assmann) [1038782] - [netdrv] igb: Remove extern from function prototypes (Stefan Assmann) [1038782] - [netdrv] igb: fix 32-bit DMA mask handling (Stefan Assmann) [1038782] - [netdrv] igb: fix up function prototypes after __dev* removals (Stefan Assmann) [1038782] - [netdrv] igb: remove __dev* attributes (Stefan Assmann) [1038782]- [documentation] vm: clarify vfs_cache_pressure description (Denys Vlasenko) [804463] - [kernel] sched_rt: Use root_domain of rt_rq not current processor (Daniel Bristot de Oliveira) [1101301] - [kernel] cgroups: fix a css_set not found bug in cgroup_attach_proc (Petr Oros) [1078263] - [virt] kvm: enable PCI multiple-segments for pass-through device (Michael S. Tsirkin) [1103471] - [kvm] x86: increase VCPU limit to 240 (Radim Krcmar) [864242] - [x86] Mark Intel Broadwell processor as supported (David Milburn) [1032351] - [x86] kvm: expose invariant tsc cpuid bit (Marcelo Tosatti) [996770] - [pci] Fix section mismatch - pcibios_scan_root() to .devinit.text:pci_scan_root_bus() (Myron Stowe) [1104384] - [net] mac80211: don't validate unchanged AP bandwidth while tracking (Stanislaw Gruszka) [1090428] - [usb] don't enable remote wakeup by default (Don Zickus) [698729] - [usb] Update USB default wakeup settings (Don Zickus) [698729] - [usb] obey the sysfs power/wakeup setting (Don Zickus) [698729] - [s390] kernel: avoid page table walk on user space access (Hendrik Brueckner) [1099146] - [s390] qeth: postpone freeing of qdio memory (Hendrik Brueckner) [1094379] - [s390] qeth: Fix retry logic in hardsetup (Hendrik Brueckner) [1094379] - [s390] qeth: Recognize return codes of ccw_device_set_online (Hendrik Brueckner) [1094379] - [s390] qdio: remove API wrappers (Hendrik Brueckner) [1094379] - [netdrv] ixgbevf: remove open-coded skb_cow_head (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Add bit to mark work queue initialization (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Fix rcu warnings induced by LER (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Change ixgbe_read_reg to ixgbevf_read_reg (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Additional adapter removal checks (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Check for adapter removal on register writes (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Check register reads for adapter removal (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Make the ethtool register test use accessors (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Use static inlines instead of macros (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Convert uses of __constant_ to (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Protect ixgbevf_down with __IXGBEVF_DOWN bit (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Indicate removal state explicitly (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: delete unneeded call to pci_set_power_state (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: add check for CHECKSUM_PARTIAL when doing TSO (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: fix handling of tx checksumming (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Use pci_enable_msix_range() instead of pci_enable_msix() (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: merge ixgbevf_tx_map and ixgbevf_tx_queue into a single function (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: redo dma mapping using the tx buffer info (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: make the first tx_buffer a repository for most of the skb info (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: add tx counters (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: remove counters for Tx/Rx checksum offload (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: move ring specific stats into ring specific structure (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: make use of the dev pointer in the ixgbevf_ring struct and remove externs (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: bump version (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: create function for all of ring init (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Convert ring storage form pointer to an array to array of pointers (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: use pci drvdata correctly in ixgbevf_suspend() (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: set the disable state when ixgbevf_qv_disable is called (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: add DCB configuration into queue setup (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Focus config of head, tail ntc, and ntu all into a single function (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: cleanup IXGBE_DESC_UNUSED (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: remove redundant workaround (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Add zero_base handler to network statistics (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: add BP_EXTENDED_STATS for CONFIG_NET_RX_BUSY_POLL (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: implement CONFIG_NET_RX_BUSY_POLL (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: have clean_rx_irq return total_rx_packets cleaned (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: add ixgbevf_rx_skb (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: bump driver version (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: implement ethtool get/set coalesce (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Adds function to set PSRTYPE register (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Miscellaneous conversions to ETH_ALEN (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: add wait for Rx queue disable (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: cleanup redundant mailbox read failure check (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: do not print registers to dmesg in ixgbevf_get_regs (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: fix 32-bit DMA mask handling (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Add checksum statistics counters to rings (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: Make use of NETIF_F_RXCSUM instead of keeping our own flag (Andy Gospodarek) [1038785] - [netdrv] ixgbevf: convert to ndo_fix_features (Andy Gospodarek) [1038785] - [netdrv] ixgbe: fix message terminations (Andy Gospodarek) [1038784] - [netdrv] ixgbe: clean up Rx time stamping code (Andy Gospodarek) [1038784] - [netdrv] ixgbe: remove open-coded skb_cow_head (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Add bit to mark service task initialization (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Fix rcu warnings induced by LER (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix ixgbe_check_reset_blocked() declaration (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix race conditions on queuing skb for HW time stamp (Andy Gospodarek) [1038784] - [netdrv] ixgbe: never generate both software and hardware timestamps (Andy Gospodarek) [1038784] - [netdrv] ixgbe: remove redundant if clause from PTP work (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Break recursion in case of removal (Andy Gospodarek) [1038784] - [netdrv] ixgbe: enable tx queues after link up (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Stop cacheing if the MNG FW enabled (Andy Gospodarek) [1038784] - [netdrv] ixgbe: clean up ixgbe_atr_compute_perfect_hash_82599 (Andy Gospodarek) [1038784] - [netdrv] ixgbe: use ixgbe_read_pci_cfg_word (Andy Gospodarek) [1038784] - [netdrv] ixgbe: remove unused media type (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix ixgbe_setup_mac_link_82599 autoc variables (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix ixgbe_stop_mac_link_on_d3_82599 to check mng correctly (Andy Gospodarek) [1038784] - [netdrv] ixgbe: check Core Clock Disable bit (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix errors related to protected AUTOC calls (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Convert uses of __constant_ to (Andy Gospodarek) [1038784] - [netdrv] ixgbe: add ixgbe_write_pci_cfg_word with ixgbe_removed check (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Don't receive packets when the napi budget == 0 (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix some multiline hw_dbg prints (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fixup header for ixgbe_set_rxpba_82598 (Andy Gospodarek) [1038784] - [netdrv] ixgbe: add Linux NICS mailing list to contact info (Andy Gospodarek) [1038784] - [netdrv] ixgbe: move setting rx_pb_size into get_invariants (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Fix format string in ixgbe_fcoe.c (Andy Gospodarek) [1038784] - [netdrv] ixgbe: calls skb_set_hash (Andy Gospodarek) [1038784] - [netdrv] ixgbe: implement SIOCGHWTSTAMP ioctl (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Check config reads for removal (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Fix up some ethtool results when adapter is removed (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Restore hw_addr in LER recovery paths (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Add check for FW veto bit (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix bit toggled for 82599 reset fix (Andy Gospodarek) [1038784] - [netdrv] ixgbe: collect all 82599 AUTOC code in one function (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix to use correct timeout interval for memory read completion (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Add WoL support for a new device (Andy Gospodarek) [1038784] - [netdrv] ixgbe: don't use magic size number to assign ptp_caps.name (Andy Gospodarek) [1038784] - [netdrv] ixgbe: modify behavior on receiving a HW ECC error (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Use pci_enable_msix_range() instead of pci_enable_msix() (Andy Gospodarek) [1038784] - [netdrv] ixgbe: bump version number (Andy Gospodarek) [1038784] - [netdrv] ixgbe: add braces around else condition in ixgbe_qv_lock_* calls (Andy Gospodarek) [1038784] - [netdrv] ixgbe: set driver_max_VFs should be done before enabling SRIOV (Andy Gospodarek) [1038784] - [netdrv] ixgbe: define IXGBE_MAX_VFS_DRV_LIMIT macro and cleanup const 63 (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Fix incorrect logic for fixed fiber eeprom write (Andy Gospodarek) [1038784] - [netdrv] ixgbe: reinit_locked() should be called with rtnl_lock (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Clear head write-back registers on VF reset (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Force QDE via PFQDE for VFs during reset (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Additional adapter removal checks (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Check for adapter removal on register writes (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Check register reads for adapter removal (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Make ethtool register test use accessors (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Use static inlines instead of macros (Andy Gospodarek) [1038784] - [netdrv] ixbge: Protect ixgbe_down with __IXGBE_DOWN bit (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Indicate removal state explicitly (Andy Gospodarek) [1038784] - [netdrv] ixgbe: slight optimization of addr compare (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix for unused variable warning with certain config (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Start temperature sensor attribute index with 1 (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Make ixgbe_identify_qsfp_module_generic static (Andy Gospodarek) [1038784] - [netdrv] ixgbe: add warning when max_vfs is out of range (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Reduce memory consumption with larger page sizes (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix qv_lock_napi call in ixgbe_napi_disable_all (Andy Gospodarek) [1038784] - [netdrv] ixgbe: use pcie_capability_read_word() to simplify code (Andy Gospodarek) [1038784] - [netdrv] ixgbe: remove marketing names from busy poll code (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Cleanup the use of tabs and spaces (Andy Gospodarek) [1038784] - [netdrv] ixgbe: ethtool DCB registers dump for 82599 and x540 (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Remove extern from function prototypes (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix 32-bit DMA mask handling (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix ethtool reporting of supported links for SFP modules (Andy Gospodarek) [1038784] - [netdrv] ixgbe: limit setting speed to only one at a time for QSFP modules (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix ethtool loopback diagnostic with DCB enabled (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fully disable hardware RSC logic when disabling RSC (Andy Gospodarek) [1038784] - [netdrv] ixgbe: add support for older QSFP active DA cables (Andy Gospodarek) [1038784] - [netdrv] ixgbe: include QSFP PHY types in ixgbe_is_sfp() (Andy Gospodarek) [1038784] - [netdrv] ixgbe: add 1Gbps support for QSFP+ (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix SFF data dumps of SFP+ modules from an offset (Andy Gospodarek) [1038784] - [netdrv] ixgbe: cleanup some log messages (Andy Gospodarek) [1038784] - [netdrv] ixgbe: zero out mailbox buffer on init (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix link test when connected to 1Gbps link partner (Andy Gospodarek) [1038784] - [netdrv] ixgbe: fix incorrect limit value in ring transverse (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Check return value on eeprom reads (Andy Gospodarek) [1038784] - [netdrv] ixgbe: disable link when adapter goes down (Andy Gospodarek) [1038784] - [netdrv] ixgbe: rename LL_EXTENDED_STATS to use queue instead of q (Andy Gospodarek) [1038784] - [netdrv] ixgbe: Update ixgbe driver to use __netdev_pick_tx in ixgbe_select_queue (Andy Gospodarek) [1038784] - [netdrv] e1000e: Out of line __ew32_prepare/__ew32 (John Greene) [1038781] - [netdrv] e1000e: Fix expand setting EEE link info to all affected parts (John Greene) [1038781] - [netdrv] e1000e: Cleanup parenthesis around return value (John Greene) [1038781] - [netdrv] e1000e: 82574/82583 TimeSync errata for SYSTIM read (John Greene) [1038781] - [netdrv] e1000e: Failure to write SHRA turns on PROMISC mode (John Greene) [1038781] - [netdrv] e1000e: Cleanup use of deprecated DEFINE_PCI_DEVICE_TABLE (John Greene) [1038781] - [netdrv] e1000e: Cleanup checkpatch extra space (John Greene) [1038781] - [netdrv] e1000e: Cleanup to fix checkpatch missing blank lines (John Greene) [1038781] - [netdrv] e1000e: Cleanup return values in ethtool (John Greene) [1038781] - [netdrv] e1000e: Restrict MDIO Slow Mode workaround to relevant parts (John Greene) [1038781] - [netdrv] e1000e: Fix issue with link flap on 82579 (John Greene) [1038781] - [netdrv] e1000e: Expand workaround for 10Mb HD throughput bug (John Greene) [1038781] - [netdrv] e1000e: Workaround for dropped packets in Gig/100 speeds on 82579 (John Greene) [1038781] - [netdrv] e1000e: fix message terminations (John Greene) [1038781] - [netdrv] e1000e: Fix no connectivity when driver loaded with cable out (John Greene) [1038781] - [netdrv] e1000e: remove redundant if clause from PTP work (John Greene) [1038781] - [netdrv] e1000e: add timeout for TX HW time stamping work (John Greene) [1038781] - [netdrv] e1000e: Fix Explicitly set Transmit Control Register (John Greene) [1038781] - [netdrv] e1000e: Fix Hardware Unit Hang (John Greene) [1038781] - [netdrv] e1000e: Fix SHRA register access for 82579 (John Greene) [1038781] - [netdrv] e1000e: Fix ethtool offline tests for 82579 parts (John Greene) [1038781] - [netdrv] e1000e: Fix not generating an error on invalid load parameter (John Greene) [1038781] - [netdrv] e1000e: Add missing branding strings in ich8lan.c (John Greene) [1038781] - [netdrv] e1000e: Cleanup - Update GPL header and Copyright (John Greene) [1038781] - [netdrv] e1000e: Fix 82579 sets LPI too early (John Greene) [1038781] - [netdrv] e1000e: Resolve issues with Management Engine briefly blocking PHY resets (John Greene) [1038781] - [netdrv] e1000e: PTP lock in e1000e_phc_adjustfreq (John Greene) [1038781] - [netdrv] e1000e: fix maybe-unitialized variable compiler warning (John Greene) [1038781] - [netdrv] e1000e: fix compiler warnings (John Greene) [1038781] - [netdrv] e1000e: fix overrun of PHY RAR array (John Greene) [1038781] - [netdrv] e1000e: cleanup boolean comparison to true (John Greene) [1038781] - [netdrv] e1000e: balance semaphore put/get for 82573 (John Greene) [1038781] - [netdrv] e1000e: resolve checkpatch JIFFIES_COMPARISON warning (John Greene) [1038781] - [netdrv] e1000e: Avoid kernel crash during shutdown (John Greene) [1038781] - [cciss] touch version string (Tomas Henzl) [1052275] - [cciss] Fallback to MSI rather than to INTx if MSI-X failed (Tomas Henzl) [1052275] - [cciss] drivers/block/cciss.c:cciss_init_one(): use proper errnos (Tomas Henzl) [1052275] - [cciss] Adds simple mode functionality (Tomas Henzl) [1052275] - [cciss] add cciss_allow_hpsa module parameter (Tomas Henzl) [1052275] - [cciss] bug fix to prevent cciss from loading in kdump crash kernel (Tomas Henzl) [1052275] - [cciss] add transport mode attribute to sys (Tomas Henzl) [1052275] - [cciss] fix flush cache transfer length (Tomas Henzl) [1052275] - [cciss] Inform controller we are using 32-bit tags (Tomas Henzl) [1052275] - [cciss] fix invalid use of sizeof in cciss_find_cfgtables() (Tomas Henzl) [1052275] - [cciss] set max scatter gather entries to 32 on P600 (Tomas Henzl) [1052275] - [cciss] The Windows driver .inf disables ASPM on all cciss devices. Do the same (Tomas Henzl) [1052275] - [cciss] auto engage SCSI mid layer at driver load time (Tomas Henzl) [1052275] - [cciss] return 0 from driver probe function on success, not 1 (Tomas Henzl) [1052275] - [cciss] add readl after writel in interrupt mask setting code (Tomas Henzl) [1052275] - [cciss] Fix scsi tape io with more than 255 scatter gather elements (Tomas Henzl) [1052275] - [cciss] Initialize scsi host max_sectors for tape drive support (Tomas Henzl) [1052275] - [cciss] fix missed command status value CMD_UNABORTABLE (Tomas Henzl) [1052275] - [cciss] fix incorrect scsi status reporting (Tomas Henzl) [1052275] - [scsi] mpt2sas: Don't disable device twice at suspend (Tomas Henzl) [1059137] - [scsi] mpt2sas: Remove phys on topology change (Tomas Henzl) [1059137] - [scsi] mpt2sas: Bump driver version to v16.100.00.00 (Tomas Henzl) [1059137] - [scsi] mpt2sas: Fix for kernel panic when driver loads with HBA connected to non LUN 0 configured expander (Tomas Henzl) [1059137] - [scsi] mpt2sas: when Async scanning is enabled then while scanning, devices are removed but their transport layer entries are not removed (Tomas Henzl) [1059137] - [scsi] mpt2sas: Infinite loop can occur if MPI2_IOCSTATUS_CONFIG_INVALID_PAGE is not returned (Tomas Henzl) [1059137] - [scsi] mpt2sas: The copyright in driver sources is updated for the year 2013 (Tomas Henzl) [1059137] - [scsi] mpt2sas: MPI2 Rev X (2.00.16) specifications (Tomas Henzl) [1059137] - [scsi] mpt2sas: Change in MPI2_RAID_ACTION_SYSTEM_SHUTDOWN_INITIATED notification methodology (Tomas Henzl) [1059137] - [scsi] mpt2sas: Null pointer deference possibility in mpt2sas_ctl_event_callback function (Tomas Henzl) [1059137] - [scsi] mpt2sas: fix cleanup on controller resource mapping failure (Tomas Henzl) [1059137]- [block] floppy: don't write kernel-only members to FDRAWCMD ioctl output (Denys Vlasenko) [1094310] {CVE-2014-1738} - [block] floppy: ignore kernel-only members in FDRAWCMD ioctl input (Denys Vlasenko) [1094310] {CVE-2014-1737} - [kbuild] Remove export of trace_clock.h (Prarit Bhargava) [1092110] - [kbuild] asm-generic support (Prarit Bhargava) [1092110] - [kbuild] headers_check: recursively search for linux/types.h inclusion (Prarit Bhargava) [1092110] - [netdrv] bonding: add an option to fail when any of arp_ip_target is inaccessible (Veaceslav Falico) [975493] - [netdrv] bonding: don't trust arp requests unless active slave really works (Veaceslav Falico) [975493] - [netdrv] bonding: don't add duplicate targets to arp_ip_target (Veaceslav Falico) [975493] - [netdrv] bonding: arp_ip_count and arp_targets can be wrong (Veaceslav Falico) [975493] - [netdrv] bonding: make arp_ip_target parameter checks consistent with sysfs (Veaceslav Falico) [975493] - [netdrv] bonding: add helper function bond_get_targets_ip() (Veaceslav Falico) [975493] - [netdrv] netxen: Update version to 4.0.82 (Veaceslav Falico) [1054332] - [netdrv] netxen: Correct off-by-one errors in bounds checks (Veaceslav Falico) [1054332] - [netdrv] netxen: Print ULA information (Veaceslav Falico) [1054332] - [netdrv] netxen: Remove extern from function prototypes (Veaceslav Falico) [1054332] - [netdrv] netxen: Update version to 4.0.81 (Veaceslav Falico) [1054332] - [netdrv] netxen: Convert mac address uses of 6 to ETH_ALEN (Veaceslav Falico) [1054332] - [netdrv] netxen: Avoid mixed mode interrupts (Veaceslav Falico) [1054332] - [netdrv] netxen: netxen_setup_intr() function code cleanup (Veaceslav Falico) [1054332] - [netdrv] netxen: Log proper error message in case of mismatched adapter type (Veaceslav Falico) [1054332] - [netdrv] netxen: Log driver version with firmware version (Veaceslav Falico) [1054332] - [netdrv] netxen: replace ip_fast_csum with csum_replace2 (Veaceslav Falico) [1054332] - [netdrv] netxen: fix off by one bug in netxen_release_tx_buffer() (Veaceslav Falico) [1054332] - [netdrv] netxen: remove __dev* attributes (Veaceslav Falico) [1054332] - [netdrv] netxen: Fixed a coding style issue in netxen_nic_ethtool.c (Veaceslav Falico) [1054332] - [netdrv] netxen: explicity handle pause autoneg parameter (Veaceslav Falico) [1054332] - [netdrv] enic: Use pci_enable_msix_range() instead of pci_enable_msix() (Stefan Assmann) [1024064] - [netdrv] enic: Fix 64 bit divide on 32bit system (Stefan Assmann) [1024064] - [netdrv] enic: Add support for adaptive interrupt coalescing (Stefan Assmann) [1024064] - [netdrv] enic: get rid of SET_ETHTOOL_OPS (Stefan Assmann) [1024064] - [netdrv] enic: include irq.h for irqreturn_t definitions (Stefan Assmann) [1024064] - [netdrv] enic: Call dev_kfree_skb_any instead of dev_kfree_skb (Stefan Assmann) [1024064] - [netdrv] enic: Don't receive packets when the napi budget == 0 (Stefan Assmann) [1024064] - [netdrv] enic: slight optimization of addr compare (Stefan Assmann) [1024064] - [netdrv] enic: cisco-enic calls skb_set_hash (Stefan Assmann) [1024064] - [netdrv] enic: remove unnecessary pci_set_drvdata() (Stefan Assmann) [1024064] - [netdrv] enic: update enic maintainers and driver (Stefan Assmann) [1024064] - [netdrv] enic: Exposing symbols for Cisco's low latency driver (Stefan Assmann) [1024064] - [netdrv] enic: Try DMA 64 first, then failover to DMA (Stefan Assmann) [1024064] - [netdrv] enic: record q_number and rss_hash for skb (Stefan Assmann) [1024064] - [netdrv] enic: Add multi tx support for enic (Stefan Assmann) [1024064] - [netdrv] enic: Generate notification of hardware crash (Stefan Assmann) [1024064] - [netdrv] enic: Add an interface for USNIC to interact with firmware (Stefan Assmann) [1024064] - [netdrv] enic: Adding support for Cisco Low Latency NIC (Stefan Assmann) [1024064] - [netdrv] enic: Move ethtool code to a separate file (Stefan Assmann) [1024064] - [netdrv] igbvf: remove usless return statements (Stefan Assmann) [1038783] - [netdrv] igbvf: get rid of SET_ETHTOOL_OPS (Stefan Assmann) [1038783] - [netdrv] igbvf: remove open-coded skb_cow_head (Stefan Assmann) [1038783] - [netdrv] igbvf: Convert uses of __constant_ to (Stefan Assmann) [1038783] - [netdrv] igbvf: slight optimization of addr compare (Stefan Assmann) [1038783] - [netdrv] igbvf: add missing iounmap() on error in igbvf_probe() (Stefan Assmann) [1038783] - [netdrv] igbvf: integer wrapping bug setting the mtu (Stefan Assmann) [1038783] - [netdrv] igbvf: Miscellaneous conversions to ETH_ALEN (Stefan Assmann) [1038783] - [netdrv] igbvf: Remove extern from function prototypes (Stefan Assmann) [1038783] - [netdrv] igbvf: fix 32-bit DMA mask handling (Stefan Assmann) [1038783] - [netdrv] igbvf: use __GFP_ZERO instead of memset() (Stefan Assmann) [1038783] - [kernel] mutex: Unlock the mutex without the wait_lock (Larry Woodman) [1100855] - [kernel] mutex: Do not unnecessarily deal with waiters (Larry Woodman) [1100855] - [kernel] mutex: Introduce cancelable MCS lock for adaptive spinning (Larry Woodman) [1100855] - [kernel] mutex: Modify the way optimistic spinners are queued (Larry Woodman) [1100855] - [kernel] mutex: Queue mutex spinners with MCS lock to reduce cacheline contention (Larry Woodman) [1100855] - [kernel] mutex: Make more scalable & Back out architecture specific check (Larry Woodman) [1100855] - [kernel] sched: Periodically decay max cost of idle balance (Larry Woodman) [1100855] - [kernel] sched: Consider max cost of idle balance per sched domain (Larry Woodman) [1100855] - [kernel] sched: Reduce overestimating rq->avg_idle (Larry Woodman) [1100855] - [kernel] futex: Increase hash table size for better performance (Larry Woodman) [1100855] - [fs] epoll: optimize EPOLL_CTL_DEL using rcu (Larry Woodman) [1100855] - [scsi] virtio-scsi: Skip setting affinity on uninitialized vq (Jason Wang) [1098309] - [scsi] virtio-scsi: Fix hotcpu_notifier use-after-free with virtscsi_freeze (Jason Wang) [1098309] - [scsi] virtio-scsi: Fix virtqueue affinity setup (Jason Wang) [1098309] - [scsi] virtio-scsi: reset virtqueue affinity when doing cpu hotplug (Jason Wang) [1098309] - [scsi] virtio-scsi: introduce multiqueue support (Jason Wang) [1098309] - [scsi] virtio-scsi: push vq lock/unlock into virtscsi_vq_done (Jason Wang) [1098309] - [scsi] virtio-scsi: pass struct virtio_scsi to virtqueue completion function (Jason Wang) [1098309] - [scsi] virtio-scsi: redo allocation of target data (Jason Wang) [1098309] - [i2c] i801: Add Device IDs for Intel Wildcat Point-LP PCH (David Milburn) [922970] - [ata] ahci: Add Device IDs for Intel Wildcat Point-LP (David Milburn) [922970] - [mfd] lpc_ich: Add Device IDs for Intel Wildcat Point-LP PCH (David Milburn) [922970] - [hda] alsa: Add Device IDs for Intel Wildcat Point-LP PCH (David Milburn) [922970] - [scsi] qla4xxx: 5.03.00.00.06.06-k0 (Chad Dupuis) [1053365] - [scsi] qla4xxx: remove pci id for ISP8042 (Chad Dupuis) [1053365] - [scsi] libiscsi: Add local_ipaddr parameter in iscsi_conn struct (Chad Dupuis) [1053365] - [scsi] IB/iser: Add Discovery support (Chad Dupuis) [1053365] - [scsi] scsi_transport_iscsi: Export ISCSI_PARAM_LOCAL_IPADDR attr for iscsi_connection (Chad Dupuis) [1053365] - [scsi] scsi_transport_iscsi: Add host statistics support (Chad Dupuis) [1053365] - [scsi] iscsi_transport: Additional parameters for network settings (Chad Dupuis) [1053365] - [scsi] iscsi_transport: Remove net param enum values (Chad Dupuis) [1053365] - [scsi] scsi_transport_iscsi: Add support to set CHAP entries (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix smatch warning in func qla4xxx_conn_get_param (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix smatch warning in func qla4xxx_get_ep_param (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix memory leak for ha->saved_acb (Chad Dupuis) [1053365] - [scsi] qla4xxx: Export sysfs DDBs from DPC handler (Chad Dupuis) [1053365] - [scsi] qla4xxx: Disable INTx interrupt for ISP82XX (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix memory leak in func qla4_84xx_config_acb() (Chad Dupuis) [1053365] - [scsi] qla4xxx: Initialize hardware queue for ISP40XX (Chad Dupuis) [1053365] - [scsi] qla4xxx: Check for correct return status (Chad Dupuis) [1053365] - [scsi] qla4xxx: Move qla4_8xxx_ms_mem_write_128b to ql4_nx.c (Chad Dupuis) [1053365] - [scsi] qla4xxx: Added PEX DMA Support for ISP8022 Adapter (Chad Dupuis) [1053365] - [scsi] qla4xxx: Added new opcodes for 84XX Minidump template (Chad Dupuis) [1053365] - [scsi] qla4xxx: Add support of 0xFF capture mask for minidump (Chad Dupuis) [1053365] - [scsi] qla4xxx: Change default capture to firmware defined capture mask (Chad Dupuis) [1053365] - [scsi] qla4xxx: Do not wait for IO completion, after issuing stop_firmware (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix sparse warnings (Chad Dupuis) [1053365] - [scsi] qla4xxx: Handle IPv6 AEN notifications (Chad Dupuis) [1053365] - [scsi] qla4xxx: Update print statements in func qla4xxx_do_dpc() (Chad Dupuis) [1053365] - [scsi] qla4xxx: Update print statements in func qla4xxx_eh_abort() (Chad Dupuis) [1053365] - [scsi] qla4xxx: Update print statements in qla4xxx_mailbox_command() (Chad Dupuis) [1053365] - [scsi] qla4xxx: Updated print for device login, logout path (Chad Dupuis) [1053365] - [scsi] qla4xxx: Remove unused code from qla4xxx_set_ifcb() (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix failure of mbox 0x31 (Chad Dupuis) [1053365] - [scsi] qla4xxx: Reduce rom-lock contention during reset recovery (Chad Dupuis) [1053365] - [scsi] qla4xxx: Driver not able to collect minidump for ISP84xx (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix pending IO completion in reset path before initiating chip reset (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix processing response queue during probe (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix failure of IDC Time Extend mailbox command (Chad Dupuis) [1053365] - [scsi] qla4xxx: Clear DDB index map upon connection close failure (Chad Dupuis) [1053365] - [scsi] qla4xxx: Return correct error status from func qla4xxx_request_irqs() (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fixed AER reset sequence for ISP83xx/ISP84xx (Chad Dupuis) [1053365] - [scsi] qla4xxx: Correctly handle msleep_interruptible (Chad Dupuis) [1053365] - [scsi] qla4xxx: Rename ACB_STATE macros with IP_ADDRSTATE macros (Chad Dupuis) [1053365] - [scsi] qla4xxx: Improve loopback failure messages (Chad Dupuis) [1053365] - [scsi] qla4xxx: Use IDC_CTRL bit1 directly instead of AF_83XX_NO_FWDUMP flag (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix comments in code (Chad Dupuis) [1053365] - [scsi] qla4xxx: Print WARN_ONCE() if iSCSI function presence bit removed (Chad Dupuis) [1053365] - [scsi] qla4xxx: ISP8xxx: Correct retry of adapter initialization (Chad Dupuis) [1053365] - [scsi] qla4xxx: treewide: fix comments and printk msgs (Chad Dupuis) [1053365] - [scsi] qla4xxx: Recreate chap data list during get chap operation (Chad Dupuis) [1053365] - [scsi] qla4xxx: Add support for ISCSI_PARAM_LOCAL_IPADDR sysfs attr (Chad Dupuis) [1053365] - [scsi] qla4xxx: Add host statistics support (Chad Dupuis) [1053365] - [scsi] qla4xxx: Added support for Diagnostics MBOX command (Chad Dupuis) [1053365] - [scsi] qla4xxx: overflow in qla4xxx_set_chap_entry() (Chad Dupuis) [1053365] - [scsi] qla4xxx: Add support for additional network parameters settings (Chad Dupuis) [1053365] - [scsi] qla4xxx: Add support to get CHAP details for flash target session (Chad Dupuis) [1053365] - [scsi] qla4xxx: Add support to set CHAP entries (Chad Dupuis) [1053365] - [scsi] qla4xxx: Use offset based on adapter type to set CHAP entry in flash (Chad Dupuis) [1053365] - [scsi] qla4xxx: Populate local CHAP credentials for flash target sessions (Chad Dupuis) [1053365] - [scsi] qla4xxx: correctly update session discovery_parent_idx (Chad Dupuis) [1053365] - [scsi] remove unnecessary pci_set_drvdata() (Chad Dupuis) [1053365] - [scsi] qla4xxx: Return error if minidump data collection fails (Chad Dupuis) [1053365] - [scsi] qla4xxx: Fix the minidump data collection check in for loop (Chad Dupuis) [1053365] - [scsi] qla4xxx: Add pex-dma support for capturing minidump (Chad Dupuis) [1053365] - [scsi] qla4xxx: Update Copyright header (Chad Dupuis) [1053365] - [scsi] qla4xxx: Implementation of ACB configuration during Loopback for ISP8042 (Chad Dupuis) [1053365] - [scsi] qla4xxx: Added support for ISP8042 (Chad Dupuis) [1053365] - [net] bridge: add empty br_mdb_init() and br_mdb_uninit() definitions (Vlad Yasevich) [1097915] - [net] bridge: Correctly unregister MDB rtnetlink handlers (Vlad Yasevich) [1097915] - [net] rds: prevent dereference of a NULL device in rds_iw_laddr_check (Radomir Vrbovsky) [1083277] {CVE-2014-2678} - [netdrv] bnx2x: convert to hw_features (Michal Schmidt) [1029841] - [netdrv] bnx2x: drop two RHEL-specific hacks that cancel each other (Michal Schmidt) [1020367] - [netdrv] virtio-net: Set RXCSUM feature if GUEST_CSUM is available (Michal Schmidt) [1029841] - [netdrv] virtio_net: convert to hw_features (Michal Schmidt) [1029841] - [netdrv] veth: features fixup (Michal Schmidt) [1029841] - [netdrv] veth: convert to hw_features (Michal Schmidt) [1029841] - [net] loopback: convert to hw_features (Michal Schmidt) [1029841] - [net] warn if mixing ndo features with legacy ops (Michal Schmidt) [1029841] - [net] ethtool: fix copy&paste errors in __ethtool_get_one_feature_actor (Michal Schmidt) [1029841] - [net] ethtool: __ethtool_set_sg: check for function pointer before using it (Michal Schmidt) [1029841] - [net] ethtool: wanted_features hack for legacy drivers (Michal Schmidt) [1029841] - [net] ethtool: allow ETHTOOL_GSSET_INFO for users (Michal Schmidt) [1029841] - [net] remove NETIF_F_ALL_TX_OFFLOADS (Michal Schmidt) [1029841] - [documentation] net: Add documentation for netdev features handling (Michal Schmidt) [1029841] - [net] allow user to change NETIF_F_HIGHDMA (Michal Schmidt) [1029841] - [net] fix ETHTOOL_SFEATURES compatibility with old ethtool_ops.set_flags (Michal Schmidt) [1029841] - [net] ethtool: add two missing netdev_features_strings (Michal Schmidt) [1029841] - [net] ethtool: fix IPV6 checksum feature name string (Michal Schmidt) [1029841] - [net] Change netdev_fix_features messages loglevel to debug (Michal Schmidt) [1029841] - [net] Change netdev_fix_features messages loglevel (Michal Schmidt) [1029841] - [net] make WARN_ON in dev_disable_lro() useful (Michal Schmidt) [1029841] - [net] fix hw_features ethtool_ops->set_flags compatibility (Michal Schmidt) [1029841] - [net] add RTNL_ASSERT in __netdev_update_features() (Michal Schmidt) [1029841] - [net] Call netdev_features_change() from netdev_update_features() (Michal Schmidt) [1029841] - [net] Fix dev dev_ethtool_get_rx_csum() for forced NETIF_F_RXCSUM (Michal Schmidt) [1029841] - [net] implement dev_disable_lro() hw_features compatibility (Michal Schmidt) [1029841] - [net] Implement SFEATURES compatibility for not updated drivers (Michal Schmidt) [1029841] - [net] Fix ETHTOOL_GFEATURES compatibility (Michal Schmidt) [1029841] - [net] avoid initial "Features changed" message (Michal Schmidt) [1029841] - [net] fix "unregistered net_device: Features changed" message (Michal Schmidt) [1029841] - [net] introduce NETIF_F_RXCSUM (Michal Schmidt) [1029841] - [net] use ndo_fix_features for ethtool_ops->set_flags (Michal Schmidt) [1029841] - [net] ethtool: use ndo_fix_features for offload setting (Michal Schmidt) [1029841] - [net] add accessors to hw_features (Michal Schmidt) [1029841] - [net] Introduce new feature setting ops (Michal Schmidt) [1029841] - [net] ethtool: factorize get/set_one_feature (Michal Schmidt) [1029841] - [net] ethtool: factorize ethtool_get_strings() and ethtool_get_sset_count() (Michal Schmidt) [1029841] - [net] ethtool: Use noinline_for_stack (Michal Schmidt) [1029841] - [net] ethtool: Add direct access to ops->get_sset_count follow-up (Michal Schmidt) [1029841] - [net] ethtool: Add direct access to ops->get_sset_count (Michal Schmidt) [1029841] - [net] ethtool: enable GSO and GRO by default (Michal Schmidt) [1029841] - [net] ethtool: reduce stack usage (Michal Schmidt) [1029841] - [net] reduce and unify printk level in netdev_fix_features() (Michal Schmidt) [1029841] - [net] Move check of checksum features to netdev_fix_features() (Michal Schmidt) [1029841] - [netdrv] Fix too optimistic NETIF_F_HW_CSUM features (Michal Schmidt) [1029841] - [net] netdevice: use __printf attribute (Michal Schmidt) [1029841] - [net] netdevice: Convert netdev_ logging macros to functions (Michal Schmidt) [1029841] - [drivers] use __printf not __attribute__((format(printf, ...))) (Michal Schmidt) [1029841] - [drivers] core: Convert dev_ logging macros to functions (Michal Schmidt) [1029841] - [scsi] Remove warnings after vsprintf pV introducation (Michal Schmidt) [1029841] - [scsi] fix warning zero-length gnu_printf format string (Michal Schmidt) [1029841] - [net] netfilter: ctnetlink: don't add null bindings if no nat requested (Florian Westphal) [1089562] - [net] netfilter: ctnetlink: force null nat binding on insert (Florian Westphal) [1089562] - [net] netfilter: nf_nat: move alloc_null_binding to nf_nat_core.c (Florian Westphal) [1089562] - [net] netfilter: nf_conntrack: don't release a conntrack with non-zero refcnt (Florian Westphal) [1089562] - [net] netfilter: ctnetlink: fix soft lockup when netlink adds new entries (Florian Westphal) [1089562] - [net] netfilter: nf_conntrack: fix RCU race in nf_conntrack_find_get (Florian Westphal) [1089562] - [drivers] Ensure drvdata = NULL when no driver is bound (John Greene) [1056266] - [pci] msi: Add pci_enable_msi_range() and pci_enable_msix_range() (John Greene) [1056266] - [net] Add netdev interfaces for recording sends/comp (John Greene) [1056266] - [net] net_tstamp: Add SIOCGHWTSTAMP ioctl to match SIOCSHWTSTAMP (John Greene) [1056266] - [net] Add function to set the rxhash (John Greene) [1056266] - [kernel] dma-api: provide a helper to set both DMA and coherent DMA masks (John Greene) [1056266]- [perf] evsel: Synthesize PERF_SAMPLE_TRANSACTION (Jiri Olsa) [1101039] - [perf] test: Update "sample parsing" test for PERF_SAMPLE_TRANSACTION (Jiri Olsa) [1101039] - [perf] evsel: Add missing overflow check for TRANSACTION (Jiri Olsa) [1101039] - [perf] test: Consider PERF_SAMPLE_TRANSACTION in the "sample parsing" test (Jiri Olsa) [1101039] - [perf] test: Clarify the "sample parsing" test entry (Jiri Olsa) [1101039] - [perf] test: Update command line callchain attribute tests (Jiri Olsa) [1101039] - [perf] tools: Fixup mmap event consumption (Jiri Olsa) [1101039] - [perf] top: Split -G and --call-graph (Jiri Olsa) [1101039] - [perf] record: Split -g and --call-graph (Jiri Olsa) [1101039] - [perf] hists: Add color overhead for stdio output buffer (Jiri Olsa) [1101039] - [perf] tools: Fix up /proc/PID/maps parsing (Jiri Olsa) [1101039] - [perf] script: Fix mem leak due to missing Py_DECREFs on dict entries (Jiri Olsa) [1101039] - [perf] Disable PERF_RECORD_MMAP2 support (Jiri Olsa) [1101039] - [perf] script: Fix build error on Fedora 12 (Jiri Olsa) [1101039] - [perf] probe: Fix to initialize fname always before use it (Jiri Olsa) [1101039] - [perf] session: Fix infinite loop on invalid perf.data file (Jiri Olsa) [1101039] - [perf] tools: Fix installation of libexec components (Jiri Olsa) [1101039] - [perf] probe: Fix to find line information for probe list (Jiri Olsa) [1101039] - [perf] tools: Fix libaudit test (Jiri Olsa) [1101039] - [perf] stat: Set child_pid after perf_evlist__prepare_workload() (Jiri Olsa) [1101039] - [perf] tools: Add default handler for mmap2 events (Jiri Olsa) [1101039] - [perf] revert "symbols: Demangle cloned functions" (Jiri Olsa) [1101039] - [perf] symbols: Demangle cloned functions (Jiri Olsa) [1101039] - [perf] machine: Fix path unpopulated in machine__create_modules() (Jiri Olsa) [1101039] - [perf] tools: Explicitly add libdl dependency (Jiri Olsa) [1101039] - [perf] probe: Fix probing symbols with optimization suffix (Jiri Olsa) [1101039] - [perf] trace: Add mmap2 handler (Jiri Olsa) [1101039] - [perf] tools: Uninclude linux/magic.h in debugfs.c (Jiri Olsa) [1101039] - [perf] tools: Fix old GCC build error in trace-event-parse.c::parse_proc_kallsyms() (Jiri Olsa) [1101039] - [perf] probe: Fix finder to find lines of given function (Jiri Olsa) [1101039] - [perf] session: Check for SIGINT in more loops (Jiri Olsa) [1101039] - [perf] tools: Fix compile with libelf without get_phdrnum (Jiri Olsa) [1101039] - [perf] tools: Fix buildid cache handling of kallsyms with kcore (Jiri Olsa) [1101039] - [perf] annotate: Fix objdump line parsing offset validation (Jiri Olsa) [1101039] - [perf] tools: Fill in new definitions for madvise()/mmap() flags (Jiri Olsa) [1101039] - [perf] tools: Sharpen the libaudit dependencies test (Jiri Olsa) [1101039] - [perf] tools: Add attr->mmap2 support (Jiri Olsa) [1101039] - [perf] Add attr->mmap2 attribute to an event (Jiri Olsa) [1101039] - [perf] kvm: Fix sample_type manipulation (Jiri Olsa) [1101039] - [perf] evlist: Fix id pos in perf_evlist__open() (Jiri Olsa) [1101039] - [perf] trace: Handle perf.data files with no tracepoints (Jiri Olsa) [1101039] - [perf] session: Separate progress bar update when processing events (Jiri Olsa) [1101039] - [perf] trace: Check if MAP_32BIT is defined (Jiri Olsa) [1101039] - [perf] hists: Fix formatting of long symbol names (Jiri Olsa) [1101039] - [perf] evlist: Fix parsing with no sample_id_all bit set (Jiri Olsa) [1101039] - [perf] tools: Add test for parsing with no sample_id_all bit (Jiri Olsa) [1101039] - [perf] trace: Check control+C more often (Jiri Olsa) [1101039] - [perf] trace: Tell arg formatters the arg index (Jiri Olsa) [1101039] - [perf] trace: Add beautifier for open's flags arg (Jiri Olsa) [1101039] - [perf] trace: Add beautifier for lseek's whence arg (Jiri Olsa) [1101039] - [perf] tools: Fix symbol offset computation for some dsos (Jiri Olsa) [1101039] - [perf] list: Skip unsupported events (Jiri Olsa) [1101039] - [perf] tests: Add 'keep tracking' test (Jiri Olsa) [1101039] - [perf] tools: Add support for PERF_COUNT_SW_DUMMY (Jiri Olsa) [1101039] - [perf] trace: Add beautifier for futex 'operation' parm (Jiri Olsa) [1101039] - [perf] trace: Allow syscall arg formatters to mask args (Jiri Olsa) [1101039] - [perf] trace: Handle missing HUGEPAGE defines (Jiri Olsa) [1101039] - [perf] trace: Honor target pid / tid options when analyzing a file (Jiri Olsa) [1101039] - [perf] trace: Add option to analyze events in a file versus live (Jiri Olsa) [1101039] - [perf] evlist: Add tracepoint lookup by name (Jiri Olsa) [1101039] - [perf] tests: Add a sample parsing test (Jiri Olsa) [1101039] - [perf] tools: Add a function to calculate sample event size (Jiri Olsa) [1101039] - [perf] tools: Expand perf_event__synthesize_sample() (Jiri Olsa) [1101039] - [perf] tools: Add missing 'abi' member to 'struct regs_dump' (Jiri Olsa) [1101039] - [perf] tools: Add support for PERF_SAMPLE_IDENTIFIER (Jiri Olsa) [1101039] - [perf] evlist: Move perf_evlist__config() to a new source file (Jiri Olsa) [1101039] - [perf] tools: Remove references to struct ip_event (Jiri Olsa) [1101039] - [perf] callchain: Remove unnecessary validation (Jiri Olsa) [1101039] - [perf] evsel: Tidy up sample parsing overflow checking (Jiri Olsa) [1101039] - [perf] tools: change machine__findnew_thread() to set thread pid (Jiri Olsa) [1101039] - [perf] traceevent: Fixup jobserver setup (Jiri Olsa) [1101039] - [perf] tools: Add pid to struct thread (Jiri Olsa) [1101039] - [perf] trace: Add beautifier for madvise behaviour/advice parm (Jiri Olsa) [1101039] - [perf] trace: Add beautifier for mmap flags parm (Jiri Olsa) [1101039] - [perf] trace: Add beautifier for mmap prot parm (Jiri Olsa) [1101039] - [perf] trace: Allow overiding the formatting of syscall fields (Jiri Olsa) [1101039] - [perf] trace: Add aliases to remaining syscalls of the sys_enter_newfoo (Jiri Olsa) [1101039] - [perf] trace: Allow printing syscall return values in hex (Jiri Olsa) [1101039] - [perf] trace: Simplify sys_exit return printing (Jiri Olsa) [1101039] - [perf] trace: Introduce syscall arg formatters (Jiri Olsa) [1101039] - [perf] trace: Hide sys_exit messages about syscall id = -1 (Jiri Olsa) [1101039] - [perf] trace: Add --verbose option (Jiri Olsa) [1101039] - [perf] trace: Support ! in -e expressions (Jiri Olsa) [1101039] - [perf] tools: Don't install scripting files files when disabled (Jiri Olsa) [1101039] - [perf] tools: Sample after exit loses thread correlation (Jiri Olsa) [1101039] - [perf] trace: Make command line arguments consistent with perf-record (Jiri Olsa) [1101039] - [perf] trace: Implement -o/--output filename (Jiri Olsa) [1101039] - [perf] tools: Try to increase the file descriptor limits on EMFILE (Jiri Olsa) [1101039] - [perf] kvm: Remove force option to cmd_record (Jiri Olsa) [1101039] - [perf] trace: Allow specifying which syscalls to trace (Jiri Olsa) [1101039] - [perf] tools: Improve robustness of topology parsing code (Jiri Olsa) [1101039] - [perf] tests: Fix compile failure on do_sort_something (Jiri Olsa) [1101039] - [perf] tools: Remove filter parameter of thread__find_addr_map() (Jiri Olsa) [1101039] - [perf] tools: Remove filter parameter of thread__find_addr_location() (Jiri Olsa) [1101039] - [perf] tools: Remove filter parameter of perf_event__preprocess_sample() (Jiri Olsa) [1101039] - [perf] annotate: Set the machines symbol filter (Jiri Olsa) [1101039] - [perf] mem: Remove unused symbol filter member (Jiri Olsa) [1101039] - [perf] report: Set the machines symbol filter (Jiri Olsa) [1101039] - [perf] top: Set the machines symbol filter (Jiri Olsa) [1101039] - [perf] machine: Add symbol filter to struct machine (Jiri Olsa) [1101039] - [perf] session: Change perf_session__has_traces to actually check for tracepoints (Jiri Olsa) [1101039] - [perf] evsel: Add option to limit stack depth in callchain dumps (Jiri Olsa) [1101039] - [perf] evsel: Add option to print stack trace on single line (Jiri Olsa) [1101039] - [perf] tool: Simplify options to perf_evsel__print_ip (Jiri Olsa) [1101039] - [perf] sched: Remove sched_process_fork tracepoint (Jiri Olsa) [1101039] - [perf] sched: Remove sched_process_exit tracepoint (Jiri Olsa) [1101039] - [perf] sched: Remove thread lookup in sample handler (Jiri Olsa) [1101039] - [perf] sched: Simplify arguments to read_events (Jiri Olsa) [1101039] - [perf] kvm: Update documentation with live command (Jiri Olsa) [1101039] - [perf] kvm: Option to print events that exceed a duration (Jiri Olsa) [1101039] - [perf] revert "tools: Fix for cross build" (Jiri Olsa) [1101039] - [perf] machine: Do not require /lib/modules/* on a guest (Jiri Olsa) [1101039] - [perf] tests: Add tests of new pinned modifier (Jiri Olsa) [1101039] - [perf] tools: Add support for pinned modifier (Jiri Olsa) [1101039] - [perf] gtk: Fix segmentation fault on perf_hpp__for_each_format loop (Jiri Olsa) [1101039] - [perf] report: Add option to analyze specific VM (Jiri Olsa) [1101039] - [perf] kvm: Add min and max stats to display (Jiri Olsa) [1101039] - [perf] kvm: Add live mode (Jiri Olsa) [1101039] - [perf] session: Export queue_event function (Jiri Olsa) [1101039] - [perf] annotate: Fix typo (Jiri Olsa) [1101039] - [perf] annotate: Improve description of '?' hotkey (Jiri Olsa) [1101039] - [perf] annotate: Add call target name if it is missing (Jiri Olsa) [1101039] - [perf] annotate: Remove nop at end of annotation (Jiri Olsa) [1101039] - [perf] annotate: Put dso name in symbol annotation title (Jiri Olsa) [1101039] - [perf] annotate: Allow disassembly using /proc/kcore (Jiri Olsa) [1101039] - [perf] tests: Add kcore to the object code reading test (Jiri Olsa) [1101039] - [perf] tests: Adjust the vmlinux symtab matches kallsyms test again (Jiri Olsa) [1101039] - [perf] symbols: Add support for reading from /proc/kcore (Jiri Olsa) [1101039] - [perf] tools: Make it possible to read object code from kernel modules (Jiri Olsa) [1101039] - [perf] tests: Adjust the vmlinux symtab matches kallsyms test (Jiri Olsa) [1101039] - [perf] tools: Make it possible to read object code from vmlinux (Jiri Olsa) [1101039] - [perf] symbols: Load kernel maps before using (Jiri Olsa) [1101039] - [perf] tests: Add test for reading object code (Jiri Olsa) [1101039] - [perf] symbols: avoid SyS kernel syscall aliases (Jiri Olsa) [1101039] - [perf] stat: Flush output after each line in interval mode (Jiri Olsa) [1101039] - [perf] evlist: Remove obsolete dummy execve (Jiri Olsa) [1101039] - [perf] kvm: Split out tracepoints from record args (Jiri Olsa) [1101039] - [perf] session: Export a few functions for event processing (Jiri Olsa) [1101039] - [perf] stats: Add max and min stats (Jiri Olsa) [1101039] - [perf] top: move CONSOLE_CLEAR to header file (Jiri Olsa) [1101039] - [perf] util: Add parse_nsec_time() function (Jiri Olsa) [1101039] - [perf] python: Remove duplicate TID bit from mask (Jiri Olsa) [1101039] - [perf] trace: Beautify 'connect' result (Jiri Olsa) [1101039] - [perf] evsel: Actually show symbol offset in stack trace when requested (Jiri Olsa) [1101039] - [perf] tests: Add parse events tests for leader sampling (Jiri Olsa) [1101039] - [perf] tests: Add attr record group sampling test (Jiri Olsa) [1101039] - [perf] tools: Add 'S' event/group modifier to read sample value (Jiri Olsa) [1101039] - [perf] tests: Add broken install-* tests into tests/make (Jiri Olsa) [1101039] - [perf] tests: Add 'make install/install-bin' tests into tests/make (Jiri Olsa) [1101039] - [perf] tests: Add DESTDIR=TMP_DEST tests/make variable (Jiri Olsa) [1101039] - [perf] tests: Rename TMP to TMP_O tests/make variable (Jiri Olsa) [1101039] - [perf] tests: Run ctags/cscope make tests only with needed binaries (Jiri Olsa) [1101039] - [perf] tools: Fix build with perl 5.18 (Jiri Olsa) [1101039] - [perf] tools: Support callchain sorting based on addresses (Jiri Olsa) [1101039] - [perf] evsel: Handle ENODEV on default cycles event (Jiri Olsa) [1101039] - [perf] script: Fix named threads support (Jiri Olsa) [1101039] - [perf] header: Recognize version number for perf data file (Jiri Olsa) [1101039] - [perf] header: Introduce feat_offset into perf_header (Jiri Olsa) [1101039] - [perf] header: Remove attr_offset from perf_header (Jiri Olsa) [1101039] - [perf] header: Remove data_offset seek as it's not needed (Jiri Olsa) [1101039] - [perf] session: Use session->fd instead of passing fd as argument (Jiri Olsa) [1101039] - [perf] symbols: Do not apply symfs for an absolute vmlinux path (Jiri Olsa) [1101039] - [perf] tools: Fix 'make tools/perf' (Jiri Olsa) [1101039] - [perf] tools: Remove event types framework completely (Jiri Olsa) [1101039] - [perf] record: Remove event types pushing (Jiri Olsa) [1101039] - [perf] tools: Remove event types from perf data file (Jiri Olsa) [1101039] - [perf] timechart: Remove event types framework only user (Jiri Olsa) [1101039] - [perf] timechart: Use traceevent lib event-parse.h include (Jiri Olsa) [1101039] - [perf] tools: Move hist_entry__period_snprintf into stdio code (Jiri Olsa) [1101039] - [perf] diff: Add generic order option for compute sorting (Jiri Olsa) [1101039] - [perf] diff: Making compute functions static (Jiri Olsa) [1101039] - [perf] diff: Update perf diff documentation for multiple data comparison (Jiri Olsa) [1101039] - [perf] diff: Change diff command to work over multiple data files (Jiri Olsa) [1101039] - [perf] diff: Move columns into struct data__file (Jiri Olsa) [1101039] - [perf] diff: Move diff related columns into diff command (Jiri Olsa) [1101039] - [perf] diff: Display data file info ahead of the diff output (Jiri Olsa) [1101039] - [perf] hists: Marking dummy hists entries (Jiri Olsa) [1101039] - [perf] diff: Switching the base hists to be pairs head (Jiri Olsa) [1101039] - [perf] diff: Introducing diff_data object to hold files (Jiri Olsa) [1101039] - [perf] tools: Centralize default columns init in perf_hpp__init (Jiri Olsa) [1101039] - [perf] tools: Add struct perf_hpp_fmt into hpp callbacks (Jiri Olsa) [1101039] - [perf] top: Add option to collapse undesired parts of call graph (Jiri Olsa) [1101039] - [perf] tools: Default to cpu// for events v5 (Jiri Olsa) [1101039] - [perf] tools: struct thread has a tid not a pid (Jiri Olsa) [1101039] - [perf] tools: Validate perf event header size (Jiri Olsa) [1101039] - [perf] evlist: Tidy duplicated munmap code (Jiri Olsa) [1101039] - [perf] tools: Add const specifier to perf_pmu__find name parameter (Jiri Olsa) [1101039] - [perf] inject: Add missing 'finished_round' (Jiri Olsa) [1101039] - [perf] hists: Set rules hint for the hist browser (Jiri Olsa) [1101039] - [perf] hists: Add a double-click handler for callchains (Jiri Olsa) [1101039] - [perf] hists: Make column headers resizable (Jiri Olsa) [1101039] - [perf] hists: Display callchain overhead also (Jiri Olsa) [1101039] - [perf] hists: Add support for callchains (Jiri Olsa) [1101039] - [perf] hists: Use GtkTreeStore instead of GtkListStore (Jiri Olsa) [1101039] - [perf] sched: Move struct perf_sched definition out of cmd_sched() (Jiri Olsa) [1101039] - [perf] util: Remove unused enum and macro in trace-event.h (Jiri Olsa) [1101039] - [perf] util: No need to call read_trace_init() in tracing_data_header() (Jiri Olsa) [1101039] - [perf] util: Rename read_*() functions in trace-event-info.c (Jiri Olsa) [1101039] - [perf] script: Adopt latency_format variable (Jiri Olsa) [1101039] - [perf] util: Get rid of unused header_page_* variables (Jiri Olsa) [1101039] - [perf] util: Parse header_page to get proper long size (Jiri Olsa) [1101039] - [perf] util: Skip reading header_event file (Jiri Olsa) [1101039] - [perf] util: Make file/host_bigendian variable local (Jiri Olsa) [1101039] - [perf] util: Save long size of traced system (Jiri Olsa) [1101039] - [perf] util: Save page size in a trace file to pevent (Jiri Olsa) [1101039] - [perf] traceevent: Port kbuffer parser routines (Jiri Olsa) [1101039] - [perf] traceevent: Add page_size field to pevent (Jiri Olsa) [1101039] - [perf] traceevent: Add trace_seq_reset() (Jiri Olsa) [1101039] - [perf] traceevent: Add const qualifier to string arguments (Jiri Olsa) [1101039] - [perf] traceevent: Get rid of unused gui target (Jiri Olsa) [1101039] - [perf] traceevent: Remove unused install targets (Jiri Olsa) [1101039] - [perf] events: Demystify memory allocations (Jiri Olsa) [1101039] - [perf] tests: Make terms a stack variable in test_term (Jiri Olsa) [1101039] - [perf] tools: Don't free list head in parse_events__free_terms (Jiri Olsa) [1101039] - [perf] evlist: Fix use of uninitialized variable (Jiri Olsa) [1101039] - [perf] report: Fix perf_session__delete removal (Jiri Olsa) [1101039] - [perf] tools: Do not elide parent symbol column (Jiri Olsa) [1101039] - [perf] util: Use evsel->name to get tracepoint_paths (Jiri Olsa) [1101039] - [perf] util: Move debugfs/tracing helper functions to util.c (Jiri Olsa) [1101039] - [perf] tools: Remove callchain_cursor_reset call (Jiri Olsa) [1101039] - [perf] tools: Add methods for setting/retrieving priv element of thread struct (Jiri Olsa) [1101039] - [perf] tools: Use default include path notation for libtraceevent headers (Jiri Olsa) [1101039] - [perf] tests: Make TEST_ASSERT_VAL global (Jiri Olsa) [1101039] - [perf] tests: Omit end of the symbol check failure for test 1 (Jiri Olsa) [1101039] - [perf] tools: Remove cwd from perf_session struct (Jiri Olsa) [1101039] - [perf] top: Add --objdump option (Jiri Olsa) [1101039] - [perf] tools: Rename cpu_map__all() to cpu_map__empty() (Jiri Olsa) [1101039] - [perf] Remove the 'match' callback for auxiliary events processing (Jiri Olsa) [1101039] - [perf] Factor out auxiliary events notification (Jiri Olsa) [1101039] - [perf] Fix EXIT event notification (Jiri Olsa) [1101039] - [perf] events: Protect access via task_subsys_state_check() (Jiri Olsa) [1101039] - [perf] Clarify perf_cpu_context::active_pmu usage by renaming it to perf_cpu_context::unique_pmu (Jiri Olsa) [1101039] - [perf] Add a dummy software event to keep tracking (Jiri Olsa) [1101039] - [perf] tools: Add support for record transaction flags (Jiri Olsa) [829875] - [perf] record: Add abort_tx, no_tx, in_tx branch filter options to perf record -j (Jiri Olsa) [829875] - [perf] tools: Support sorting by in_tx or abort branch flags (Jiri Olsa) [829875] - [perf] stat: Add perf stat --transaction (Jiri Olsa) [829875] - [perf] tools: Fix sorting for 64bit entries (Jiri Olsa) [829875] - [perf] stat: Add support for --initial-delay option (Jiri Olsa) [829875] - [perf] evsel: Add support for enabling counters (Jiri Olsa) [829875] - [perf] evsel: Add PERF_SAMPLE_READ sample related processing (Jiri Olsa) [829875] - [perf] evlist: Add perf_evlist__id2sid method to get event ID related data (Jiri Olsa) [829875] - [perf] evlist: Fix event ID retrieval for group format read case (Jiri Olsa) [829875] - [perf] tools: Add support for parsing PERF_SAMPLE_READ sample type (Jiri Olsa) [829875] - [perf] evlist: Use PERF_EVENT_IOC_ID perf ioctl to read event id (Jiri Olsa) [829875] - [perf] tools: Move weight back to common sort keys (Jiri Olsa) [829875] - [perf] list: List kernel supplied event aliases (Jiri Olsa) [829875] - [perf] Fix UAPI export of PERF_EVENT_IOC_ID (Jiri Olsa) [829875] - [perf] Add PERF_EVENT_IOC_ID ioctl to return event ID (Jiri Olsa) [829875] - [perf] fix Haswell precise store data source encoding (Jiri Olsa) [829875] - [perf] x86: Suppress duplicated abort LBR records (Jiri Olsa) [829875] - [perf] x86: Add Haswell specific transaction flag reporting (Jiri Olsa) [829875] - [perf] Add generic transaction flags (Jiri Olsa) [829875] - [perf] make events stream always parsable (Jiri Olsa) [829875] - [perf] Update perf_event_type documentation (Jiri Olsa) [829875] - [perf] x86: Clean up EVENT_ATTR_STR() muck (Jiri Olsa) [829875] - [perf] x86: Clean-up/reduce PEBS code (Jiri Olsa) [829875] - [perf] x86: Clean up checkpoint-interrupt bits (Jiri Olsa) [829875] - [perf] x86: Add Haswell TSX event aliases (Jiri Olsa) [829875] - [perf] x86: Report TSX transaction abort cost as weight (Jiri Olsa) [829875] - [perf] x86: Avoid checkpointed counters causing excessive TSX aborts (Jiri Olsa) [829875] - [perf] x86: Add Haswell ULT model number used in Macbook Air and other systems (Jiri Olsa) [829875] - [perf] x86: Support full width counting (Jiri Olsa) [829875] - [perf] x86: Add mem-loads/stores support for Haswell (Jiri Olsa) [829875] - [perf] x86: Support Haswell/v4 LBR format (Jiri Olsa) [829875] - [perf] x86: Move NMI clearing to end of PMI handler (Jiri Olsa) [829875] - [perf] x86: Add Haswell PEBS support (Jiri Olsa) [829875] - [perf] x86: Add simple Haswell PMU support (Jiri Olsa) [829875] - [perf] x86: Add Haswell PEBS record support (Jiri Olsa) [829875] - [perf] x86: Don't assume there can be only 4 PEBS events (Jiri Olsa) [829875] - [perf] x86: Fix uninitialized pt_regs in intel_pmu_drain_bts_buffer() (Jiri Olsa) [829875] - [perf] x86: fix wrmsr_on_cpu() warning on suspend/resume (Jiri Olsa) [829875] - [perf] x86: fix kernel crash with PEBS/BTS after suspend/resume (Jiri Olsa) [829875] - [perf] x86: Move Intel specific code to intel_pmu_init() (Jiri Olsa) [829875] - [perf] x86: Rename Intel specific macros (Jiri Olsa) [829875] - [perf] Export perf_assign_events() (Jiri Olsa) [829875]- [scsi] aacraid: kdump fix (Rich Bono) [1054925] - [scsi] aacraid: prevent invalid pointer dereference (Rich Bono) [1054925] - [scsi] aacraid: avoid parsing names as kthread_run() format strings (Rich Bono) [1054925] - [scsi] aacraid: suppress two GCC warnings (Rich Bono) [1054925] - [scsi] aacraid: SCSI dma mapping failure case handling (Rich Bono) [1054925] - [scsi] aacraid: fix mem leak in aac_send_raw_srb() (Rich Bono) [1054925] - [scsi] megaraid_sas: Version and Changelog update (Tomas Henzl) [1059073] - [scsi] megaraid_sas: Add Dell PowerEdge VRTX SR-IOV VF support (Tomas Henzl) [1059073] - [scsi] megaraid_sas: Return leaked MPT frames to MPT frame pool (Tomas Henzl) [1059073] - [scsi] megaraid_sas: Fix megasas_ioc_init_fusion (Tomas Henzl) [1059073] - [scsi] megaraid_sas: Load correct raid context timeout (Tomas Henzl) [1059073] - [scsi] megaraid_sas: Performance boost fixes (Tomas Henzl) [1059073] - [scsi] megaraid_sas: Set 32-bit DMA mask (Tomas Henzl) [1059073] - [scsi] megaraid_sas: Big endian code related fixes (Tomas Henzl) [1059073] - [scsi] megaraid_sas: Don't wait forever for non-IOCTL DCMDs (Tomas Henzl) [1059073] - [scsi] megaraid_sas: check return value for megasas_get_pd_list() (Tomas Henzl) [1059073] - [scsi] megaraid_sas_fusion: Return correct error value in megasas_get_ld_map_info() (Tomas Henzl) [1059073] - [scsi] megaraid_sas_fusion: correctly pass queue info pointer (Tomas Henzl) [1059073] - [scsi] megaraid: missing bounds check in mimd_to_kioc() (Tomas Henzl) [1059073] - [scsi] megaraid: Use resource_size_t for PCI resources, not long (Tomas Henzl) [1059073] - [scsi] megaraid_sas: fixes for few endianess issues (Tomas Henzl) [1059073] - [scsi] megaraid_sas: addded support for big endian architecture (Tomas Henzl) [1059073] - [scsi] megaraid_sas: fix a bug for 64 bit arches (Tomas Henzl) [1059073] - [scsi] megaraid_sas: fix memory leak if SGL has zero length entries (Tomas Henzl) [1059073] - [scsi] megaraid: minor cut and paste error fixed (Tomas Henzl) [1059073] - [scsi] megaraid_sas: release lock on error path (Tomas Henzl) [1059073] - [scsi] megaraid_sas: Use correct #define for MSI-X capability (Tomas Henzl) [1059073] - [scsi] megaraid_sas: combine kmalloc+memset into kzalloc (Tomas Henzl) [1059073] - [target] tcm_fc: Fix use-after-free of ft_tpg (Andy Grover) [1084646] - [scsi] Set the minimum valid value of 'eh_deadline' as 0 (Ewan Milne) [987789] - [scsi] Unlock accesses to eh_deadline (Ewan Milne) [987789] - [scsi] scsi_error: Escalate to LUN reset if abort fails (Ewan Milne) [987789] - [scsi] Adjust eh_deadline changes to match final upstream version (Ewan Milne) [987789] - [scsi] Generate uevents on certain unit attention codes (Ewan Milne) [741163] - [scsi] lpfc: Update lpfc version for 10.2.8020.0 driver release (Rob Evers) [1054369] - [scsi] lpfc: Fixed unused variable in lpfc_scsi_cmd_iocb_cmpl (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Update Copyright on changed files from 8.3.45 patches (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Update Copyright on changed files (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Fixed locking for scsi task management commands (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Convert runtime references to old xlane cfg param to fof cfg param (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Fix FW dump using sysfs (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Fix SLI4 s abort loop to process all FCP rings and under ring_lock (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Fixed kernel panic in lpfc_abort_handler (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Fix locking for postbufq when freeing (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Fix locking for lpfc_hba_down_post (Rob Evers) [1054369] - [scsi] lpfc 10.2.8000.0: Fix dynamic transitions of FirstBurst from on to off (Rob Evers) [1054369] - [scsi] lpfc 8.3.45: Fixed crash during driver unload (Rob Evers) [1054369] - [scsi] lpfc 8.3.45: Fixed driver error messages after firmware download (Rob Evers) [1054369] - [scsi] lpfc 8.3.45: Fixed missing initialization for task management IOCBs (Rob Evers) [1054369] - [scsi] lpfc 8.3.45: Fix sysfs buffer overrun in read of lpfc_fcp_cpu_map for 128 CPUs (Rob Evers) [1054369] - [scsi] lpfc 8.3.45: Incorporate changes to use reason in change_queue_depth function (Rob Evers) [1054369] - [scsi] lpfc 8.3.45: Incorporated support of a low-latency io path (Rob Evers) [1054369] - [scsi] lpfc 8.3.45: Added dport mailbox pass through support (Rob Evers) [1054369] - [scsi] lpfc 8.3.44: Fixed unassigned variable in ELS timeout message (Rob Evers) [1054369] - [scsi] lpfc 8.3.44: Fixed incorrect allocation of iDiags directories/files in debugfs (Rob Evers) [1054369] - [scsi] lpfc 8.3.44: Fix Crash in lpfc_els_timeout_handler (Rob Evers) [1054369] - [scsi] lpfc 8.3.44: Fixed stopped FCF discovery on failed FCF record read (Rob Evers) [1054369] - [scsi] lpfc 8.3.44: Fixed IO hang when in msi mode (Rob Evers) [1054369] - [scsi] lpfc: Fix wrong assignment in lpfc_debugfs.c (Rob Evers) [1054369] - [scsi] lpfc: Fix typo on NULL assignment (Rob Evers) [1054369] - [scsi] lpfc 8.3.43: Fixed not processing task management IOCB response status (Rob Evers) [1054369] - [scsi] lpfc 8.3.43: Fixed invalid Total_Data_Placed value received for els and ct command responses (Rob Evers) [1054369] - [scsi] lpfc 8.3.43: Fixed invalid fcp_rsp length fir FCP_ICMND (Rob Evers) [1054369] - [scsi] lpfc 8.3.43: Fixed invalid mailbox timeouts (Rob Evers) [1054369] - [scsi] lpfc 8.3.43: Fix crash after xri limit is reached (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fix driver's abort loop functionality to skip IOs already getting aborted (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fix WARN_ON when driver unloads (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Avoided making pci bar ioremap call during dual-chute WQ/RQ pci bar selection (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fixed driver iocbq structure's iocb_flag field running out of space (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fix crash on driver load due to cpu affinity logic (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fixed logging format of setting driver sysfs attributes hard to interpret (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fixed back to back RSCNs discovery failure (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fixed race condition between BSG I/O dispatch and timeout handling (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Back out data count, (residual fcfi_parm) fix for bad target (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fixed mailbox memory leak (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fix random errors using first burst (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fixed not able to log informational messages at early stage of driver init time (Rob Evers) [1054369] - [scsi] lpfc 8.3.42: Fixed using unsafe linked list macro for walking and deleting linked list (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Update copyrights for 8.3.41 modifications (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Fixed the format of some log message fields (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Add first burst support to driver (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Fixed not able to perform PCI function reset when board was not in online mode (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Fixed failure in setting SLI3 board mode (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Fixed SLI3 failing FCP write on check-condition no-sense with residual zero (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Fixed support for 128 byte WQEs (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Ensure driver properly zeros unused fields in SLI4 mailbox commands (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Fixed max value of lpfc_lun_queue_depth (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Fixed Receive Queue varied frame size handling (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Fix mailbox byteswap issue on PPC (Rob Evers) [1054369] - [scsi] lpfc 8.3.41: Fixed freeing of iocb when internal loopback times out (Rob Evers) [1054369] - [scsi] hpsa: version string change (Tomas Henzl) [1052272] - [scsi] hpsa: fix handling of hpsa_volume_offline return value (Tomas Henzl) [1052272] - [scsi] hpsa: return -ENOMEM not -1 on kzalloc failure in hpsa_get_device_id (Tomas Henzl) [1052272] - [scsi] hpsa: fix bad comparison of signed with unsigned in hpsa_update_scsi_devices (Tomas Henzl) [1052272] - [scsi] hpsa: do not ignore failure of sense controller parameters command (Tomas Henzl) [1052272] - [scsi] hpsa: fix memory leak in hpsa_hba_mode_enabled (Tomas Henzl) [1052272] - [scsi] hpsa: fix bad endif placement in RAID 5 mapper code (Tomas Henzl) [1052272] - [scsi] hpsa: Do not zero fields of ioaccel2 command structure twice (Tomas Henzl) [1052272] - [scsi] hpsa: Add hba mode to the hpsa driver (Tomas Henzl) [1052272] - [scsi] hpsa: remove unused struct request from CommandList (Tomas Henzl) [1052272] - [scsi] hpsa: increase the probability of a reported success after a device reset (Tomas Henzl) [1052272] - [scsi] hpsa: bring format-in-progress drives online when ready (Tomas Henzl) [1052272] - [scsi] hpsa: remove unused kthread.h header (Tomas Henzl) [1052272] - [scsi] hpsa: fixup MSI-X registration (Tomas Henzl) [1052272] - [scsi] hpsa: Add support for a few HP Storage controllers (Tomas Henzl) [1052272] - [scsi] hpsa: add HP/3PAR vendor id to pci_ids.h (Tomas Henzl) [1052272] - [scsi] hpsa: add sysfs debug switch for raid map debugging messages (Tomas Henzl) [1052272] - [scsi] hpsa: improve error messages for driver initiated commands (Tomas Henzl) [1052272] - [scsi] hpsa: only do device rescan for certain events (Tomas Henzl) [1052272] - [scsi] hpsa: when switching out of accel mode await only accel command completions (Tomas Henzl) [1052272] - [scsi] hpsa: add controller base data-at-rest encryption compatibility ioaccel2 (Tomas Henzl) [1052272] - [scsi] hpsa: update source file copyrights (Tomas Henzl) [1052272] - [scsi] hpsa: retry certain ioaccel error cases on the RAID path (Tomas Henzl) [1052272] - [scsi] hpsa: do not inquire for unsupported ioaccel status vpd page (Tomas Henzl) [1052272] - [scsi] hpsa: allow VPD page zero to be queried (Tomas Henzl) [1052272] - [scsi] hpsa: rescan devices on ioaccel2 error (Tomas Henzl) [1052272] - [scsi] hpsa: allow user to disable accelerated i/o path (Tomas Henzl) [1052272] - [scsi] hpsa: complete the ioaccel raidmap code (Tomas Henzl) [1052272] - [scsi] hpsa: make device update copy the raid map also (Tomas Henzl) [1052272] - [scsi] hpsa: add task management for ioaccel mode 2 (Tomas Henzl) [1052272] - [scsi] hpsa: teach hpsa_device_reset to do either target or lun reset (Tomas Henzl) [1052272] - [scsi] hpsa: get ioaccel mode 2 i/o working (Tomas Henzl) [1052272] - [scsi] hpsa: fix NULL dereference in hpsa_put_ctlr_into_performant_mode() (Tomas Henzl) [1052272] - [scsi] hpsa: initialize controller to perform io accelerator mode 2 (Tomas Henzl) [1052272] - [scsi] hpsa: get physical device handles for io accel mode 2 as well as mode 1 (Tomas Henzl) [1052272] - [scsi] hpsa: do ioaccel mode 2 resource allocations (Tomas Henzl) [1052272] - [scsi] hpsa: Acknowledge controller events in ioaccell mode 2 as well as mode 1 (Tomas Henzl) [1052272] - [scsi] hpsa: add ioaccel mode 2 structure definitions (Tomas Henzl) [1052272] - [scsi] hpsa: complain if physical or logical aborts are not supported (Tomas Henzl) [1052272] - [scsi] hpsa: add hp_ssd_smart_path_enabled sysfs attribute (Tomas Henzl) [1052272] - [scsi] hpsa: do not rescan controllers known to be locked up (Tomas Henzl) [1052272] - [scsi] hpsa: poll controller to detect device change event (Tomas Henzl) [1052272] - [scsi] hpsa: update raid offload status on device rescan (Tomas Henzl) [1052272] - [scsi] hpsa: add ioaccell mode 1 RAID offload support (Tomas Henzl) [1052272] - [scsi] hpsa: fix task management for mode-1 ioaccell path (Tomas Henzl) [1052272] - [scsi] hpsa: only allow REQ_TYPE_FS to use fast path (Tomas Henzl) [1052272] - [scsi] hpsa: add support for 'fastpath' i/o (Tomas Henzl) [1052272] - [scsi] hpsa: mark last scatter gather element as the last (Tomas Henzl) [1052272] - [scsi] hpsa: use extended report luns command for HP SSD SmartPath (Tomas Henzl) [1052272] - [scsi] hpsa: allow SCSI mid layer to handle unit attention (Tomas Henzl) [1052272] - [scsi] hpsa: do not require board "not ready" status after hard reset (Tomas Henzl) [1052272] - [scsi] hpsa: enable unit attention reporting (Tomas Henzl) [1052272] - [scsi] hpsa: rename scsi prefetch field (Tomas Henzl) [1052272] - [scsi] hpsa: use workqueue instead of kernel thread for lockup detection (Tomas Henzl) [1052272] - [scsi] hpsa: remove P822se PCI ID (Tomas Henzl) [1052272] - [scsi] hpsa: prevent stalled i/o (Tomas Henzl) [1052272] - [scsi] hpsa: cap CCISS_PASSTHRU at 20 concurrent commands (Tomas Henzl) [1052272] - [scsi] hpsa: add MSA 2040 to list of external target devices (Tomas Henzl) [1052272] - [scsi] hpsa: fix memory leak in CCISS_BIG_PASSTHRU ioctl (Tomas Henzl) [1052272] - [scsi] hpsa: remove unneeded include of seq_file.h (Tomas Henzl) [1052272] - [scsi] hpsa: add 5 second delay after doorbell reset (Tomas Henzl) [1052272] - [scsi] hpsa: do not attempt to flush the cache on locked up controllers (Tomas Henzl) [1052272] - [scsi] hpsa: return 0 from driver probe function on success, not 1 (Tomas Henzl) [1052272] - [scsi] hpsa: do not discard scsi status on aborted commands (Tomas Henzl) [1052272] - [scsi] hpsa: fix warning with smp_processor_id() in preemptible (Tomas Henzl) [1052272] - [scsi] hpsa: check for dma_mapping_error in hpsa_passthru ioctls (Tomas Henzl) [1052272] - [scsi] hpsa: reorganize error handling in hpsa_passthru_ioctl (Tomas Henzl) [1052272] - [scsi] hpsa: check for dma_mapping_error in hpsa_map_sg_chain_block (Tomas Henzl) [1052272] - [scsi] hpsa: Check for dma_mapping_error for all code paths using fill_cmd (Tomas Henzl) [1052272] - [scsi] hpsa: Check for dma_mapping_error in hpsa_map_one (Tomas Henzl) [1052272] - [scsi] bfa: Driver version upgrade to 3.2.23.0 (Chad Dupuis) [1054461] - [scsi] bfa: Fix smatch warnings (Chad Dupuis) [1054461] - [scsi] bfa: change FC_ELS_TOV to 20sec (Chad Dupuis) [1054461] - [scsi] bfa: Observed auto D-port mode instead of manual (Chad Dupuis) [1054461] - [scsi] bfa: Fix for bcu or hcm faa query hang (Chad Dupuis) [1054461] - [scsi] bfa: LUN discovery issue in direct attach mode (Chad Dupuis) [1054461] - [scsi] bfa: Register port with SCSI even on port init failure (Chad Dupuis) [1054461] - [scsi] bfa: Firmware patch simplification (Chad Dupuis) [1054461]- [scsi] Ensure medium access timeout counter resets (David Jeffery) [1036884] - [scsi] Fix error handling when no ULD is attached (David Jeffery) [1036884] - [scsi] Handle disk devices which can not process medium access commands (David Jeffery) [1036884] - [hv] vmbus: Negotiate version 3.0 when running on ws2012r2 hosts (Jason Wang) [1071723] - [hv] vmbus: Don't timeout during the initial connection with host (Jason Wang) [1071723] - [hv] vmbus: Specify the target CPU that should receive notification (Jason Wang) [1071723] - [hv] make "monitor_pages" a "real" pointer array (Jason Wang) [1071723] - [hv] vmbus: Fix a bug in channel rescind code (Jason Wang) [1071723] - [hv] Fix wrong check for synic_event_page (Jason Wang) [1071723] - [hv] vmbus: fix vmbus_recvpacket_raw() return code (Jason Wang) [1071723] - [hv] vmbus: Terminate vmbus version negotiation on timeout (Jason Wang) [1071723] - [hv] vmbus: Do not attempt to negoatiate a new version prematurely (Jason Wang) [1071723] - [hv] vmbus: Fix a bug in the handling of channel offers (Jason Wang) [1071723] - [x86] pci: Clean up and mark early_root_info_init() as deprecated (Myron Stowe) [1040440] - [x86] pci: Stop enabling ECS for AMD CPUs after Fam16h (Myron Stowe) [1040440] - [x86] pci: Work around AMD Fam15h BIOSes that fail to provide _PXM (Myron Stowe) [1040440] - [x86] pci: Warn if we have to "guess" host bridge node information (Myron Stowe) [1040440] - [x86] acpi: Use __weak, not the gcc-specific version (Myron Stowe) [1040440] - [x86] acpi: Make __acpi_map_pxm_to_node(), acpi_get_pxm() static (Myron Stowe) [1040440] - [x86] acpi: Simplify acpi_get_node() style (Myron Stowe) [1040440] - [x86] acpi: Fix acpi_get_node() prototype (Myron Stowe) [1040440] - [x86] pci: Remove acpi_get_pxm() usage (Myron Stowe) [1040440] - [x86] pci: Use NUMA_NO_NODE, not -1, for unknown node (Myron Stowe) [1040440] - [x86] pci: Remove unnecessary &pci_root_infos list_empty() check (Myron Stowe) [1040440] - [x86] pci: Remove mp_bus_to_node(), set_mp_bus_to_node(), get_mp_bus_to_node() (Myron Stowe) [1040440] - [x86] pci: Use x86_pci_root_bus_node() instead of get_mp_bus_to_node() (Myron Stowe) [1040440] - [x86] pci: Add x86_pci_root_bus_node() to look up NUMA node from PCI bus (Myron Stowe) [1040440] - [x86] pci: Drop return value of pcibios_scan_root() (Myron Stowe) [1040440] - [x86] pci: Merge pci_scan_bus_on_node() into pcibios_scan_root() (Myron Stowe) [1040440] - [x86] pci: Use pcibios_scan_root() instead of pci_scan_bus_on_node() (Myron Stowe) [1040440] - [x86] pci: Use pcibios_scan_root() instead of pci_scan_bus_with_sysdata() (Myron Stowe) [1040440] - [x86] pci: Drop pcibios_scan_root() check for bus already scanned (Myron Stowe) [1040440] - [x86] pci: Drop "__" prefix on __pci_enable_device_flags() (Myron Stowe) [1040440] - [x86] pci: Use "unsigned long" for __pci_enable_device_flags to match ioport.h (Myron Stowe) [1040440] - [x86] pci: Remove unused pci_root_bus (Myron Stowe) [1040440] - [x86] pci: put busn resource in pci_root_info for native host bridge drivers (Myron Stowe) [1040440] - [x86] pci: build amd_bus.o only when CONFIG_AMD_NB=y (Myron Stowe) [1040440] - [x86] pci: amd: factor out MMCONFIG discovery (Myron Stowe) [1040440] - [x86] pci: Kill misleading message about enablement of IO access to PCI ECS (Myron Stowe) [1040440] - [x86] Adjust section placement in AMD northbridge related code (Myron Stowe) [1040440] - [x86] Use PCI method for enabling AMD extended config space before MSR method (Myron Stowe) [1040440] - [x86] pnp: work around Dell 1536/1546 BIOS MMCONFIG bug that breaks USB (Myron Stowe) [1040440] - [fs] proc: Assure /proc/meminfo legacy backwards compatibility when adding new statistics (Rafael Aquini) [1032702] - [kvm] mmu: fix incorrect check of guest cr4 bits (Bandan Das) [1007164] - [kernel] Fix BUG() upon security_cred_alloc_blank() failure (Eric Paris) [717904]- [fs] nfs: Fix calls to drop_nlink() (Steve Dickson) [1093819] - [fs] xfs: fix directory readahead offset off-by-one (Eric Sandeen) [1093820] - [fs] btrfs: don't oops on mount failure due to unsupported features (Eric Sandeen) [889471] - [fs] gfs2: check NULL return value in gfs2_ok_to_move (Abhijith Das) [1060246] - [fs] gfs2: avoid locking while unfreezing fs (Benjamin Marzinski) [1056625] - [fs] nfsd: Change name of extended attribute containing junction (J. Bruce Fields) [1024034] - [fs] nfsd: Add a cache for fs_locations information (J. Bruce Fields) [1024034] - [fs] ext4: include journal blocks in df overhead calcs (Lukas Czerner) [1003476] - [fs] ext4: add mmp fs freeze protection (Eric Sandeen) [1012412] - [fs] ext4: MMP: kmmpd should use nodename from init_uts_ns.name, not sysname (Eric Sandeen) [1012412] - [fs] ext4: MMP: fix error message rate-limiting logic in kmmpd (Eric Sandeen) [1012412] - [fs] ext4: Fix comparison endianness problem in MMP initialization (Eric Sandeen) [1012412] - [fs] ext4: Fix endianness bug when reading the MMP block (Eric Sandeen) [1012412] - [fs] ext4: add support for multiple mount protection (Eric Sandeen) [1012412] - [block] mtip32xx: mtip_async_complete() bug fixes (David Milburn) [1059099] - [block] mtip32xx: Unmap the DMA segments before completing the IO request (David Milburn) [1059099] - [block] mtip32xx: Set queue bounce limit (David Milburn) [1059099] - [block] mtip32xx: Correctly handle security locked condition (David Milburn) [1059099] - [block] mtip32xx: Make SGL container per-command to eliminate high order dma allocation (David Milburn) [1059099] - [block] mtip32xx: Correctly handle bio->bi_idx != 0 conditions (David Milburn) [1059099] - [block] mtip32xx: Fix NULL pointer dereference during module unload (David Milburn) [1059099] - [block] mtip32xx: Add SRSI support (David Milburn) [980257] - [netdrv] forcedeth: run loopback test only on chipsets that support it (Ivan Vecera) [1030782] - [scsi] libfc: don't exch_done() on invalid sequence ptr (Mateusz Guzik) [1065162] - [security] selinux: fix selinuxfs policy file on big endian systems (Eric Paris) [739866] - [drm] nouveau: fix nasty bug which can clobber SOR0's clock setup (Ben Skeggs) [1095796] - [s390] crypto: fix aes, des ctr mode concurrency finding (Hendrik Brueckner) [1096328] - [s390] add support to start the kernel in 64 bit mode (Hendrik Brueckner) [1053826]- [i2c] i2c-ismt: support I2C_SMBUS_I2C_BLOCK_DATA transaction type (Neil Horman) [1030646] - [kernel] kthread_worker: reimplement flush_kthread_work() to allow freeing the work item being executed (David Milburn) [1091083] - [kernel] kthread_worker: reorganize to prepare for flush_kthread_work() reimplementation (David Milburn) [1091083] - [s390] cio: fix unlocked access of global bitmap (Hendrik Brueckner) [1094381] - [s390] css: stop stsch loop after cc 3 (Hendrik Brueckner) [1094381] - [x86] intel_pstate: Use del_timer_sync in intel_pstate_cpu_stop (Prarit Bhargava) [1038318] - [x86] intel_pstate: Set core to min P state during core offline (Prarit Bhargava) [1038318] - [x86] intel_pstate: fix pid_reset to use fixed point values (Prarit Bhargava) [1038318] - [x86] intel_pstate: remove unneeded sample buffers (Prarit Bhargava) [1038318] - [x86] intel_pstate: Change busy calculation to use fixed point math (Prarit Bhargava) [1038318] - [x86] intel_pstate: Add support for Baytrail turbo P states (Prarit Bhargava) [1038318] - [x86] intel_pstate: Use LFM bus ratio as min ratio/P state (Prarit Bhargava) [1038318] - [x86] intel_pstate: Remove energy reporting from pstate_sample tracepoint (Prarit Bhargava) [1038318] - [x86] intel_pstate: Take core C0 time into account for core busy calculation (Prarit Bhargava) [1038318] - [x86] intel_pstate: Add trace point to report internal state (Prarit Bhargava) [1038318] - [x86] intel_pstate: Add X86_FEATURE_APERFMPERF to cpu match parameters (Prarit Bhargava) [1038318] - [x86] intel_pstate: Fail initialization if P-state information is missing (Prarit Bhargava) [1038318] - [x86] intel_pstate: Remove periodic P state boost (Prarit Bhargava) [1038318] - [x86] intel_pstate: Add setting voltage value for baytrail P states (Prarit Bhargava) [1038318] - [x86] intel_pstate: skip the driver if ACPI has power mgmt option (Prarit Bhargava) [1038318] - [x86] intel_pstate: Add static declarations to internal functions (Prarit Bhargava) [1038318] - [x86] intel_pstate: Add Baytrail support (Prarit Bhargava) [1038318] - [x86] intel_pstate: Refactor driver to support CPUs with different MSR layouts (Prarit Bhargava) [1038318] - [x86] intel_pstate: Correct calculation of min pstate value (Prarit Bhargava) [1038318] - [x86] intel_pstate: Improve accuracy by not truncating until final result (Prarit Bhargava) [1038318] - [x86] intel_pstate: Fix type mismatch warning (Prarit Bhargava) [1038318] - [x86] intel_pstate: Fix max_perf_pct on resume (Prarit Bhargava) [1038318] - [x86] cpufreq: add new routine cpufreq_verify_within_cpu_limits() (Prarit Bhargava) [1038318] - [x86] intel_pstate: fix no_turbo (Prarit Bhargava) [1038318] - [x86] intel_pstate: Add Haswell CPU models (Prarit Bhargava) [1038318] - [x86] intel_pstate: Change to scale off of max P-state (Prarit Bhargava) [1038318] - [x86] intel_pstate: Add additional supported CPU ID (Prarit Bhargava) [1038318] - [x86] intel_pstate: use vzalloc() instead of vmalloc()/memset(0) (Prarit Bhargava) [1038318] - [x86] intel_pstate: Remove idle mode PID (Prarit Bhargava) [1038318] - [x86] intel_pstate: use lowest requested max performance (Prarit Bhargava) [1038318] - [x86] intel_pstate: fix ffmpeg regression (Prarit Bhargava) [1038318] - [x86] intel_pstate: remove idle time and duration from sample and calculations (Prarit Bhargava) [1038318] - [x86] intel_pstate: Optimize intel_pstate_set_policy (Prarit Bhargava) [1038318] - [x86] msr: add 64bit _on_cpu access functions (Prarit Bhargava) [1038318] - [net] net: sctp: remove NULL check in sctp_assoc_update_retran_path (Daniel Borkmann) [1040897] - [net] sctp: rework multihoming retransmission path selection to rfc4960 (Daniel Borkmann) [1040897] - [net] sctp: retran_path not set properly after transports recovering (Daniel Borkmann) [1040897] - [net] sctp: test if association is dead in sctp_wake_up_waiters (Daniel Borkmann) [1082453] - [net] sctp: wake up all assocs if sndbuf policy is per socket (Daniel Borkmann) [1082453] - [kernel] list: introduce list_next_entry() and list_prev_entry() (Daniel Borkmann) [1082453] - [net] netdevice: add struct net_device_ops_ext (Michal Schmidt) [1029869] - [net] netpoll: netpoll_poll_dev() should access dev->flags (Florian Westphal) [1095252] - [net] busy_poll: backport missed snmp mib item rename (Jiri Pirko) [1093806] - [net] ip_tunnel: Set network header properly for IP_ECN_decapsulate() (Jiri Pirko) [1094418] - [net] ptp: validate the requested frequency adjustment (Jiri Benc) [1092968] - [net] bridge: fix race with topology change timer (Jiri Benc) [1058517] - [net] bridge: avoid OOPS if root port not found (Jiri Benc) [1058517]- [security] selinux: put the mmap() DAC controls before the MAC controls (Paul Moore) [1070859] - [serial] bring DTR up after speed change from B0 (Aristeu Rozanski) [991667] - [mm] compaction: acquire the zone->lock as late as possible (Jerome Marchand) [975902] - [mm] compaction: acquire the zone->lru_lock as late as possible (Jerome Marchand) [975902] - [mm] swap: do not skip lowest_bit in scan_swap_map() scan loop (Rafael Aquini) [1060886] - [mm] swap: fix shmem swapping when more than 8 areas (Rafael Aquini) [1060886] - [mm] swap: fix swapon size off-by-one (Rafael Aquini) [1060886] - [x86] mm: Add missing TLB page invalidation for hugetlb_cow() (Larry Woodman) [1097917] - [char] n_tty: Lock access to tty->pgrp for POSIX job control (Prarit Bhargava) [1098982] - [kernel] resource: correct the comment of allocate_resource() (Myron Stowe) [744239] - [kernel] resource: move EXPORT_SYMBOL right after definition (Myron Stowe) [744239] - [kernel] resource: fix wrong resource window calculation (Myron Stowe) [744239] - [kernel] resource: Add lookup_resource() (Myron Stowe) [744239] - [kernel] resource: handle reinsertion of an already-inserted resource (Myron Stowe) [744239] - [pm] intel_powerclamp: off by one in start_power_clamp() (Steve Best) [1036301] - [pm] Introduce Intel PowerClamp Driver (Steve Best) [1036301] - [s390] zcrypt: remove zcrypt kmsg documentation again (Hendrik Brueckner) [1053830] - [s390] zcrypt: add support for EP11 coprocessor cards (Hendrik Brueckner) [1053830] - [s390] crypto: fix des and des3_ede ctr concurrency issue (Hendrik Brueckner) [1065404] - [s390] crypto: fix des and des3_ede cbc concurrency issue (Hendrik Brueckner) [1065398] - [watchdog] hpwdt: patch to display informative string (Nigel Croxon) [1053685] - [netdrv] tg3: Poll cpmu link state on APE + ASF enabled devices (Ivan Vecera) [1057283] - [netdrv] virtio-net: make all RX paths handle errors consistently (Jason Wang) [1032458] - [netdrv] virtio-net: fix error handling for mergeable buffers (Jason Wang) [1032458] - [netdrv] bonding: use the correct ether type for alb (Veaceslav Falico) [1027480] - [netdrv] ether: add loopback type ETH_P_LOOPBACK (Veaceslav Falico) [1027480] - [kernel] futex: Forbid uaddr == uaddr2 in futex_wait_requeue_pi() (Mateusz Guzik) [1097760] {CVE-2012-6647} - [libata] ahci: accommodate tag ordered controller (David Milburn) [1083748] - [net] mac80211: crash dues to AP powersave TX vs. wakeup race (Jacob Tanenbaum) [1083532] {CVE-2014-2706} - [netdrv] ath9k: tid->sched race in ath_tx_aggr_sleep() (Jacob Tanenbaum) [1083250] {CVE-2014-2672}- [perf] kvm: Fix kvm report without guestmount (Jiri Olsa) [1038418] - [perf] script: Fix broken include in Context.xs (Jiri Olsa) [1096519] - [perf] tools: Fix -ldw/-lelf link test when static linking (Jiri Olsa) [1096519] - [perf] tools: Revert regression in configuration of Python support (Jiri Olsa) [1096519] - [perf] tools: Fix perf version generation (Jiri Olsa) [1096519] - [perf] stat: Fix per-socket output bug for uncore events (Jiri Olsa) [1096519] - [perf] symbols: Fix vdso list searching (Jiri Olsa) [1096519] - [perf] evsel: Fix missing increment in sample parsing (Jiri Olsa) [1096519] - [perf] tools: Update symbol_conf.nr_events when processing attribute events (Jiri Olsa) [1096519] - [perf] tools: Fix new_term() missing free on error path (Jiri Olsa) [1096519] - [perf] tools: Fix parse_events_terms() segfault on error path (Jiri Olsa) [1096519] - [perf] evsel: Fix count parameter to read call in event_format__new (Jiri Olsa) [1096519] - [perf] tools: Fix -x/--exclude-other option for report command (Jiri Olsa) [1096519] - [perf] evlist: Enhance perf_evlist__start_workload() (Jiri Olsa) [1096519] - [perf] record: Remove -f/--force option (Jiri Olsa) [1096519] - [perf] record: Remove -A/--append option (Jiri Olsa) [1096519] - [perf] stat: Avoid sending SIGTERM to random processes (Jiri Olsa) [1096519] - [perf] lib: Fix for cross build (Jiri Olsa) [1096519] - [perf] tools: Include termios.h explicitly (Jiri Olsa) [1096519] - [perf] tools: Fix build errors with O and DESTDIR make vars set (Jiri Olsa) [1096519] - [perf] tools: Fix output directory of Documentation/ (Jiri Olsa) [1096519] - [perf] tools: Get only verbose output with V=1 (Jiri Olsa) [1096519] - [perf] tools: Add missing liblk.a dependency for python/perf.so (Jiri Olsa) [1096519] - [perf] tools: Remove '?=' Makefile STRIP assignment (Jiri Olsa) [1096519] - [perf] tools: Replace multiple line assignment with multiple statements (Jiri Olsa) [1096519] - [perf] tools: Replace tabs with spaces for all non-commands statements (Jiri Olsa) [1096519] - [perf] tools: Add NO_BIONIC variable to confiure bionic setup (Jiri Olsa) [1096519] - [perf] tools: Switch to full path C include directories (Jiri Olsa) [1096519] - [perf] tools: Merge all *LDFLAGS* make variable into LDFLAGS (Jiri Olsa) [1096519] - [perf] tools: Merge all *CFLAGS* make variable into CFLAGS (Jiri Olsa) [1096519] - [perf] evlist: Reset SIGTERM handler in workload child process (Jiri Olsa) [1096519] - [perf] lib: Respect CROSS_COMPILE (Jiri Olsa) [1096519] - [perf] tools: Remove cwdlen from struct perf_session (Jiri Olsa) [1096519] - [perf] tools: Remove frozen from perf_header struct (Jiri Olsa) [1096519] - [perf] tests: Fix exclude_guest|exclude_host checking for attr tests (Jiri Olsa) [1096519] - [perf] tests: Fix attr test for record -d option (Jiri Olsa) [1096519] - [perf] tools: Final touches for CHK config move (Jiri Olsa) [1096519] - [perf] tools: Move paths config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move libnuma check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move stdlib check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move libbfd check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move libpython check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move libperl check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move gtk2 check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move slang check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move libaudit check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move libunwind check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move libdw check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move libelf check config into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move compiler and linker flags check into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move programs check into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Move arch check into config/Makefile (Jiri Olsa) [1096519] - [perf] tools: Add automated make test suite (Jiri Olsa) [1096519] - [perf] tools: Save parent pid in thread struct (Jiri Olsa) [1096519] - [perf] stats: Fix divide by 0 in variance (Jiri Olsa) [1096519] - [perf] kvm: Handle realloc failures (Jiri Olsa) [1096519] - [perf] evsel: Fix printing of perf_event_paranoid message (Jiri Olsa) [1096519] - [perf] test: Fix typo (Jiri Olsa) [1096519] - [perf] hists: Rename hist_entry__add_pair arguments (Jiri Olsa) [1096519] - [perf] diff: Use internal rb tree for hists__precompute (Jiri Olsa) [1096519] - [perf] report: Add report.percent-limit config variable (Jiri Olsa) [1096519] - [perf] top: Add --percent-limit option (Jiri Olsa) [1096519] - [perf] report: Add --percent-limit option (Jiri Olsa) [1096519] - [perf] report: Don't bother locking when adding hist entries (Jiri Olsa) [1096519] - [perf] hists: Move locking to its call-sites (Jiri Olsa) [1096519] - [perf] top: Get rid of *_threaded() functions (Jiri Olsa) [1096519] - [perf] top: Fix percent output when no samples collected (Jiri Olsa) [1096519] - [perf] top: Fix -E option behavior (Jiri Olsa) [1096519] - [perf] record: handle death by SIGTERM (Jiri Olsa) [1096519] - [perf] tools: Handle JITed code in shared memory (Jiri Olsa) [1096519] - [perf] tools: Fix tab vs spaces issue in Makefile ifdef/endif (Jiri Olsa) [1096519] - [perf] hists browser: Use sort__has_sym (Jiri Olsa) [1096519] - [perf] top: Use sort__has_sym (Jiri Olsa) [1096519] - [perf] sort: Cleanup sort__has_sym setting (Jiri Olsa) [1096519] - [perf] sort: Reorder HISTC_SRCLINE index (Jiri Olsa) [1096519] - [perf] archive: Fix typo on Documentation (Jiri Olsa) [1096519] - [perf] sort: Consolidate sort_entry__setup_elide() (Jiri Olsa) [1096519] - [perf] sort: Separate out memory-specific sort keys (Jiri Olsa) [1096519] - [perf] sort: Factor out common code in sort_dimension__add() (Jiri Olsa) [1096519] - [perf] sort: Introduce sort__mode variable (Jiri Olsa) [1096519] - [perf] report: Fix alignment of symbol column when -v is given (Jiri Olsa) [1096519] - [perf] hists: Free unused mem info of a matched hist entry (Jiri Olsa) [1096519] - [perf] hists: Fix an invalid memory free on he->branch_info (Jiri Olsa) [1096519] - [perf] tools: Fix bug in isupper() and islower() (Jiri Olsa) [1096519] - [perf] tools: Re-implement debug print function for linking python/perf.so (Jiri Olsa) [1096519] - [perf] Generate EXIT event only once per task context (Jiri Olsa) [1096519] - [perf] Reset hwc->last_period on sw clock events (Jiri Olsa) [1096519]- [hid] core do not use hid-multitouch for Win 7 devices (Benjamin Tissoires) [1076662] - [hid] mt: disable reset_resume (Benjamin Tissoires) [1076662] - [hid] add multitouch backport from 3.14 (Benjamin Tissoires) [1076662] - [hid] do not init input reports for Win 8 multitouch devices (Benjamin Tissoires) [1076662] - [hid] detect Win 8 multitouch devices in core (Benjamin Tissoires) [1076662] - [hid] Use hid_parser for pre-scanning the report descriptors (Benjamin Tissoires) [1076662] - [hid] don't register unmapped input devices (Benjamin Tissoires) [1076662] - [hid] Extend the interface with idle requests (Benjamin Tissoires) [1076662] - [hid] Extend the interface with wait io request (Benjamin Tissoires) [1076662] - [hid] Extend the interface with report requests (Benjamin Tissoires) [1076662] - [hid] add hid_hw_open/close/power() handlers (Benjamin Tissoires) [1076662] - [hid] add "report" hook, called once the report has been parsed (Benjamin Tissoires) [1076662] - [hid] introduce helper for hid_driver boilerplate (Benjamin Tissoires) [1076662] - [hid] factorize hid_input allocation (Benjamin Tissoires) [1076662] - [hid] Fix unit exponent parsing again (Benjamin Tissoires) [1076662] - [hid] round return value of hidinput_calc_abs_res (Benjamin Tissoires) [1076662] - [hid] fix unit exponent parsing (Benjamin Tissoires) [1076662] - [hid] export hidinput_calc_abs_res (Benjamin Tissoires) [1076662] - [hid] Add digitizer tilt usage support (Benjamin Tissoires) [1076662] - [hid] length resolution should be reported units/mm (Benjamin Tissoires) [1076662] - [hid] add absolute axis resolution calculation (Benjamin Tissoires) [1076662] - [hid] add usage_index in struct hid_usage (Benjamin Tissoires) [1076662] - [hid] Allow more fields in the hid report (Benjamin Tissoires) [1076662] - [hid] Add an input configured notification callback (Benjamin Tissoires) [1076662] - [hid] hid-multitouch: Switch to device groups (Benjamin Tissoires) [1076662] - [hid] Create a generic device group (Benjamin Tissoires) [1076662] - [hid] Allow bus wildcard matching (Benjamin Tissoires) [1076662] - [hid] Scan the device for group info before adding it (Benjamin Tissoires) [1076662] - [hid] Add device group to modalias (Benjamin Tissoires) [1076662] - [hid] Handle driver-specific device descriptor in core (Benjamin Tissoires) [1076662] - [hid] Do not create input devices for feature reports (Benjamin Tissoires) [1076662] - [hid] set HID_MAX_FIELD at 128 (Benjamin Tissoires) [1076662] - [hid] add feature_mapping callback (Benjamin Tissoires) [1076662] - [hid] Add a hid quirk for input sync override (Benjamin Tissoires) [1076662] - [hid] Support for MosArt multitouch panel (Benjamin Tissoires) [1076662] - [hid] let hid-input accept digitizers (Benjamin Tissoires) [1076662] - [input] mt: do not apply filtering on emulated events (Benjamin Tissoires) [1076662] - [input] mt: add input_mt_is_used (Benjamin Tissoires) [1076662] - [input] mt: document new 'flags' argument of input_mt_init_slots() (Benjamin Tissoires) [1076662] - [input] fix sparse warning in multitouch code (Benjamin Tissoires) [1076662] - [input] mt: Get slot by key (Benjamin Tissoires) [1076662] - [input] mt: Add in-kernel tracking (Benjamin Tissoires) [1076662] - [input] mt: Handle frame synchronization in core (Benjamin Tissoires) [1076662] - [input] mt: Add flags to input_mt_init_slots() (Benjamin Tissoires) [1076662] - [input] Break out MT data (Benjamin Tissoires) [1076662] - [input] mt: fix null pointer warning (Benjamin Tissoires) [1076662] - [input] Use accessor for MT values (Benjamin Tissoires) [1076662] - [input] mt: Include win8 support (Benjamin Tissoires) [1076662] - [input] add BTN_TOOL_QUINTTAP for reporting 5 fingers on touchpad (Benjamin Tissoires) [1076662] - [input] properly assign return value of clamp() macro (Benjamin Tissoires) [1076662] - [input] Improve the events-per-packet estimate (Benjamin Tissoires) [1076662] - [input] estimate number of events per packet (Benjamin Tissoires) [1076662] - [input] kabi fixes after addition of hint_events_per_packet field (Benjamin Tissoires) [1076662] - [input] evdev: use driver hint to compute size of event buffer (Benjamin Tissoires) [1076662] - [input] evdev: convert to dynamic event buffer (Benjamin Tissoires) [1076662] - [input] kabi fixes after addition of propbit field (Benjamin Tissoires) [1076662] - [input] introduce device properties (Benjamin Tissoires) [1076662]- [scsi] libsas: introduce scmd_dbg() to quiet false positive "timeout" messages (David Milburn) [1074955] - [md] raid5: fix a race of stripe count check (Jes Sorensen) [1030619] - [md] raid5: get_active_stripe avoids device_lock (Jes Sorensen) [1030619] - [md] raid5: make_request does less prepare wait (Jes Sorensen) [1030619] - [md] avoid oops on unload if some process is in poll or select (Jes Sorensen) [1030619] - [md] bitmap: don't abuse i_writecount for bitmap files (Jes Sorensen) [1030619] - [md] raid5: Fix CPU hotplug callback registration (Jes Sorensen) [1030619] - [md] raid1: restore ability for check and repair to fix read errors (Jes Sorensen) [1030619] - [md] raid5: close recently introduced race in stripe_head management (Jes Sorensen) [1030619] - [md] raid5: fix long-standing problem with bitmap handling on write failure (Jes Sorensen) [1030619] - [md] check command validity early in md_ioctl() (Jes Sorensen) [1030619] - [md] ensure metadata is writen after raid level change (Jes Sorensen) [1030619] - [md] raid10: avoid fullsync when not necessary (Jes Sorensen) [1030619] - [md] allow a partially recovered device to be hot-added to an array (Jes Sorensen) [1030619] - [md] Change handling of save_raid_disk and metadata update during recovery (Jes Sorensen) [1030619] - [md] fix problem when adding device to read-only array with bitmap (Jes Sorensen) [1030619] - [md] raid10: fix bug when raid10 recovery fails to recover a block (Jes Sorensen) [1030619] - [md] raid5: fix a recently broken BUG_ON() (Jes Sorensen) [1030619] - [md] raid1: fix request counting bug in new 'barrier' code (Jes Sorensen) [1030619] - [md] raid10: fix two bugs in handling of known-bad-blocks (Jes Sorensen) [1030619] - [md] raid5: Fix possible confusion when multiple write errors occur (Jes Sorensen) [1030619] - [md] raid5: fix newly-broken locking in get_active_stripe (Jes Sorensen) [1030619] - [md] test mddev->flags more safely in md_check_recovery (Jes Sorensen) [1030619] - [md] raid5: fix new memory-reference bug in alloc_thread_groups (Jes Sorensen) [1030619] - [md] raid5: Use conf->device_lock protect changing of multi-thread resources (Jes Sorensen) [1030619] - [md] raid5: Before freeing old multi-thread worker, it should flush them (Jes Sorensen) [1030619] - [md] raid5: For stripe with R5_ReadNoMerge, we replace REQ_FLUSH with REQ_NOMERGE (Jes Sorensen) [1030619] - [md] raid1: Rewrite the implementation of iobarrier (Jes Sorensen) [1030619] - [md] raid1: Add some macros to make code clearly (Jes Sorensen) [1030619] - [md] raid1: Replace raise_barrier/lower_barrier with freeze_array/unfreeze_array when reconfiguring the array (Jes Sorensen) [1030619] - [md] raid1: Add a field array_frozen to indicate whether raid in freeze state (Jes Sorensen) [1030619] - [md] Convert use of typedef ctl_table to struct ctl_table (Jes Sorensen) [1030619] - [md] raid5: avoid deadlock when raid5 array has unack badblocks during md_stop_writes (Jes Sorensen) [1030619] - [md] use MD_RECOVERY_INTR instead of kthread_should_stop in resync thread (Jes Sorensen) [1030619] - [md] fix some places where mddev_lock return value is not checked (Jes Sorensen) [1030619] - [md] raid5: Retry R5_ReadNoMerge flag when hit a read error (Jes Sorensen) [1030619] - [md] raid5: relieve lock contention in get_active_stripe() (Jes Sorensen) [1030619] - [md] llists: move llist_reverse_order from raid5 to llist.c (Jes Sorensen) [1030619] - [md] raid5: relieve lock contention in get_active_stripe() (Jes Sorensen) [1030619] - [md] raid5: add proper locking to error path of raid5_start_reshape (Jes Sorensen) [1030619] - [md] raid5: Use slow_path to release stripe when mddev->thread is null (Jes Sorensen) [1030619] - [md] avoid deadlock when md_set_badblocks (Jes Sorensen) [1030619] - [md] raid5: only wakeup necessary threads (Jes Sorensen) [1030619] - [md] raid5: flush out all pending requests before proceeding with reshape (Jes Sorensen) [1030619] - [md] raid5: use seqcount to protect access to shape in make_request (Jes Sorensen) [1030619] - [md] raid5: sysfs entry to control worker thread number (Jes Sorensen) [1030619] - [md] raid5: offload stripe handle to workqueue (Jes Sorensen) [1030619] - [md] raid5: fix stripe release order (Jes Sorensen) [1030619] - [md] raid5: make release_stripe lockless (Jes Sorensen) [1030619] - [md] Don't test all of mddev->flags at once (Jes Sorensen) [1030619] - [md] Fix apparent cut-and-paste error in super_90_validate (Jes Sorensen) [1030619] - [md] fix safe_mode buglet (Jes Sorensen) [1030619] - [md] don't call md_allow_write in get_bitmap_file (Jes Sorensen) [1030619] - [md] raid1: fix bio handling problems in process_checks() (Jes Sorensen) [1030619] - [kernel] wait: add wait_event_lock_irq() interface (Jes Sorensen) [1030619] - [kernel] wait: add wait_event_cmd() (Jes Sorensen) [1030619] - [kernel] wait: Make the __wait_event*() interface more friendly (Jes Sorensen) [1030619] - [kernel] wait: Introduce ___wait_event() (Jes Sorensen) [1030619] - [md] Introduce BIO_NOMERGE flag (Jes Sorensen) [1030619] - [mm] vmscan: change type of vm_total_pages to unsigned long (George Beshers) [1086943] - [fs] nfsd: change type of max_delegations, nfsd_drc_max_mem and nfsd_drc_mem_used (George Beshers) [1086943] - [fs] change type of max_buffer_heads to unsigned long (George Beshers) [1086943] - [mm] fix return type for functions nr_free_*_pages (George Beshers) [1086943]- [char] n_tty: Fix n_tty_write crash when echoing in raw mode (Aristeu Rozanski) [1094237] {CVE-2014-0196} - [fs] nfs: Ensure that test_stateid and free_stateid use correct credentials (Steve Dickson) [1079075] - [fs] cifs: fix offset handling in cifs_iovec_write (Sachin Prabhu) [1044438] - [fs] sunrpc: Fix a livelock problem in the xprt->backlog queue (Steve Dickson) [1075170] - [fs] sunrpc: Fix an RCU dereference in xprt_reserve (Steve Dickson) [1075170] - [fs] sunrpc: Fix infinite loop in RPC state machine (Steve Dickson) [1075170] - [fs] sunrpc: Fix races in xs_nospace() (Steve Dickson) [1075170] - [fs] cifs: set MAY_SIGN when sec=krb5 (Sachin Prabhu) [976331] - [fs] cifs: stop trying to use virtual circuits (Sachin Prabhu) [1026346] - [fs] autofs: fix symlinks aren't checked for expiry (Ian Kent) [1035630] - [fs] ext4: force ro mount if ext4_setup_super() fails (Eric Sandeen) [1093471] - [fs] gfs2: Fixing double brelse'ing bh allocated in gfs2_meta_read when EIO occurs (Robert S Peterson) [892710] - [fs] gfs2: Refresh quota after setting through quotactl (Abhijith Das) [1077463] - [fs] nfs: pass string length to pr_notice message about readdir loops (Jeff Layton) [1040764] - [fs] svcrdma: fix offset calculation for non-page aligned sge entries (Jeff Layton) [857020] - [fs] cifs: fix bad error handling in crypto code (Sachin Prabhu) [872311] - [fs] cifs: Limit allocation of crypto mechanisms to dialect which requires (Sachin Prabhu) [872311] - [fs] nfs: Fail the truncate() if the lock/open stateid is invalid (Steve Dickson) [1075123] - [fs] nfs: Servers should only check SETATTR stateid open mode on size change (Steve Dickson) [1075123] - [fs] nfs: Fail data server I/O if stateid represents a lost lock (Steve Dickson) [1075123] - [fs] nfs: Fix the return value of nfs4_select_rw_stateid (Steve Dickson) [1075123] - [fs] nfs: Use the open stateid if the delegation has the wrong mode (Steve Dickson) [1075123] - [fs] nfs: nfs4_stateid_is_current should return 'true' for an invalid stateid (Steve Dickson) [1075123] - [fs] nfs: fix error return in nfs4_select_rw_stateid (Steve Dickson) [1075123] - [fs] sunrpc: do not fail gss proc NULL calls with EACCES (Steve Dickson) [1079562] - [usb] xhci: change enumeration scheme to 'new scheme' by default (Gopal) [1066423] - [x86] ioapic: Restore the mask bit correctly in eoi_ioapic_irq() (Jason Wang) [1031488] - [vhost] don't forget to schedule() (Michael S. Tsirkin) [1095627] - [virt] kvm: Introduce KVM_MAX_VCPU_ID macro (Eduardo Habkost) [1010882] - [virt] kvm: Rename KVM_MAX_VCPUS to KVM_MAX_VCPU_COUNT (Eduardo Habkost) [1010882] - [virt] kvm: fix "Improve create VCPU parameter" (Andrew Jones) [1010882] - [acpi] apei: Add a boot option to disable ff mode for corrected errors (Steve Best) [947993] - [acpi] apei: Only disable banks listed in HEST if mce is configured (Steve Best) [947993] - [x86] mce: Honour Firmware First for MCA banks listed in APEI HEST CMC (Steve Best) [947993] - [x86] mca: Convert dont_log_ce, banks and tolerant (Steve Best) [947993] - [acpi] apei: Soft-offline a page on firmware GHES notification (Steve Best) [947993] - [x86] mce: Remove bios_cmci_threshold sysfs attribute (Steve Best) [929317] - [x86] mce: Provide boot argument to honour bios-set CMCI threshold (Steve Best) [929317] - [x86] mce: Make cmci_discover() quiet (Steve Best) [929317] - [mm] fix readahead failure for memoryless NUMA nodes and limit readahead pages (Steve Best) [862177]- [netdrv] be2net: increase the timeout value for loopback-test FW cmd (Ivan Vecera) [1039122] - [kernel] hrtimer: Prevent all reprogramming if hang detected (Prarit Bhargava) [1075805] - [module] show version information for built-in modules in sysfs (Tony Camuso) [1065913] - [mm] Increase RECLAIM_DISTANCE to 30 (Larry Woodman) [1005921] - [mm] fix backport of overcommit_kbytes sysctl variable (Jerome Marchand) [1078131] - [mm] vmscan: do not allow kswapd to scan at maximum priority (Jerome Marchand) [949166] - [mm] memcg: further prevent OOM with too many dirty pages (Johannes Weiner) [870011] - [mm] memcg: prevent OOM with too many dirty pages (Johannes Weiner) [870011] - [virtio] delete napi structures from netdev before releasing memory (Jason Wang) [1039825] - [virtio] virtio-net: correctly handle cpu hotplug notifier during resuming (Jason Wang) [1039825] - [virtio] virtio-net: refill only when device is up during setting queues (Jason Wang) [1039825] - [virtio] virtio-net: don't respond to cpu hotplug notifier if we're not ready (Jason Wang) [1039825] - [virtio] virtio-net: fix the race between channels setting and refill (Jason Wang) [1039825] - [virtio] virtio-net: enable napi for all possible queues during open (Jason Wang) [1039825] - [virtio] virtio-net: fill only rx queues which are being used (Jason Wang) [1039825] - [virtio] virtio-net: reset virtqueue affinity when doing cpu hotplug (Jason Wang) [1039825] - [virtio] virtio-net: split out clean affinity function (Jason Wang) [1039825] - [virtio] virtio-net: fix the set affinity bug when CPU IDs are not consecutive (Jason Wang) [1039825] - [virtio] virtio-net: fix a typo in virtnet_alloc_queues() (Jason Wang) [1039825] - [virtio] virtio-net: support changing the number of queue pairs through ethtool (Jason Wang) [1039825] - [virtio] virtio-net: multiqueue support (Jason Wang) [1039825] - [virtio] virtio-net: separate fields of sending/receiving queue from virtnet_info (Jason Wang) [1039825] - [virtio] virtio-net: fix oom handling on tx (Jason Wang) [1039825] - [virtio] virtio-net: move sg off stack (Jason Wang) [1039825] - [virtio] virtio-net: Make delayed refill more reliable (Jason Wang) [1039825] - [virtio] virtio-net: send gratuitous packets when needed (Jason Wang) [1039825] - [virtio] introduce an API to set affinity for a virtqueue (Jason Wang) [1039825] - [virtio] virtio-ring: move queue_index to vring_virtqueue (Jason Wang) [1039825] - [nvme] Namespace use after free on surprise removal (David Milburn) [1030635] - [nvme] Correct uses of INIT_WORK (David Milburn) [1030635] - [nvme] Include device and queue numbers in interrupt name (David Milburn) [1030635] - [nvme] Add a pci_driver shutdown method (David Milburn) [1030635] - [nvme] kthread_work: make lockdep happy (David Milburn) [1030635] - [nvme] kthread: implement kthread_worker (David Milburn) [1030635] - [nvme] Disable admin queue on init failure (David Milburn) [1030635] - [nvme] Dynamically allocate partition numbers (David Milburn) [1030635] - [nvme] Async IO queue deletion (David Milburn) [1030635] - [nvme] Surprise removal handling (David Milburn) [1030635] - [nvme] Abort timed out commands (David Milburn) [1030635] - [nvme] Schedule reset for failed controllers (David Milburn) [1030635] - [nvme] Device resume error handling (David Milburn) [1030635] - [nvme] Cache dev->pci_dev in a local pointer (David Milburn) [1030635] - [nvme] Fix lockdep warnings (David Milburn) [1030635] - [nvme] compat SG_IO ioctl (David Milburn) [1030635] - [nvme] remove deprecated IRQF_DISABLED (David Milburn) [1030635] - [nvme] Avoid shift operation when writing cq head doorbell (David Milburn) [1030635] - [usb] Using correct way to clear usb3.0 device's remote wakeup feature (Don Zickus) [924089] - [usb] improved error handling in usb_port_suspend() (Don Zickus) [924089]- [fs] Removed unused typedef to avoid "unused local typedef" warnings (Michal Schmidt) [1035341] - [media] tuner-xc2028: fix compile warning (Michal Schmidt) [1035341] - [net] netfilter: ctnetlink: fix ctnetlink_parse_tuple() warning (Michal Schmidt) [1035341] - [ata] ahci: Fix warning comparison between 'enum ' and 'enum ' (Michal Schmidt) [1035341] - [net] ipv6: Fix return of xfrm6_tunnel_rcv() (Michal Schmidt) [1035341] - [xen] Provide a variant of __RING_SIZE() that is an integer constant expression (Michal Schmidt) [1035341] - [media] budget-av: only use t_state if initialized (Michal Schmidt) [1035341] - [media] max2165: trival fix for some -Wuninitialized warning (Michal Schmidt) [1035341] - [ata] sata_sil: fix used-uninit warning (Michal Schmidt) [1035341] - [char] cm4000_cs: Fix undefined ops warning (Michal Schmidt) [1035341] - [netdrv] de4x5: remove undefined operations (Michal Schmidt) [1035341] - [netdrv] chelsio: Fix build warning (Michal Schmidt) [1035341] - [bluetooth] Fix abuse of the preincrement operator (Michal Schmidt) [1035341] - [usb] wusb: check CHID is all zeros before stopping the host (Michal Schmidt) [1035341] - [netdrv] Fix MAC address access in 3c507, ibmlana, pcnet32 and libertas (Michal Schmidt) [1035341] - [fs] nfs: Fix the initialisation of the readdir 'cookieverf' array (Michal Schmidt) [1035341] - [fs] nfs: Remove pointless memset in nfsacl_encode() (Michal Schmidt) [1035341] - [crypto] gf128mul: fix call to memset() (Michal Schmidt) [1035341] - [net] xfrm: fix XFRMA_MARK extraction in xfrm_mark_get (Michal Schmidt) [1035341] - [scsi] pmcraid: remove duplicate struct member (Michal Schmidt) [1035341] - [x86] gcc-4.6: Use gcc -m options when building vdso (Michal Schmidt) [1035341] - [net] rtnetlink: Only supply IFLA_VF_PORTS information when RTEXT_FILTER_VF is set (Jiri Pirko) [1081282] - [net] rtnetlink: Warn when interface's information won't fit in our packet (Jiri Pirko) [1081282] - [net] ipv4: current group_info should be put after using (Jiri Benc) [1087414] {CVE-2014-2851} - [net] Start with correct mac_len in skb_network_protocol (Vlad Yasevich) [1067448] - [net] Account for all vlan headers in skb_mac_gso_segment (Vlad Yasevich) [1067448] - [net] nf_conntrack: decrement global counter after object release (Jiri Pirko) [1089189] - [net] neigh: fix unres_qlen value manipulation (Jiri Pirko) [1073711] - [net] tcp: add mib counters to track zero window transitions (Florian Westphal) [1035908] - [net] tcp: use zero-window when free_space is low (Florian Westphal) [1035908] - [net] bridge: Correctly receive hw-accelerated vlan traffic (Vlad Yasevich) [1067722] - [net] vlan: Allow accelerated packets to flow through the bridge (Vlad Yasevich) [1067722] - [net] sysctl: Keep tcp_syn_retries inside the boundary (Michal Tesar) [985323] - [net] ipv6: don't call fib6_run_gc() until routing is ready (Florian Westphal) [1049733] - [net] Report dev->promiscuity in netlink reports (Seth Jennings) [1015438]- [kernel] tracing: Reset ring buffer when changing trace_clocks (Marcelo Tosatti) [1018138] - [netdrv] sfc: Maintain current frequency adjustment when applying a time offset (Nikolay Aleksandrov) [1017591] - [netdrv] sfc: Stop/re-start PTP when stopping/starting the datapath (Nikolay Aleksandrov) [1017591] - [netdrv] sfc: Rate-limit log message for PTP packets without a matching timestamp event (Nikolay Aleksandrov) [1017591] - [netdrv] sfc: Moderate log message on event queue overflow (Nikolay Aleksandrov) [1017591] - [netdrv] sfc: Add length checks to efx_xmit_with_hwtstamp() and efx_ptp_is_ptp_tx() (Nikolay Aleksandrov) [1017591] - [netdrv] sfc: Fix lookup of default RX MAC filters when steered using ethtool (Nikolay Aleksandrov) [1017591] - [net] Revert "disable the new NAPI weight error message for RHEL 6.5" (Michal Schmidt) [1017841] - [netdrv] qeth: use default napi weight (Michal Schmidt) [1017841] - [netdrv] ps3_gelic: lower NAPI weight (Michal Schmidt) [1017841] - [netdrv] IPoIB: lower NAPI weight (Michal Schmidt) [1017841] - [netdrv] jme: lower NAPI weight (Michal Schmidt) [1017841] - [netdrv] netxen: lower NAPI weight (Michal Schmidt) [1017841] - [netdrv] virtio_net: use default napi weight by default (Michal Schmidt) [1017841] - [netdrv] ethtool: allow custom interval for physical identification (Ivan Vecera) [1035269] - [netdrv] tg3: implement ethtool set_phys_id (Ivan Vecera) [1035269] - [netdrv] sky2: support ethtool set_phys_id (Ivan Vecera) [1035269] - [netdrv] skge: implement set_phys_id (Ivan Vecera) [1035269] - [netdrv] sfc: Implement ethtool_ops::set_phys_id instead of ethtool_ops::phys_id (Ivan Vecera) [1035269] - [netdrv] s2io: convert to set_phys_id - v2 (Ivan Vecera) [1035269] - [netdrv] pcnet32: convert to set_phys_id (Ivan Vecera) [1035269] - [netdrv] niu: convert to new ethtool set_phys_id (Ivan Vecera) [1035269] - [netdrv] cxgb3: implement set_phys_id (Ivan Vecera) [1035269] - [netdrv] bnx2: convert to set_phys_id (Ivan Vecera) [1035269] - [netdrv] vxge: convert to set_phys_id (Ivan Vecera) [1040420] - [netdrv] qlge: use ethtool set_phys_id (Ivan Vecera) [1040420] - [netdrv] qlcnic: convert to set_phys_id (Ivan Vecera) [1040420] - [netdrv] ixgbe: convert to ethtool set_phys_id (Ivan Vecera) [1040420] - [netdrv] ixgb: convert to set_phys_id (Ivan Vecera) [1040420] - [netdrv] igb: convert to ethtool set_phys_id (Ivan Vecera) [1040420] - [netdrv] e1000: convert to set_phys_id (Ivan Vecera) [1040420] - [netdrv] e100: implemenet set_phys_id (Ivan Vecera) [1040420] - [netdrv] cxgb4: drop phys_id interface and implement the newer set_phys_id (Ivan Vecera) [1040420] - [fs] dlm: Do not allocate a fd for peeloff (Aaron Tomlin) [1075629] - [net] sctp: Export sctp_do_peeloff (Aaron Tomlin) [1075629] - [mm] hugetlbfs: partial merge of hugetlbfs directio optimization (Andrea Arcangeli) [1045045] - [infiniband] qib: Fix QP check when looping back to/from QP1 (Doug Ledford) [1005491] - [infiniband] qib_fs: fix some dcache abuses (Doug Ledford) [1005491] - [infiniband] qib: Fix checkpatch __packed warnings (Doug Ledford) [1005491] - [infiniband] qib: Convert qib_user_sdma_pin_pages() to use get_user_pages_fast() (Doug Ledford) [1005491] - [infiniband] qib: Drop qib_tune_pcie_caps() and qib_tune_pcie_coalesce() return values (Doug Ledford) [1005491] - [infiniband] qib: Use pcie_set_mps() and pcie_get_mps() to simplify code (Doug Ledford) [1005491] - [pci] export 4 symbols (Doug Ledford) [1005491] - [infiniband] qib: Use pci_is_root_bus() to check whether it is a root bus (Doug Ledford) [1005491] - [infiniband] qib: Move COUNTER_MASK definition within qib_mad.h header guards (Doug Ledford) [1005491] - [infiniband] qib: Make qib_driver static (Doug Ledford) [1005491] - [infiniband] qib: Improve SDMA performance (Doug Ledford) [1005491] - [infiniband] qib: Add err_decode() call for ring dump (Doug Ledford) [1005491] - [infiniband] qib: Log all SDMA errors unconditionally (Doug Ledford) [1005491] - [infiniband] qib: Fix module-level leak (Doug Ledford) [1005491] - [infiniband] qib: New transmitter tunning settings for Dell 1.1 backplane (Doug Ledford) [1005491] - [infiniband] qib: Add qp_stats debug file (Doug Ledford) [1005491] - [infiniband] qib: Add per-context stats interface (Doug Ledford) [1005491] - [infiniband] qib: Convert opcode counters to per-context (Doug Ledford) [1005491] - [infiniband] qib: Add dual-rail NUMA awareness for PSM processes (Doug Ledford) [1005491] - [infiniband] qib: Add optional NUMA affinity (Doug Ledford) [1005491] - [infiniband] qib: Update minor version number (Doug Ledford) [1005491] - [infiniband] qib: Remove atomic_inc_not_zero() from QP RCU (Doug Ledford) [1005491] - [infiniband] qib: Add DCA support (Doug Ledford) [1005491] - [infiniband] qib: Fix lockdep splat in qib_alloc_lkey() (Doug Ledford) [1005491] - [infiniband] qib: Correct qib_verbs_register_sysfs() error handling (Doug Ledford) [1005491] - [firmware] ib: qib: revert firmware file move (Doug Ledford) [1005491] - [infiniband] qib: change QLogic to Intel (Doug Ledford) [1005491] - [infiniband] qib: Fix QP locate/remove race (Doug Ledford) [1005491] - [infiniband] qib: Add missing serdes init sequence (Doug Ledford) [1005491] - [infiniband] qib: Fix txselect regression (Doug Ledford) [1005491]- [perf] tools: Add debug prints (Jiri Olsa) [1070896] - [perf] net_dropmonitor: Remove progress indicator (Jiri Olsa) [1070896] - [perf] net_dropmonitor: Use bisection in symbol lookup (Jiri Olsa) [1070896] - [perf] net_dropmonitor: Do not assume ordering of dictionaries (Jiri Olsa) [1070896] - [perf] net_dropmonitor: Fix symbol-relative addresses (Jiri Olsa) [1070896] - [perf] net_dropmonitor: Fix trace parameter order (Jiri Olsa) [1070896] - [perf] treewide: Fix typo in printks (Jiri Olsa) [1070896] - [perf] map: Exit just on well known key presses (Jiri Olsa) [1070896] - [perf] tools: Remove dependency on libnewt (Jiri Olsa) [1070896] - [perf] map: Use ui_browser__input_window() (Jiri Olsa) [1070896] - [perf] python: Fix dependency for python/perf.so (Jiri Olsa) [1070896] - [perf] tools: Convert needless static variable to local (Jiri Olsa) [1070896] - [perf] tools: Fix output of symbol_daddr offset (Jiri Olsa) [1070896] - [perf] machine: Detect data vs. text mappings (Jiri Olsa) [1070896] - [perf] tools: Add new mem command for memory access profiling (Jiri Olsa) [1070896] - [perf] report: Add support for mem access profiling (Jiri Olsa) [1070896] - [perf] record: Add support for mem access profiling (Jiri Olsa) [1070896] - [perf] tools: Add mem access sampling core support (Jiri Olsa) [1070896] - [perf] tools: Add support for weight v7 (Jiri Olsa) [1070896] - [perf] report: Add --no-demangle option (Jiri Olsa) [1070896] - [perf] stat: Add per-core aggregation (Jiri Olsa) [1070896] - [perf] stat: Rename --aggr-socket to --per-socket (Jiri Olsa) [1070896] - [perf] stat: Refactor aggregation code (Jiri Olsa) [1070896] - [perf] tools: Cleanup calc_data_size logic (Jiri Olsa) [1070896] - [perf] tools: Get rid of die() calls in trace-data-read.c (Jiri Olsa) [1070896] - [perf] tools: Get rid of read_or_die() in trace-event-read.c (Jiri Olsa) [1070896] - [perf] tools: Get rid of malloc_or_die() in trace-event-read.c (Jiri Olsa) [1070896] - [perf] tools: Handle failure case in trace_report() (Jiri Olsa) [1070896] - [perf] tools: Get rid of die() calls from trace-event-info.c (Jiri Olsa) [1070896] - [perf] tools: Get rid of write_or_die() from trace-event-info.c (Jiri Olsa) [1070896] - [perf] tools: Get rid of malloc_or_die() in trace-event-info.c (Jiri Olsa) [1070896] - [perf] tools: Let get_tracing_file() return NULL to indicate failure (Jiri Olsa) [1070896] - [perf] tools: Get rid of redundant _FILE_OFFSET_BITS definition (Jiri Olsa) [1070896] - [perf] tests: Add a test case for checking sw clock event frequency (Jiri Olsa) [1070896] - [perf] stat: Introduce evlist methods to allocate/free the stats (Jiri Olsa) [1070896] - [perf] stat: Introduce --repeat forever (Jiri Olsa) [1070896] - [perf] test: Add test case for checking number of EXIT events (Jiri Olsa) [1070896] - [perf] tests: Fixup return path of perf record test case (Jiri Olsa) [1070896] - [perf] tests: Fixup return path of open-syscall-tp-fields test case (Jiri Olsa) [1070896] - [perf] record: Fixup return path of cmd_record() (Jiri Olsa) [1070896] - [perf] trace: Free evlist resources properly on return path (Jiri Olsa) [1070896] - [perf] evlist: Introduce perf_evlist__close() (Jiri Olsa) [1070896] - [perf] evsel: Cleanup perf_evsel__exit() (Jiri Olsa) [1070896] - [perf] tools: Remove duplicated page_size definition (Jiri Olsa) [1070896] - [perf] tools: Remove unused macro definitions (Jiri Olsa) [1070896] - [perf] tools: Remove unnecessary calc_data_size variable (Jiri Olsa) [1070896] - [perf] tools: Remove unused struct definitions (Jiri Olsa) [1070896] - [perf] tools: Remove unused trace_read_data function (Jiri Olsa) [1070896] - [perf] report: Remove duplicated include (Jiri Olsa) [1070896] - [perf] machine: Move machine__remove_thread and make static (Jiri Olsa) [1070896] - [perf] session: Remove unused perf_session__remove_thread method (Jiri Olsa) [1070896] - [perf] tools: Remove unused tracing functions (Jiri Olsa) [1070896] - [perf] trace: Get rid of a duplicate code (Jiri Olsa) [1070896] - [perf] annotate: Support event group view on TUI (Jiri Olsa) [1070896] - [perf] annotate: Support event group view on GTK (Jiri Olsa) [1070896] - [perf] annotate: Use disasm__calc_percent() (Jiri Olsa) [1070896] - [perf] annotate: Make browser_disasm_line->percent an array (Jiri Olsa) [1070896] - [perf] annotate: Support event group view for --print-line (Jiri Olsa) [1070896] - [perf] annotate: Factor out struct source_line_percent (Jiri Olsa) [1070896] - [perf] evsel: Introduce perf_evsel__is_group_event() helper (Jiri Olsa) [1070896] - [perf] annotate: Add basic support to event group view (Jiri Olsa) [1070896] - [perf] annotate: Cleanup disasm__calc_percent() (Jiri Olsa) [1070896] - [perf] annotate: Factor out disasm__calc_percent() (Jiri Olsa) [1070896] - [perf] annotate: Add a comment on the symbol__parse_objdump_line() (Jiri Olsa) [1070896] - [perf] annotate: Pass evsel instead of evidx on annotation functions (Jiri Olsa) [1070896] - [perf] stat: Use perf_evlist__prepare/start_workload() (Jiri Olsa) [1070896] - [perf] evlist: Add want_signal parameter to perf_evlist__prepare_workload() (Jiri Olsa) [1070896] - [perf] evlist: Do not pass struct record_opts to perf_evlist__prepare_workload() (Jiri Olsa) [1070896] - [perf] evlist: Pass struct perf_target to perf_evlist__prepare_workload() (Jiri Olsa) [1070896] - [perf] evlist: Add thread_map__nr() helper (Jiri Olsa) [1070896] - [perf] evlist: Use cpu_map__nr() helper (Jiri Olsa) [1070896] - [perf] evlist: Remove cpus and threads arguments from perf_evlist__new() (Jiri Olsa) [1070896] - [perf] tools: Fix _FORTIFY_SOURCE builds (Jiri Olsa) [1070896] - [perf] tools: Extract perf-specific stuff from debugfs.c (Jiri Olsa) [1070896] - [perf] tools: Introduce tools/lib/lk library (Jiri Olsa) [1070896] - [perf] Make perf build for x86 with UAPI disintegration applied (Jiri Olsa) [1070896] - [perf] tests: Add attr stat -C cpu test (Jiri Olsa) [1070896] - [perf] tests: Add attr record -C cpu test (Jiri Olsa) [1070896] - [perf] tests: Make attr script test event cpu (Jiri Olsa) [1070896] - [perf] tests: Make attr script verbose friendly (Jiri Olsa) [1070896] - [perf] tools: Sort command-list.txt alphabetically (Jiri Olsa) [1070896] - [perf] tools: Correct Makefile.include (Jiri Olsa) [1070896] - [perf] tools: Honor parallel jobs (Jiri Olsa) [1070896] - [perf] tools: Pass the target in descend (Jiri Olsa) [1070896] - [perf] tools: Honour the O= flag when tool build called from a higher Makefile (Jiri Olsa) [1070896] - [perf] tools: Define a Makefile function to do subdir processing (Jiri Olsa) [1070896] - [perf] tools: Let O= makes handle relative paths (Jiri Olsa) [1070896] - [perf] tools: Cleanup EXTRA_WARNINGS (Jiri Olsa) [1070896] - [perf] tools: Remove a write-only variable in the debugfs code (Jiri Olsa) [1070896] - [perf] x86: Add a microcode revision check for SNB-PEBS (Jiri Olsa) [1059205] - [x86] intel: Output microcode revision in /proc/cpuinfo (Jiri Olsa) [1059205] - [perf] x86: Enable raw event access to Intel offcore events (Jiri Olsa) [1059205] - [perf] Fix comments in PERF_MEM_LVL bitmask (Jiri Olsa) [1059205] - [perf] Add PERF_RECORD_MISC_MMAP_DATA to RECORD_MMAP (Jiri Olsa) [1059205] - [perf] x86: Add support for PEBS Precise Store (Jiri Olsa) [1059205] - [perf] x86: Export PEBS load latency threshold register to sysfs (Jiri Olsa) [1059205] - [perf] x86: Add memory profiling via PEBS Load Latency (Jiri Olsa) [1059205] - [perf] Add generic memory sampling interface (Jiri Olsa) [1059205] - [perf] core: Add weighted samples (Jiri Olsa) [1059205] - [perf] x86: Add flags to event constraints (Jiri Olsa) [1059205] - [perf] x86: Improve sysfs event mapping with event string (Jiri Olsa) [1059205] - [perf] x86: Support CPU specific sysfs events (Jiri Olsa) [1059205] - [perf] Make EVENT_ATTR global (Jiri Olsa) [1059205] - [perf] x86: Fix sparse warnings (Jiri Olsa) [1059205] - [perf] x86: Add hardware events translations for Intel P6 cpus (Jiri Olsa) [1059205] - [perf] x86: Add hardware events translations for AMD cpus (Jiri Olsa) [1059205] - [perf] x86: Add hardware events translations for Intel cpus (Jiri Olsa) [1059205] - [perf] x86: Filter out undefined events from sysfs events attribute (Jiri Olsa) [1059205] - [perf] x86: Make hardware event translations available in sysfs (Jiri Olsa) [1059205] - [kernel] sched: fix cpu_power initialization (Radim Krcmar) [1065304] - [x86] add VMWare exception to support check (Prarit Bhargava) [1084456] - [char] ipmi_watchdog: restore settings when BMC reset (Tony Camuso) [1080098] - [netdrv] ixgbevf: fix vlan acceleration (Nikolay Aleksandrov) [1069028] - [netdrv] tg3: update rx_jumbo_pending ring param only when jumbo frames are enabled (Ivan Vecera) [1073146] - [netdrv] tg3: Expand 4g_overflow_test workaround to skb fragments of any size (Ivan Vecera) [1058864] - [netdrv] be2net: Create single TXQ on BE3-R 1G ports (Ivan Vecera) [976179] - [crypto] Move to DSA-2048 and SHA-256 for module signing (David Howells) [1012593]- [fs] sunrpc: Fix a UDP transport regression (Jeff Layton) [906809] - [kernel] Remove setting of TAINT_HARDWARE_UNSUPPORTED flag (Prarit Bhargava) [956219] - [kernel] audit: allow checking the type of audit message in the user filter (Richard Guy Briggs) [952295] - [security] selinux: Fix kernel BUG on empty security contexts (Paul Moore) [1064545] {CVE-2014-1874} - [perf] x86: Disable uncore on virtualized CPUs (Radim Krcmar) [1063836] - [s390] dump: Fix dump memory detection (Hendrik Brueckner) [1065391] - [md] avoid deadlock when dirty buffers during md_stop (Jes Sorensen) [994724] - [ata] ahci: disabled FBS prior to issuing software reset (David Milburn) [843060] - [scsi] mvsas: config change (David Milburn) [1072052] - [scsi] mvsas: Fix kernel panic on tile due to unaligned data access (David Milburn) [1072052] - [scsi] mvsas: fixed timeout issue when removing module (David Milburn) [1072052] - [scsi] mvsas: Fix oops when ata commond timeout (David Milburn) [1072052] - [scsi] mvsas: OCZ RevoDrive3 & zDrive R4 support (David Milburn) [1072052] - [scsi] mvsas: fix undefined bit shift (David Milburn) [1072052] - [scsi] mvsas: update driver version (David Milburn) [1072052] - [scsi] mvsas: fixed SMP request watchdog timeout issue (David Milburn) [1072052] - [scsi] mvsas: expander write performance enhancement (David Milburn) [1072052] - [scsi] mvsas: change SL mode0 register value (David Milburn) [1072052] - [scsi] mvsas: fixed wrong destination when hiting NAK for command frame (David Milburn) [1072052] - [scsi] mvsas: fixed some disk spin up issue (David Milburn) [1072052] - [scsi] mvsas: add support for 9480 device id (David Milburn) [1072052] - [scsi] mvsas: fix expander link error (David Milburn) [1072052] - [scsi] mvsas: Add support for interrupt tasklet (David Milburn) [1072052] - [scsi] mvsas: update comments (David Milburn) [1072052] - [scsi] mvsas: misc improvements (David Milburn) [1072052] - [scsi] mvsas: Add new macros and functions (David Milburn) [1072052] - [scsi] mvsas: Remove unused macros, variables and functions (David Milburn) [1072052] - [scsi] mvsas: fix 94xx hotplug issue (David Milburn) [1072052] - [scsi] mvsas: Add driver version and interrupt coalescing to device attributes in sysfs (David Milburn) [1072052] - [scsi] mvsas: add support for 94xx phy tuning and multiple revisions (David Milburn) [1072052] - [scsi] mvsas: Add support for Non specific NCQ error interrupt (David Milburn) [1072052] - [scsi] mvsas: add support for Task collector mode and fixed relative bugs (David Milburn) [1072052] - [scsi] mvsas: add support for Marvell 88SE9445/88SE9485 (David Milburn) [1072052] - [scsi] mvsas: Add support for HighPoint RR27xx series HBA (David Milburn) [1072052] - [scsi] mvsas: fix potential NULL dereference (David Milburn) [1072052] - [scsi] mvsas: fix hot plug handling and IO issues (David Milburn) [1072052]- [virt] kvm: Improve create VCPU parameter (Andrew Jones) [1010882] - [char] tty: move pty count limiting into devpts (Prarit Bhargava) [1061555] - [documentation] proc: fix mistake in the description of Committed_AS (Minto Joseph) [1008376] - [netdrv] macvtap: limit head length of skb allocated (Jason Wang) [1029381] - [netdrv] macvtap: do not zerocopy if iov needs more pages than MAX_SKB_FRAGS (Jason Wang) [1029381] - [netdrv] macvtap: correctly linearize skb when zerocopy is used (Jason Wang) [1029381] - [netdrv] tuntap: limit head length of skb allocated (Jason Wang) [1029381] - [net] tcp: Fix a connect() race with timewait sockets (with reuse) (Jiri Pirko) [1084525] - [net] tcp: Fix a connect() race with timewait sockets (Jiri Pirko) [1084525] - [net] proc_fs: print UIDs as unsigned int (Francesco Fusco) [996124] - [net] ipv6: Unify raw6_sock_seq_show and udp6_sock_seq_show (Francesco Fusco) [996124] - [net] busy_poll: preserve kabi (Jiri Pirko) [1000460] - [net] busy_poll: rename busy poll MIB counter (Jiri Pirko) [1000460] - [net] busy_poll: rename CONFIG_NET_LL_RX_POLL to CONFIG_NET_RX_BUSY_POLL (Jiri Pirko) [1000460] - [net] busy_poll: fix a compile error when CONFIG_NET_LL_RX_POLL is not set (Jiri Pirko) [1000460] - [net] busy_poll: rename busy poll socket op and globals (Jiri Pirko) [1000460] - [net] busy_poll: rename ll methods to busy-poll (Jiri Pirko) [1000460] - [net] busy_poll: rename include/net/ll_poll.h to include/net/busy_poll.h (Jiri Pirko) [1000460] - [net] busy_poll: fs: change busy poll time accounting (Jiri Pirko) [1000460] - [net] busy_poll: rename low latency sockets functions to busy poll (Jiri Pirko) [1000460] - [net] busy_poll: lls fix build with allnoconfig (Jiri Pirko) [1000460] - [net] busy_poll: convert lls to use time_in_range() (Jiri Pirko) [1000460] - [net] busy_poll: avoid calling sched_clock when LLS is off (Jiri Pirko) [1000460] - [net] busy_poll: fix LLS debug_smp_processor_id() warning (Jiri Pirko) [1000460] - [net] busy_poll: poll/select low latency socket support (Jiri Pirko) [1000460] - [netdrv] bnx2x: add support for ndo_ll_poll (Jiri Pirko) [1000460] - [net] busy_poll: add socket option for low latency polling (Jiri Pirko) [1000460] - [net] busy_poll: remove NET_LL_RX_POLL config menu (Jiri Pirko) [1000460] - [net] busy_poll: convert low latency sockets to sched_clock() (Jiri Pirko) [1000460] - [net] busy_poll: change sysctl_net_ll_poll into an unsigned int (Jiri Pirko) [1000460] - [netdrv] ixgbe: add extra stats for ndo_ll_poll (Jiri Pirko) [1000460] - [netdrv] ixgbe: add support for ndo_ll_poll (Jiri Pirko) [1000460] - [net] tcp: add low latency socket poll support (Jiri Pirko) [1000460] - [net] udp: add low latency socket poll support (Jiri Pirko) [1000460] - [net] busy_poll: add low latency socket poll (Jiri Pirko) [1000460] - [net] add napi_id and hash (Jiri Pirko) [1000460] - [kernel] hashtable: introduce a small and naive hashtable (Jiri Pirko) [1000460] - [net] rds: dereference of a NULL device (Jacob Tanenbaum) [1079219] {CVE-2013-7339} - [s390] cio: add condev keyword to cio_ignore (Hendrik Brueckner) [1053831] - [s390] cio: add ipldev keyword to cio_ignore (Hendrik Brueckner) [1053831] - [s390] crypto: fix concurrency issue in aes-ctr mode (Hendrik Brueckner) [1063478] - [netdrv] libertas: potential oops in debugfs (Denys Vlasenko) [1034177] {CVE-2013-6378} - [kernel] cgroup: move put_css_set() after setting CGRP_RELEASABLE bit to fix notify_on_release (Naoya Horiguchi) [1037465] - [kernel] sched: Use exit hook to avoid use-after-free crash (Naoya Horiguchi) [1032347] - [kernel] cgroup: replace list_del() with list_del_init() to avoid panic (Naoya Horiguchi) [1032343]- [documentation] kernel-parameters: replace kernelcore with Movable (Weiping Pan) [887213] - [tools] perf: Fix attr tests (Jiri Olsa) [1070238] - [tools] perf: Enable dwarf unwind (Jiri Olsa) [1070238] - [tools] perf: Keep the perf_event_attr on version 3 (Jiri Olsa) [1070238] - [tools] perf: Add feature that measures the performance of the arch/x86/lib/memcpy_64.S memcpy routines via 'perf bench mem' (Jiri Olsa) [1070238] - [kernel] perf: Add attribute to filter out callchains (Jiri Olsa) [1070238] - [kernel] events: Add ability to set a target task for events (Jiri Olsa) [1070238] - [kernel] perf: Add ability to attach user stack dump to sample (Jiri Olsa) [1070238] - [kernel] perf: Add perf_output_skip function to skip bytes in sample (Jiri Olsa) [1070238] - [kernel] perf: Factor __output_copy to be usable with specific copy function (Jiri Olsa) [1070238] - [kernel] perf: Add ability to attach user level registers dump to sample (Jiri Olsa) [1070238] - [kernel] perf: Unified API to record selective sets of arch registers (Jiri Olsa) [1070238] - [kernel] perf: Pass last sampling period to perf_sample_data_init() (Jiri Olsa) [1070238] - [tools] perf: Update attr_file_abi_sizes array properly (Jiri Olsa) [1070238] - [tools] perf: Add ABI reference sizes (Jiri Olsa) [1070238] - [tools] perf: Fix strict alias issue for find_first_bit (Jiri Olsa) [1070238] - [tools] perf: Fix parse events test (Jiri Olsa) [1070238] - [bluetooth] Use USB_VENDOR_AND_INTERFACE() for Broadcom devices (Jay Fenlason) [885100] - [bluetooth] Add USB_VENDOR_AND_INTERFACE_INFO() for Broadcom/Foxconn (Jay Fenlason) [885100] - [bluetooth] Add Foxconn / Hon Hai IDs for btusb module (Jay Fenlason) [885100] - [bluetooth] btusb: Add vendor specific ID "0489 e042" for BCM20702A0 (Jay Fenlason) [885100] - [bluetooth] btusb: Add vendor specific ID "0a5c 21f4" BCM20702A0 (Jay Fenlason) [885100] - [bluetooth] btusb: Add USB device ID "0a5c 21e8" (Jay Fenlason) [885100] - [bluetooth] btusb: add support for BCM20702A0 "0a5c 21e6" (Jay Fenlason) [885100] - [bluetooth] btusb: Add vendor specific ID "0a5c 21f3" for BCM20702A0 (Jay Fenlason) [885100] - [bluetooth] Add support for BCM20702A0 "0a5c 21e3" (Jay Fenlason) [885100] - [nvme] fixup usage of bio rw flag (David Milburn) [1056539] - [kernel] fix wrong usage of __ratelimit() (Jeff Layton) [1025441] - [fs] nfs: Document the recover_lost_locks kernel parameter (Jeff Layton) [963785] - [fs] nfs: Don't try to recover NFSv4 locks when they are lost (Jeff Layton) [963785] - [fs] nfs: Ensure that layoutreturn uses the correct credential (Jeff Layton) [966832] - [fs] nfs: Ensure that layoutget is called using the layout credential (Jeff Layton) [966832] - [fs] nfs: Ensure the LOCK call cannot use the delegation stateid (Jeff Layton) [962561] - [fs] nfs: Fix handling of partially delegated locks (Jeff Layton) [959788] - [fs] nfs: Convert the nfs4_lock_state->ls_flags to a bit field (Jeff Layton) [959788] - [fs] pnfs: fix resend_to_mds for directio (Jeff Layton) [913655] - [fs] nfsd/sunrpc: avoid deadlock on TCP connection due to memory pressure (J. Bruce Fields) [905236] - [x86] turbostat: display C8, C9, C10 residency (Neil Horman) [1080637] - [x86] tsc: output boot TSC value for Ivybridge E5v2 (Prarit Bhargava) [1046422] - [usb] CP210x Fix Break On/Off (Don Zickus) [888003]- [vhost] fix total length when packets are too short (Michael S. Tsirkin) [1064444] {CVE-2014-0077} - [scsi] lpfc: Update lpfc version for 8.3.7.21.6p driver release (Rob Evers) [1063699] - [scsi] lpfc 8.3.44: Fix kernel panics from corrupted ndlp list (Rob Evers) [1063699] - [scsi] qla2xxx: Fixup looking for a space in the outstanding_cmds array in qla2x00_alloc_iocbs() (Chad Dupuis) [1070856] - [mfd] rtsx: fix deadlock (Neil Horman) [1024205] - [mmc] Add mmc_op_multi function (Neil Horman) [1024205] - [mmc] rtsx: Remove redundant suspend and resume callbacks (Neil Horman) [1024205] - [mfd] rtsx_pcr: Remove redundant dev_set_drvdata (Neil Horman) [1024205] - [mfd] rtsx: Modify rts5249_optimize_phy (Neil Horman) [1024205] - [memstick] rtsx: remove unnecessary platform_set_drvdata() (Neil Horman) [1024205] - [mmc] rtsx: Modify copyright comments (Neil Horman) [1024205] - [mmc] rtsx: Clear SD_CLK toggle enable bit if switching voltage fail (Neil Horman) [1024205] - [mfd] rtsx: Change default tx phase (Neil Horman) [1024205] - [mfd] rtsx: Copyright modifications (Neil Horman) [1024205] - [mfd] rtsx: Configure to enter a deeper power-saving mode in S3 (Neil Horman) [1024205] - [mfd] rtsx: Clear hardware PFM mode in rtl8411b (Neil Horman) [1024205] - [mfd] rtsx: Move some actions from rtsx_pci_init_hw to individual extra_init_hw (Neil Horman) [1024205] - [mfd] rtsx: Add shutdown callback in rtsx_pci_driver (Neil Horman) [1024205] - [mfd] rtsx: Read vendor setting from config space (Neil Horman) [1024205] - [mfd] rtsx: Add support for RTL8411B (Neil Horman) [1024205] - [mfd] rtsx: Support RTS5249 (Neil Horman) [1024205] - [mfd] rtsx_pcr: Fix probe fail path (Neil Horman) [1024205] - [mmc] rtsx_pci_sdmmc: Don't execute power up sequence repeatedly (Neil Horman) [1024205] - [mfd] rtsx: remove driving adjustment (Neil Horman) [1024205] - [mfd] rtsx: Fix issue that booting OS with SD card inserted (Neil Horman) [1024205] - [mfd] rtsx: Support RTS5227 (Neil Horman) [1024205] - [mfd] rtsx: Optimize card detect flow (Neil Horman) [1024205] - [mfd] rtsx: Use macros to replace some variables (Neil Horman) [1024205] - [mfd] rtsx: Fix checkpatch warning (Neil Horman) [1024205] - [mfd] rtsx: Declare that the DMA address limitation is 32bit explicitly (Neil Horman) [1024205] - [mfd] rtsx: Remove redundant code (Neil Horman) [1024205] - [mfd] rtsx: Fix typo in comment (Neil Horman) [1024205] - [mfd] rtsx: Fix oops when rtsx_pci_sdmmc is not probed (Neil Horman) [1024205] - [mfd] rtsx: Add clock divider hook (Neil Horman) [1024205] - [mmc] rtsx: Call MFD hook to switch output voltage (Neil Horman) [1024205] - [mfd] rtsx: Add output voltage switch hook (Neil Horman) [1024205] - [mfd] remove __dev* attributes (Neil Horman) [1024205] - [mmc] rtsx: Explicitely include slab.h in rtsx_pci_sdmmc.c (Neil Horman) [1024205] - [mmc] rtsx: Configure SD_CFG2 register in sd_rw_multi (Neil Horman) [1024205] - [mmc] rtsx: Remove a duplicate command in sd_rw_multi (Neil Horman) [1024205] - [mfd] Explicitely include slab.h to rtsx (Neil Horman) [1024205] - [memstick] Add realtek pcie memstick host driver (Neil Horman) [1024205] - [mmc] Add realtek pcie sdmmc host driver (Neil Horman) [1024205] - [mfd] Add realtek pcie card reader driver (Neil Horman) [1024205] - [s390] css: Prevent unnecessary allocation in subchannel loop (Hendrik Brueckner) [1076467] - [s390] cio: Perform subchannel scan only when needed (Hendrik Brueckner) [1076467] - [s390] cio: Relax subchannel scan loop (Hendrik Brueckner) [1076467] - [s390] cio: Delay scan for newly available I/O devices (Hendrik Brueckner) [1076467] - [s390] cio: More efficient handling of CHPID availability events (Hendrik Brueckner) [1076467] - [s390] cio: improve cio_commit_config (Hendrik Brueckner) [1065403] - [s390] fix kernel crash due to linkage stack instructions (Hendrik Brueckner) [1065399] - [s390] crypto: fix aes_s390 crypto module unload problem (Hendrik Brueckner) [1034256] - [md] dm-thin: fix rcu_read_lock being held in code that can sleep (Mike Snitzer) [1060381] - [md] dm-thin: irqsave must always be used with the pool->lock spinlock (Mike Snitzer) [1060381] - [scsi] isci: fix reset timeout handling (David Milburn) [1040393] - [scsi] isci: correct erroneous for_each_isci_host macro (David Milburn) [1059325] - [ata] libata: report link resume failure as KERN_WARNING instead of ERR (David Milburn) [1029395] - [char] ipmi: revert special case for UV systems (Tony Camuso) [1063878] - [acpi] ipmi: create dependencies so ipmi loads before power_meter (Tony Camuso) [1063878] - [acpi] Not an error if IPMI handlers are not available at boot (Tony Camuso) [1063878] - [char] ipmi: allow building ipmi_si and ipmi_msghandler as loadable modules (Tony Camuso) [1063878] - [kernel] sched: Fix small race where child->se.parent, cfs_rq might point to invalid ones (Naoya Horiguchi) [1032350] - [kernel] sched: suppress RCU lockdep splat in task_fork_fair (Naoya Horiguchi) [1032350] - [kernel] sched: add local variable to store task_group() to avoid kernel stall (Naoya Horiguchi) [1043733] - [edac] pci: remove unnecessary debug printk (Aristeu Rozanski) [755026] - [x86] Optimize switch_mm() for multi-threaded workloads (Rik van Riel) [991518] - [fs] vfs: enclose vfs_check_frozen macro (Mateusz Guzik) [1056303] - [fs] jbd: Remove j_barrier mutex (Mateusz Guzik) [1052757]- [md] dm-cache: fix a lock-inversion (Mike Snitzer) [1038227] - [md] dm-cache: take care to copy the space map roots before locking the superblock (Mike Snitzer) [1038227] - [md] dm-cache-metadata: fix corruption due to non-atomic transaction commit (Mike Snitzer) [1038227] - [md] dm-era: fixes for issues identified upstream (Mike Snitzer) [1038227] - [md] dm-cache: remove remainder of distinct discard block size (Mike Snitzer) [1038227] - [md] dm-cache: prevent corruption caused by discard_block_size > cache_block_size (Mike Snitzer) [1038227] - [md] dm-cache: fix access beyond end of origin device (Mike Snitzer) [1038227] - [md] dm-cache: fix truncation bug when copying a block to/from >2TB fast device (Mike Snitzer) [1038227] - [md] dm-era: mark as tech preview for RHEL6.6 (Mike Snitzer) [1038227] - [md] dm-era: port to RHEL6.6 (Mike Snitzer) [1038227] - [md] dm-bitset: only flush the current word if it has been dirtied (Mike Snitzer) [1038227] - [md] dm-era: support non power-of-2 blocksize (Mike Snitzer) [1038227] - [md] dm: add era target (Mike Snitzer) [1038227] - [md] dm-cache-mq: fix memory allocation failure for large cache devices (Mike Snitzer) [1038227] - [md] dm-cache: fix truncation bug when mapping I/O to >2TB fast device (Mike Snitzer) [1038227] - [md] dm-cache: mark as tech preview (Mike Snitzer) [1038227] - [md] dm-cache: fix RHEL6 incompatibility with upstream's hook/unhook (Mike Snitzer) [1038227] - [md] dm-cache: fix bug in cache-mode based per-bio data destruction (Mike Snitzer) [1038227] - [md] dm-cache: port to RHEL6 (Mike Snitzer) [1038227] - [md] dm-cache: do not add migration to completed list before unhooking bio (Mike Snitzer) [1038227] - [md] dm-cache: move hook_info into common portion of per_bio_data structure (Mike Snitzer) [1038227] - [md] dm-cache: add policy name to status output (Mike Snitzer) [1038227] - [md] dm-cache: add block sizes and total cache blocks to status output (Mike Snitzer) [1038227] - [md] dm-btree: add dm_btree_find_lowest_key (Mike Snitzer) [1038227] - [md] dm-cache-policy-mq: introduce three promotion threshold tunables (Mike Snitzer) [1038227] - [md] dm-cache-policy-mq: use list_del_init instead of list_del + INIT_LIST_HEAD (Mike Snitzer) [1038227] - [md] dm-array: fix a reference counting bug in shadow_ablock (Mike Snitzer) [1038227] - [md] dm-cache: actually resize cache (Mike Snitzer) [1038227] - [md] dm-cache: update Documentation for invalidate_cblocks's range syntax (Mike Snitzer) [1038227] - [md] dm-cache-policy-mq: fix promotions to occur as expected (Mike Snitzer) [1038227] - [md] dm-cache: resolve small nits and improve Documentation (Mike Snitzer) [1038227] - [md] dm-cache: add cache block invalidation support (Mike Snitzer) [1038227] - [md] dm-cache: add remove_cblock method to policy interface (Mike Snitzer) [1038227] - [md] dm-cache-policy-mq: reduce memory requirements (Mike Snitzer) [1038227] - [md] dm-cache-metadata: check the metadata version when reading the superblock (Mike Snitzer) [1038227] - [md] dm-cache: add passthrough mode (Mike Snitzer) [1038227] - [md] dm-cache: cache shrinking support (Mike Snitzer) [1038227] - [md] dm-cache: promotion optimisation for writes (Mike Snitzer) [1038227] - [md] dm-cache: be much more aggressive about promoting writes to discarded blocks (Mike Snitzer) [1038227] - [md] dm-cache-policy-mq: implement writeback_work(), mq_set_dirty() and mq_clear_dirty() (Mike Snitzer) [1038227] - [md] dm-cache: optimize commit_if_needed (Mike Snitzer) [1038227] - [md] dm-cache: log error message if dm_kcopyd_copy() fails (Mike Snitzer) [1038227] - [md] dm-cache: use cell_defer() boolean argument consistently (Mike Snitzer) [1038227] - [md] dm-cache: return -EINVAL if the user specifies unknown cache policy (Mike Snitzer) [1038227] - [md] dm-cache-metadata: return bool from __superblock_all_zeroes (Mike Snitzer) [1038227] - [md] dm-cache-policy-mq: a few small fixes (Mike Snitzer) [1038227] - [md] dm-cache-policy: remove return from void policy_remove_mapping (Mike Snitzer) [1038227] - [md] dm-cache: improve efficiency of quiescing flag management (Mike Snitzer) [1038227] - [md] dm-cache: fix a race condition between queuing new migrations and quiescing for a shutdown (Mike Snitzer) [1038227] - [md] dm-cache: io destined for the cache device can now serve as tick bios (Mike Snitzer) [1038227] - [md] dm-cache-policy-mq: protect residency method with existing mutex (Mike Snitzer) [1038227] - [md] dm-array: fix bug in growing array (Mike Snitzer) [1038227] - [md] dm-cache: eliminate holes in cache structure (Mike Snitzer) [1038227] - [md] dm-cache: fix stacking of geometry limits (Mike Snitzer) [1038227] - [md] dm-cache: add data block size limits to code and Documentation (Mike Snitzer) [1038227] - [md] dm-cache: document metadata device is exclussive to a cache (Mike Snitzer) [1038227] - [md] dm-cache: avoid conflicting remove_mapping() in mq policy (Mike Snitzer) [1038227] - [md] dm-cache: fix arm link errors with inline (Mike Snitzer) [1038227] - [md] doc: fix dm-cache misspelling found with 'codespell' tool (Mike Snitzer) [1038227] - [md] dm-cache: set config value (Mike Snitzer) [1038227] - [md] dm-cache: move config fns (Mike Snitzer) [1038227] - [md] dm-cache: replace memcpy with struct assignment (Mike Snitzer) [1038227] - [md] dm-cache: fix typos in comments (Mike Snitzer) [1038227] - [md] dm-cache-policy: fix description of lookup fn (Mike Snitzer) [1038227] - [md] dm-cache: tune migration throttling (Mike Snitzer) [1038227] - [md] dm-cache: fix error return code in cache_create (Mike Snitzer) [1038227] - [md] dm-cache: reduce bio front_pad size in writeback mode (Mike Snitzer) [1038227] - [md] dm-cache: fix writes to cache device in writethrough mode (Mike Snitzer) [1038227] - [md] dm-cache: policy ignore hints if generated by different version (Mike Snitzer) [1038227] - [md] dm-cache: policy change version from string to integer set (Mike Snitzer) [1038227] - [md] dm-cache: fix race in writethrough implementation (Mike Snitzer) [1038227] - [md] dm-cache: metadata clear dirty bits on clean shutdown (Mike Snitzer) [1038227] - [md] dm-cache: avoid calling policy destructor twice on error (Mike Snitzer) [1038227] - [md] dm-cache: detect cache_create failure (Mike Snitzer) [1038227] - [md] dm-cache: avoid 64 bit division on 32 bit (Mike Snitzer) [1038227] - [md] dm-cache: add cleaner policy (Mike Snitzer) [1038227] - [md] dm-cache: add mq policy (Mike Snitzer) [1038227] - [md] dm: add cache target (Mike Snitzer) [1038227] - [md] dm-persistent-data: add bitset (Mike Snitzer) [1038227] - [md] dm-persistent-data: add transactional array (Mike Snitzer) [1038227] - [md] dm-log-userspace: allow mark requests to piggyback on flush requests (Mike Snitzer) [1057707] - [md] dm-sysfs: fix a module unload race (Mike Snitzer) [1057707] - [md] dm-snapshot: use dm-bufio prefetch (Mike Snitzer) [1057707] - [md] dm-snapshot: use dm-bufio (Mike Snitzer) [1057707] - [md] dm-snapshot: prepare for switch to using dm-bufio (Mike Snitzer) [1057707] - [md] dm-snapshot: use GFP_KERNEL when initializing exceptions (Mike Snitzer) [1057707] - [md] dm: wait until embedded kobject is released before destroying a device (Mike Snitzer) [1057707] - [md] dm: remove pointless kobject comparison in dm_get_from_kobject (Mike Snitzer) [1057707] - [md] dm-table: remove unused buggy code that extends the targets array (Mike Snitzer) [1057707] - [md] dm-stats: initialize read-only module parameter (Mike Snitzer) [1057707] - [md] dm-table: fail dm_table_create on dm_round_up overflow (Mike Snitzer) [1057707] - [md] dm-snapshot: avoid snapshot space leak on crash (Mike Snitzer) [1057707] - [md] dm-delay: fix a possible deadlock due to shared workqueue (Mike Snitzer) [1057707] - [md] dm: allow remove to be deferred (Mike Snitzer) [1057707] - [md] dm-mpath: requeue I_O during pg_init (Mike Snitzer) [1057707] - [md] dm-mpath: fix race condition between multipath_dtr and pg_init_done (Mike Snitzer) [1057707] - [md] dm: allocate buffer for messages with small number of arguments using GFP_NOIO (Mike Snitzer) [1057707] - [md] dm: add reserved_bio_based_ios module parameter (Mike Snitzer) [1057707] - [md] dm: add reserved_rq_based_ios module parameter (Mike Snitzer) [1057707] - [md] dm: lower bio-based mempool reservation (Mike Snitzer) [1057707] - [md] dm-snapshot: fix performance degradation due to small hash size (Mike Snitzer) [1057707] - [md] dm-stats: fix possible counter corruption on 32-bit systems (Mike Snitzer) [1057707] - [md] dm-mpath: do not fail path on -ENOSPC (Mike Snitzer) [1057707] - [scsi] Return ENODATA on medium error (Mike Snitzer) [1057707] - [scsi] return ENOSPC on thin provisioning failure (Mike Snitzer) [1057707] - [scsi] Set hostbyte status in scsi_check_sense() (Mike Snitzer) [1057707] - [scsi] Document enhanced error codes (Mike Snitzer) [1057707] - [md] dm-stripe: silence a couple sparse warnings (Mike Snitzer) [1057707] - [md] dm: add statistics support (Mike Snitzer) [1057707] - [md] math64: New separate div64_u64_rem helper (Mike Snitzer) [1057707] - [md] dm-ioctl: cleanup error handling in table_load (Mike Snitzer) [1057707] - [md] dm-ioctl: increase granularity of type_lock when loading table (Mike Snitzer) [1057707] - [md] dm-ioctl: prevent rename to empty name or uuid (Mike Snitzer) [1057707] - [md] dm: allow error target to replace bio-based and request-based targets (Mike Snitzer) [1057707] - [md] bump ioctl version from "dm: optimize use SRCU and RCU" (Mike Snitzer) [1057707] - [md] dm: document iterate_devices (Mike Snitzer) [1057707]- [fs] xfs: prevent stack overflows from page cache allocation (Eric Sandeen) [1020574] - [fs] gfs2: Fix uninitialized VFS inode in gfs2_create_inode (Abhijith Das) [1059808] - [fs] cifs: mask off top byte in get_rfc1002_length() (Sachin Prabhu) [1069737] - [fs] nfs: add memory barriers around NFS_INO_INVALID_DATA and NFS_INO_INVALIDATING (Jeff Layton) [908603] - [fs] nfs: Fix races in nfs_revalidate_mapping (Jeff Layton) [908603] - [fs] nfs: fix the handling of NFS_INO_INVALID_DATA flag in nfs_revalidate_mapping (Jeff Layton) [908603] - [fs] nfs: don't invalidate dentries that act as mountpoints (Jeff Layton) [1023276] - [kernel] Prevent deadlock when post_schedule_rt() results in calling wakeup_kswapd() on multiple CPUs (Larry Woodman) [1009626] - [s390] cio: Fix missing subchannels after CHPID configure on (Hendrik Brueckner) [1076468] - [scsi] AACRAID Driver compat IOCTL missing capability check (Jacob Tanenbaum) [1033534] {CVE-2013-6383} - [ata] libata: Include WWN ID in inquiry VPD emulation (David Milburn) [1032443] - [acpi] ipmi: Fix atomic context requirement of ipmi_msg_handler() (Tony Camuso) [868399 968459] - [x86] hyperv: bypass the timer_irq_works() check (Jason Wang) [1040349] - [netdrv] iwlwifi: don't return -ERFKILL if SEND_IF_RFKILL is set (Stanislaw Gruszka) [1065147] - [netdrv] iwlwifi: fix initialisation while RF-kill is asserted (Stanislaw Gruszka) [1065147] - [cpufreq] Invoke __cpufreq_remove_dev_finish() after releasing cpu_hotplug.lock (Petr Oros) [1051352] - [cpufreq] Split __cpufreq_remove_dev() into two parts (Petr Oros) [1051352] - [cpufreq] Fix sysfs deadlock with concurrent hotplug/frequency switch (Petr Oros) [1051352] - [acpi] Enhance ACPI warning for memory/IO address conflicts (Prarit Bhargava) [1033939] - [acpi] acpica: Add support for region address conflict checking (Prarit Bhargava) [1033939] - [firmware] dmi: kernel parameter smbios_26_uuid needs to be early_param (Prarit Bhargava) [1030721] - [serial] 8250: Add support for Broadcom TruManage redirected serial port (Prarit Bhargava) [953260] - [x86] cpu: Always print SMP information in /proc/cpuinfo (Prarit Bhargava) [1073898] - [Documentation] alt-smp-once should be alt-smp-boot (Prarit Bhargava) [1027505] - [pci] irq_remapping: Clean up x2apic opt-out security warning mess (Prarit Bhargava) [907549] - [block] nvme: fixup build warnings (David Milburn) [1014725]- [md] dm-thin: sort the per thin deferred bios using an rb_tree (Mike Snitzer) [1060381] - [md] dm-thin: use per thin device deferred bio lists (Mike Snitzer) [1060381] - [md] dm-thin: simplify pool_is_congested (Mike Snitzer) [1060381] - [md] dm-thin: fix dangling bio in process_deferred_bios error path (Mike Snitzer) [1060381] - [md] dm-thin: take care to copy the space map root before locking the superblock (Mike Snitzer) [1060381] - [md] dm-transaction-manager: fix corruption due to non-atomic transaction commit (Mike Snitzer) [1060381] - [md] dm-space-map-metadata: fix refcount decrement below 0 which caused corruption (Mike Snitzer) [1060381] - [md] dm-thin: fix Documentation for held metadata root feature (Mike Snitzer) [1060381] - [md] dm-thin: fix noflush suspend IO queueing (Mike Snitzer) [1060381] - [md] dm-thin: fix deadlock in __requeue_bio_list (Mike Snitzer) [1060381] - [md] dm-thin: fix out of data space handling (Mike Snitzer) [1060381] - [md] dm-thin: ensure user takes action to validate data and metadata consistency (Mike Snitzer) [1060381] - [md] dm-thin: synchronize the pool mode during suspend (Mike Snitzer) [1060381] - [md] fix Kconfig indentation (Mike Snitzer) [1060381] - [md] dm-thin: allow metadata space larger than supported to go unused (Mike Snitzer) [1060381] - [md] dm-thin: fix the error path for the thin device constructor (Mike Snitzer) [1060381] - [md] dm-thin: avoid metadata commit if a pool's thin devices haven't changed (Mike Snitzer) [1060381] - [md] dm-space-map-metadata: fix bug in resizing of thin metadata (Mike Snitzer) [1060381] - [md] dm-thin: fix pool feature parsing (Mike Snitzer) [1060381] - [md] dm-space-map-metadata: fix extending the space map (Mike Snitzer) [1060381] - [md] dm-space-map-common: make sure new space is used during extend (Mike Snitzer) [1060381] - [md] dm-thin: fix set_pool_mode exposed pool operation races (Mike Snitzer) [1060381] - [md] dm-thin: eliminate the no_free_space flag (Mike Snitzer) [1060381] - [md] dm-thin: add error_if_no_space feature (Mike Snitzer) [1060381] - [md] dm-thin: requeue bios to DM core if no_free_space and in read-only mode (Mike Snitzer) [1060381] - [md] dm-thin: cleanup and improve no space handling (Mike Snitzer) [1060381] - [md] dm-thin: log info when growing the data or metadata device (Mike Snitzer) [1060381] - [md] dm-thin: handle metadata failures more consistently (Mike Snitzer) [1060381] - [md] dm-thin: factor out check_low_water_mark and use bools (Mike Snitzer) [1060381] - [md] dm-thin: add mappings to end of prepared_* lists (Mike Snitzer) [1060381] - [md] dm-thin: return error from alloc_data_block if pool is not in write mode (Mike Snitzer) [1060381] - [md] dm-thin: use bool rather than unsigned for flags in structures (Mike Snitzer) [1060381] - [md] dm-persistent-data: cleanup dm-thin specific references in text (Mike Snitzer) [1060381] - [md] dm-space-map-metadata: limit errors in sm_metadata_new_block (Mike Snitzer) [1060381] - [md] dm-thin: fix discard support to a previously shared block (Mike Snitzer) [1060381] - [md] dm-thin: initialize dm_thin_new_mapping returned by get_next_mapping (Mike Snitzer) [1060381] - [md] dm-space-map: disallow decrementing a reference count below zero (Mike Snitzer) [1060381] - [md] dm-thin: allow pool in read-only mode to transition to read-write mode (Mike Snitzer) [1060381] - [md] dm-thin: re-establish read-only state when switching to fail mode (Mike Snitzer) [1060381] - [md] dm-thin: always fallback the pool mode if commit fails (Mike Snitzer) [1060381] - [md] dm-thin: switch to read-only mode if metadata space is exhausted (Mike Snitzer) [1060381] - [md] dm-thin: switch to read only mode if a mapping insert fails (Mike Snitzer) [1060381] - [md] dm-space-map-metadata: return on failure in sm_metadata_new_block (Mike Snitzer) [1060381] - [md] dm-space-map-disk: optimise sm_disk_dec_block (Mike Snitzer) [1060381] - [md] dm-table: print error on preresume failure (Mike Snitzer) [1060381] - [md] dm-thin: do not expose non-zero discard limits if discards disabled (Mike Snitzer) [1060381] - [md] dm-thin: always return -ENOSPC if no_free_space is set (Mike Snitzer) [1060381] - [md] dm-thin: set pool read-only if breaking_sharing fails block allocation (Mike Snitzer) [1060381] - [md] dm-thin: prefix pool error messages with pool device name (Mike Snitzer) [1060381] - [md] dm-space-map: optimise sm_ll_dec and sm_ll_inc (Mike Snitzer) [1060381] - [md] dm-btree: prefetch child nodes when walking tree for a dm_btree_del (Mike Snitzer) [1060381] - [md] dm-btree: use pop_frame in dm_btree_del to cleanup code (Mike Snitzer) [1060381] - [md] dm-thin: fix stacking of geometry limits (Mike Snitzer) [1060381] - [md] dm-thin: add data block size limits to Documentation (Mike Snitzer) [1060381] - [md] dm-thin: fix metadata dev resize detection (Mike Snitzer) [1060381] - [md] dm-thin: generate event when metadata threshold passed (Mike Snitzer) [1060381] - [md] dm-persistent-metadata: add space map threshold callback (Mike Snitzer) [1060381] - [md] dm-persistent-data: add threshold callback to space map (Mike Snitzer) [1060381] - [md] dm-thin: detect metadata device resizing (Mike Snitzer) [1060381] - [md] dm-persistent-data: support space map resizing (Mike Snitzer) [1060381] - [md] dm-thin: refactor data dev resize (Mike Snitzer) [1060381] - [md] dm-bufio: initialize read-only module parameters (Mike Snitzer) [1060381] - [md] dm-bufio: submit writes outside lock (Mike Snitzer) [1060381] - [md] dm-bufio: add recursive IO request BUG_ON (Mike Snitzer) [1060381] - [md] dm-bufio: prefetch (Mike Snitzer) [1060381] - [md] dm-bufio: fix slow IO latency issue specific to RHEL6 (Mike Snitzer) [1058528] - [netdrv] tun: fix LSM/SELinux labeling of tun/tap devices (Vlad Yasevich) [1004625] - [netdrv] tuntap: fix leaking reference count (Vlad Yasevich) [1004625] - [netdrv] tun: release the reference of tun device in tun_recvmsg (Vlad Yasevich) [1004625] - [netdrv] tuntap: move socket to tun_file (Vlad Yasevich) [1004625] - [netdrv] tun: don't hold network namespace by tun sockets (Vlad Yasevich) [1004625] - [char] tty: Correct tty buffer flush (Prarit Bhargava) [999913]- [vhost] validate vhost_get_vq_desc return value (Michael S. Tsirkin) [1058677] {CVE-2014-0055} - [net] ip_gre: fix msg_name parsing for recvfrom/recvmsg (Jiri Pirko) [1076379] - [net] ip_tunnel: Fix a memory corruption in ip_tunnel_xmit (Jiri Pirko) [1076379] - [net] ip_gre: fix ipgre_header to return correct offset (Jiri Pirko) [1075579] - [net] gre: fix hard header destination address checking (Jiri Pirko) [1075579] - [x86] Adjust irq remapping quirk for older revisions of 5500/5520 chipsets (Neil Horman) [995262] - [x86] kvm: introduce periodic global clock updates (Andrew Jones) [1078929] - [x86] kvm: rate-limit global clock updates (Andrew Jones) [1072373] - [hid] wacom: Add reporting of wheel for Intuos4 WL (Aristeu Rozanski) [959596] - [netdrv] mlx4_en: Fixed crash when port type is changed (Amir Vadai) [1059586] - [netdrv] be2net: Warn users of possible broken functionality on BE2 cards with very old FW versions with latest driver (Ivan Vecera) [998013] - [pci] pciehp: replace unconditional sleep with config space access check (Myron Stowe) [988052] - [pci] Separate pci_bus_read_dev_vendor_id from pci_scan_device (Myron Stowe) [988052] - [pci] pciehp: wait 100 ms after Link Training check (Myron Stowe) [988052] - [pci] pciehp: wait 1000 ms before Link Training check (Myron Stowe) [988052] - [pci] pciehp: fix power fault interrupt storm problem (Myron Stowe) [988052]- [netdrv] vmxnet3: fix netpoll race condition (Neil Horman) [1073218] - [net] ip_tunnel: Remove double unregister of the fallback device (Florian Westphal) [1020426] - [net] ip_tunnel: return more precise errno value when adding tunnel fails (Florian Westphal) [1020426] - [net] ip_tunnel: Add fallback tunnels to the hash lists (Florian Westphal) [1020426] - [net] netfilter: nf_conntrack_dccp: fix skb_header_pointer API usages (Jiri Pirko) [1077346] {CVE-2014-2523} - [net] ip_tunnel: (revert old)/fix ecn decapsulation behaviour (Jiri Pirko) [1059402] - [net] ipvs: Add missing locking during connection table hashing and unhashing (Jesper Brouer) [1069874] - [net] don't send NEWLINK in UNREGISTER_BATCH case (Florian Westphal) [1062254] - [net] openvswitch: Use flow hash during flow lookup operation (Francesco Fusco) [1002053] - [net] openvswitch: TCP flags matching support (Francesco Fusco) [1002053] - [net] openvswitch: Widen TCP flags handling (Francesco Fusco) [1002053] - [net] openvswitch: Enable all GSO features on internal port (Francesco Fusco) [1002053] - [net] openvswitch: collect mega flow mask stats (Francesco Fusco) [1002053] - [net] openvswitch: Simplify mega-flow APIs (Francesco Fusco) [1002053] - [net] openvswitch: Move mega-flow list out of rehashing struct (Francesco Fusco) [1002053] - [net] openvswitch: Restructure datapath.c and flow.c (Francesco Fusco) [1002053] - [net] openvswitch: remove duplicated include from vport-gre.c (Francesco Fusco) [1002053] - [net] openvswitch: remove duplicated include from vport-vxlan.c (Francesco Fusco) [1002053] - [net] openvswitch: Move flow table rehashing to flow install (Francesco Fusco) [1002053] - [net] openvswitch: flow: fix potential illegal memory access in __parse_flow_nlattrs (Francesco Fusco) [1002053] - [net] openvswitch: Fix alignment of struct sw_flow_key (Francesco Fusco) [1002053] - [net] openvswitch: optimize flow compare and mask functions (Francesco Fusco) [1002053] - [net] openvswitch: Rename key_len to key_end (Francesco Fusco) [1002053] - [net] openvswitch: Add SCTP support (Francesco Fusco) [1002053] - [net] ipv6: Add NEXTHDR_SCTP to ipv6.h (Francesco Fusco) [1002053] - [net] sctp: Refactor SCTP skb checksum computation (Francesco Fusco) [1002053] - [net] sctp: prevent checksum.h from double inclusion (Francesco Fusco) [1002053] - [net] openvswitch: Mega flow implementation (Francesco Fusco) [1002053] - [net] openvswitch: Use non rcu hlist_del() flow table entry (Francesco Fusco) [1002053] - [net] openvswitch: Use RCU lock for flow dump operation (Francesco Fusco) [1002053] - [net] openvswitch: Use parallel_ops genl (Francesco Fusco) [1002053] - [net] genl: Allow concurrent genl callbacks (Francesco Fusco) [1002053] - [net] ipv6: del unreachable route when an addr is deleted on lo (Vivek Dasgupta) [1028372] - [net] ipv6: add ip6_route_lookup (Vivek Dasgupta) [1028372] - [net] ethtool: added support for 40GbE link (Nikolay Aleksandrov) [1024039] - [scsi] megaraid_sas: fix a small problem when reading state value from hw (Tomas Henzl) [1065187] - [fs] gfs2: Increase the max number of ACLs (Robert S Peterson) [1075713] - [kernel] hrtimers: Move SMP function call to thread context (Mateusz Guzik) [1073129] - [kernel] hrtimers: Support resuming with two or more CPUs online (Mateusz Guzik) [1073129]- [net] sctp: fix sctp_sf_do_5_1D_ce to verify if peer is AUTH capable (Daniel Borkmann) [1067451] {CVE-2014-0101} - [fs] dcache: fix cleanup on warning in d_splice_alias (J. Bruce Fields) [1042731] - [fs] ext4: Fix buffer head leaks after calls to ext4_get_inode_loc() (Eric Sandeen) [1058583] - [fs] autofs4: fix device ioctl mount lookup (Ian Kent) [999708] - [fs] vfs: introduce kern_path_mountpoint() (Ian Kent) [999708] - [fs] vfs: rename user_path_umountat() to user_path_mountpoint_at() (Ian Kent) [999708] - [fs] vfs: massage umount_lookup_last() a bit to reduce nesting (Ian Kent) [999708] - [fs] vfs: allow umount to handle mountpoints without revalidating them (Ian Kent) [999708] - [net] ip, ipv6: handle gso skbs in forwarding path (Florian Westphal) [1029603] - [net] introduce netif_skb_dev_features (Florian Westphal) [1029603] - [net] add and use skb_gso_transport_seglen() (Florian Westphal) [1029603] - [net] bridge: apply multicast snooping to IPv6 link-local, too (Francesco Fusco) [1020579] - [net] bridge: fix mdb info leaks (Francesco Fusco) [1020579] - [net] bridge: fix a possible use after free (Francesco Fusco) [1020579] - [net] bridge: Pseudo-header required for the checksum of ICMPv6 (Francesco Fusco) [1020579] - [net] bridge: correct IPv6 checksum after pull (Francesco Fusco) [1020579] - [net] bridge: Do not send queries on multicast group leaves (Francesco Fusco) [1020579] - [net] bridge: Fix return values of br_multicast_add_group/br_multicast_new_group (Francesco Fusco) [1020579] - [net] bridge: don't try to update timers in case of broken MLD queries (Francesco Fusco) [1020579] - [net] bridge: prevent flooding IPv6 packets that do not have a listener (Francesco Fusco) [1020579] - [net] ipv6: mcast: use in6_dev_put in timer handlers instead of __in6_dev_put (Florian Westphal) [1026520] - [net] ipv6: mld: document force_mld_version in ip-sysctl.txt (Florian Westphal) [1026520] - [net] ipv6: mld: introduce mld_*_stop_timer functions (Florian Westphal) [1026520] - [net] ipv6: mld: refactor query processing into v1/v2 functions (Florian Westphal) [1026520] - [net] ipv6: mld: similarly to MLDv2 have min max_delay of 1 (Florian Westphal) [1026520] - [net] ipv6: mld: implement RFC3810 MLDv2 mode only (Florian Westphal) [1026520] - [net] ipv6: mld: get rid of MLDV2_MRC and simplify calculation (Florian Westphal) [1026520] - [net] ipv6: mld: clean up MLD_V1_SEEN macro (Florian Westphal) [1026520] - [net] ipv6: mld: fix v1/v2 switchback timeout to rfc3810, 9.12 (Florian Westphal) [1026520] - [net] ipv6: mcast: minor: use defines for rfc3810/8.1 lengths (Florian Westphal) [1026520] - [net] ipv6: minor: *_start_timer: rather use unsigned long (Florian Westphal) [1026520] - [net] ipv4: processing ancillary IP_TOS or IP_TTL (Francesco Fusco) [990694] - [net] ipv4: IP_TOS and IP_TTL can be specified as ancillary data (Francesco Fusco) [990694] - [net] netfilter: nf_conntrack: avoid large timeout for mid-stream pickup (Jiri Benc) [1033869] - [net] tcp: preserve ACK clocking in TSO (Jesper Brouer) [1015147] - [documentation] add missing documentation about network stack scaling (Ivan Vecera) [961555] - [netdrv] bonding: check for vlan device in bond_3ad_lacpdu_recv() (Veaceslav Falico) [1050224] - [netdrv] bonding: move bond_compute_features out of locks (Veaceslav Falico) [1021442] - [netdrv] bnx2: remove unnecessary pci_set_drvdata() (Neil Horman) [1054555] - [netdrv] bnx2: Miscellaneous conversions to ETH_ALEN (Neil Horman) [1054555] - [netdrv] bnx2: Convert dma_alloc_coherent() to dma_zalloc_coherent (Neil Horman) [1054555] - [netdrv] bnx2: Update version to 2.2.4 (Neil Horman) [1054555] - [netdrv] bnx2: Use SIMPLE_DEV_PM_OPS (Neil Horman) [1054555] - [netdrv] bnx2: Refactor WoL setup into a separate function (Neil Horman) [1054555] - [netdrv] bnx2: Use kernel APIs for WoL and power state changes (Neil Horman) [1054555] - [netdrv] bnx2: Handle error condition in ->slot_reset() (Neil Horman) [1054555] - [netdrv] bnx2: use pdev->pm_cap instead of pci_find_capability() (Neil Horman) [1054555] - [netdrv] bnx2: Use module_pci_driver to register driver (Neil Horman) [1054555] - [netdrv] bnx2: make cnic_probe static (Neil Horman) [1054555] - [netdrv] bnx2: Fix accidental reversions (Neil Horman) [1054555]- [net] sctp: fix sctp_connectx abi for ia32 emulation/compat mode (Daniel Borkmann) [1053547] - [net] packet: improve socket create/bind latency in some cases (Daniel Borkmann) [1045150] - [net] filter: let bpf_tell_extensions return SKF_AD_MAX (Daniel Borkmann) [960275] - [net] introduce SO_BPF_EXTENSIONS (Daniel Borkmann) [960275] - [net] tcp_probe: adapt tbuf size for recent changes (Daniel Borkmann) [1000466] - [net] tcp_probe: allow more advanced ingress filtering by mark (Daniel Borkmann) [1000466] - [net] tcp_probe: add IPv6 support (Daniel Borkmann) [1000466] - [net] tcp_probe: kprobes: adapt jtcp_rcv_established signature (Daniel Borkmann) [1000466] - [net] tcp_probe: also include rcv_wnd next to snd_wnd (Daniel Borkmann) [1000466] - [net] tcp_probe: cleanup snprintf() use (Daniel Borkmann) [1000466] - [net] tcp_probe: avoid modulus operation and wrap fix (Daniel Borkmann) [1000466] - [lib] vsprintf: add IPv4/v6 generic format specifier (Daniel Borkmann) [1000466] - [lib] vsprintf: Add IPV4 options for host, network, big and little endian (Daniel Borkmann) [1000466] - [lib] vsprintf: Update pI6c to not compress a single 0 (Daniel Borkmann) [1000466] - [net] netfilter: nf_conntrack: use RCU safe kfree for conntrack extensions (Jesper Brouer) [1015122] - [scsi] vmw_pvscsi: Fix pvscsi_abort() function (Ewan Milne) [1002727] - [scsi] scsi_dh: cosmetic change to sizeof() (Ewan Milne) [1062494] - [scsi] scsi_dh_alua: Add module parameter to allow failover to non preferred path without STPG (Maurizio Lombardi) [1020554] - [x86] Support Silvermont (Neil Horman) [1048304] - [netdrv] bonding: don't permit to use ARP monitoring in 802.3ad mode (Veaceslav Falico) [1029315] - [security] audit: suppress stock memalloc failure warnings since already managed (Richard Guy Briggs) [890899] - [kernel] sched: Avoid throttle_cfs_rq() racing with period_timer stopping (Seth Jennings) [844450] - [hv] ballon: Make pressure posting thread sleep interruptibly (Luiz Capitulino) [1065274] - [virt] virtio_balloon: fix handling of PAGE_SIZE != 4k (Steve Best) [1034793] - [virt] virtio_balloon: Fix endian bug (Steve Best) [1034793] - [kvm] x86: emulator: Implement jmp far opcode ff/5 (Laszlo Ersek) [1059496] - [kvm] x86: emulator: Add decoding of 16bit second in memory argument (Laszlo Ersek) [1059496] - [virt] xenfv: cpuid filtering, allow 'em all on v4 (Andrew Jones) [1064971] - [virt] xenfv: cpuid filtering, check xen major version (Andrew Jones) [1064971] - [kernel] errno.h: remove "NFS" from descriptions in comments (Eric Sandeen) [1009681] - [virt] xen: mask x2APIC feature in PV (Andrew Jones) [1061348 1064974] - [virt] xen: filter APERFMPERF cpuid feature out (Andrew Jones) [1061348 1064974] - [virt] xenpv: fix xen_cpuid mwait leaf case (Andrew Jones) [1061348 1064974] - [virt] xenpv: improve xsave detection (Andrew Jones) [1061348 1064974] - [virt] xen: mask the MTRR feature from the cpuid (Andrew Jones) [1061348 1064974] - [s390] crypto: Fix aes-xts parameter corruption (Hendrik Brueckner) [1043540] - [x86] crypto: xor - Check for osxsave as well as avx in crypto/xor (Andrew Jones) [1061348] - [x86] add cpu_has_osxsave (Andrew Jones) [1061348] - [virt] revert "xen: don't touch xsave in cr4" (Andrew Jones) [1061348] - [virt] revert "xen: mask cpu feature avx" (Andrew Jones) [1061348] - [x86] intel-iommu: fix off-by-one in pagetable freeing (Marcelo Tosatti) [635846] - [x86] intel-iommu: Free old page tables before creating superpage (Marcelo Tosatti) [635846] - [x86] amd-iommu: Fix memory leak in free_pagetable (Marcelo Tosatti) [635846] - [x86] kvm: iommu: hva align mapping page size (Marcelo Tosatti) [635846] - [x86] intel-iommu: fix return value of iommu_unmap() API (Marcelo Tosatti) [635846] - [x86] intel-iommu: Fix leaks in pagetable freeing (Marcelo Tosatti) [635846] - [x86] amd-iommu: Make iommu_map_page and alloc_pte aware of page sizes (Marcelo Tosatti) [635846] - [x86] intel-iommu: fix superpage support in pfn_to_dma_pte() (Marcelo Tosatti) [635846] - [x86] intel-iommu: set iommu_superpage on VM domains to lowest common denominator (Marcelo Tosatti) [635846] - [x86] intel-iommu: Enable super page support (Marcelo Tosatti) [635846] - [x86] kvm: Fix order passed to iommu_unmap (Marcelo Tosatti) [635846] - [x86] kvm: Change kvm_iommu_map_pages to map large pages (Marcelo Tosatti) [635846] - [x86] vt-d: Change map_range functions to implement map interface (Marcelo Tosatti) [635846] - [x86] iommu-api: Add ->*map callbacks to iommu_ops (Marcelo Tosatti) [635846] - [x86] iommu-api: Add iommu_map and iommu_unmap functions (Marcelo Tosatti) [635846] - [x86] iommu-api: Rename ->*map function pointers to ->*map_range (Marcelo Tosatti) [635846] - [x86] kvm: Introduce kvm_host_page_size (Marcelo Tosatti) [635846] - [x86] kvm: Enable EPT 1GB page support (Marcelo Tosatti) [998745] - [x86] kvm: Rename gb_page_enable() to get_lpage_level() in kvm_x86_ops (Marcelo Tosatti) [998745] - [x86] kvm: Moving PT_*_LEVEL to mmu.h (Marcelo Tosatti) [998745]- [edac] sb_edac: add support for Ivy Bridge (Aristeu Rozanski) [1005266] - [edac] sb_edac: avoid decoding the same error multiple times (Aristeu Rozanski) [1005266] - [edac] sb_edac: rename mci_bind_devs() (Aristeu Rozanski) [1005266] - [edac] sb_edac: enable multiple PCI id tables to be used (Aristeu Rozanski) [1005266] - [edac] sb_edac: rework sad_pkg (Aristeu Rozanski) [1005266] - [edac] sb_edac: allow different interleave lists (Aristeu Rozanski) [1005266] - [edac] sb_edac: allow different dram_rule arrays (Aristeu Rozanski) [1005266] - [edac] sb_edac: isolate TOHM retrieval (Aristeu Rozanski) [1005266] - [edac] sb_edac: rename pci_br (Aristeu Rozanski) [1005266] - [edac] sb_edac: isolate TOLM retrieval (Aristeu Rozanski) [1005266] - [edac] sb_edac: make RANK_CFG_A value part of sbridge_info (Aristeu Rozanski) [1005266] - [char] tty: ldisc, wait for ldisc infinitely in hangup (Aristeu Rozanski) [983146] - [char] tty: ldisc, move wait idle to caller (Aristeu Rozanski) [983146] - [char] tty: ldisc, allow waiting for ldisc arbitrarily long (Aristeu Rozanski) [983146] - [char] tty: ldisc, do not close until there are readers (Aristeu Rozanski) [983146] - [char] tty: restore tty_ldisc_wait_idle (Aristeu Rozanski) [983146] - [acpi] thermal: Check for thermal zone requirement (Nigel Croxon) [1021044] - [acpi] thermal: Don't invalidate thermal zone if critical trip point is bad (Nigel Croxon) [1021044] - [powerpc] mm: Fix mmap errno when MAP_FIXED is set and mapping exceeds the allowed address space (Jerome Marchand) [848316] - [mm] add overcommit_kbytes sysctl variable (Jerome Marchand) [967101] - [mm] factor commit limit calculation (Jerome Marchand) [967101] - [kernel] futex: fix handling of read-only-mapped hugepages (Andrea Arcangeli) [1045050] - [mm] flush pages from pagevec of offlined CPU (Naoya Horiguchi) [1037467] - [fs] Change fsnotify() to call fsnotify_create_event() with GFP_NOFS instead of GFP_KERNEL (Larry Woodman) [1032264] - [x86] Stop recursive fault in print_context_stack after stack overflow (Aaron Tomlin) [1028407] - [mm] fix BUG in __split_huge_page_pmd (Andrea Arcangeli) [949735] - [fs] GFS2: Lock i_mutex and use a local gfs2_holder for fallocate (Robert S Peterson) [1061910] - [fs] xfs: deprecate nodelaylog option (Eric Sandeen) [1055644] - [fs] nfsd: fix a race between returning and breaking the same delegation (Scott Mayhew) [914772] - [fs] cifs: escaping special characters in cifs_show_options (Cedric Buissart) [1023373] - [fs] ext4: fix WARN_ON from ext4_releasepage() (Carlos Maiolino) [1036814] - [scsi] sg: Fix user memory corruption when SG_IO is interrupted by a signal (David Milburn) [913199] - [fs] vfs: fix getname() && do_getname() interaction (Oleg Nesterov) [1024689] - [fs] ext3: pass custom EOF to generic_file_llseek_size() (Eric Sandeen) [1007459] - [fs] ext4: use core vfs llseek code for dir seeks (Eric Sandeen) [1007459] - [fs] vfs: allow custom EOF in generic_file_llseek code (Eric Sandeen) [1007459] - [fs] ext3: return 32/64-bit dir name hash according to usage type (Eric Sandeen) [1007459] - [fs] ext4: replace cut'n'pasted llseek code with generic_file_llseek_size (Eric Sandeen) [1007459] - [fs] vfs: add generic_file_llseek_size (Eric Sandeen) [1007459]- [x86] apic: Make disabled_cpu_apicid static read_mostly, fix typos (Nigel Croxon) [980621] - [x86] kexec: Add disable_cpu_apicid kernel parameter (Nigel Croxon) [980621] - [net] neigh: fix setting of default gc_* values (Jiri Pirko) [1070363] - [net] ipv4: fix route deletion for IPs on many subnets (Jiri Benc) [1056443] - [net] ipv4: match prefsrc when deleting routes (Jiri Benc) [1056443] - [net] tcp: tsq: restore minimal amount of queueing (Jiri Pirko) [1044053] - [net] ipv6: fix potential use after free in tcp_v6_do_rcv (Jiri Benc) [1004164] - [net] ipv6: Use ipv6_get_dsfield() instead of ipv6_tclass() (Jiri Benc) [1004164] - [fs] proc: meminfo: provide estimated available memory (Luiz Capitulino) [1032702] - [mm] vmscan: re-introduce the ZONE_RECLAIM_NOSCAN bailout for zone_reclaim() (Rafael Aquini) [1039534] - [mm] vmscan: compaction works against zones, not lruvecs (Johannes Weiner) [982770]- [fs] Fix mountpoint reference leakage in linkat (Jeff Layton) [1059943] - [net] sock: Fix release_cb kABI brekage (Thomas Graf) [1039723] - [kvm] x86: use kvm_read/write_guest_virt_system in task switch (Paolo Bonzini) [1018581] - [kvm] x86: small cleanups to kvm_task_switch (Paolo Bonzini) [1018581] - [kvm] x86: propagate error from kvm_load_segment_descriptor (Paolo Bonzini) [1018581] - [kvm] x86: improve save_guest_segment_descriptor (Paolo Bonzini) [1018581] - [kvm] x86: introduce kvm_write_guest_virt_system (Paolo Bonzini) [1018581] - [kvm] x86: Fix task switch privilege checks (Paolo Bonzini) [1018581]- [powerpc] Make function that parses RTAS error logs global (Steve Best) [1028682] - [powerpc] pseries: Add RTAS event log v6 definition (Steve Best) [1028682] - [powerpc] pseries: Parse and handle EPOW interrupts (Steve Best) [1028682] - [net] loopback: set default mtu to 64K (Jiri Pirko) [1057610] - [net] netpoll: take rcu_read_lock_bh() in netpoll_send_skb_on_dev() (Florian Westphal) [1049052] - [net] tcp: call tcp_replace_ts_recent() from tcp_ack() (Jiri Pirko) [1056516] - [net] tcp: accept RST without ACK flag (Jiri Pirko) [890377] - [net] tcp: should drop incoming frames without ACK flag set (Jiri Pirko) [890377] - [fs] cifs: sanity check length of data to send before sending (Sachin Prabhu) [1062590] {CVE-2014-0069} - [fs] cifs: ensure that uncached writes handle unmapped areas correctly (Sachin Prabhu) [1062590] {CVE-2014-0069} - [fs] xfs: xfs_remove deadlocks due to inverted AGF vs AGI lock ordering (Brian Foster) [1059334]- [pci] Retry allocation of only the resource type that failed (Myron Stowe) [1033748] - [pci] cleanup assign_requested_resources_sorted() kernel-doc warning (Myron Stowe) [1033748] - [pci] add a PCI resource reallocation config option (Myron Stowe) [1033748] - [pci] print out suggestion about using pci=realloc (Myron Stowe) [1033748] - [pci] prepare pci=realloc for multiple options (Myron Stowe) [1033748] - [pci] Retry on IORESOURCE_IO type allocations (Myron Stowe) [1033748] - [pci] Skip cardbus assigned resource reset during pci bus rescan (Myron Stowe) [1033748] - [pci] Fix "cardbus bridge resources as optional" size handling (Myron Stowe) [1033748] - [pci] Disable cardbus bridge MEM1 prefetchable bit (Myron Stowe) [1033748] - [pci] Fix /sys warning when sriov enabled and card is hot removed (Myron Stowe) [1033748] - [pci] remove add_to_failed_list() (Myron Stowe) [1033748] - [pci] add debug print out for add_size (Myron Stowe) [1033748] - [pci] make free_list() into a function (Myron Stowe) [1033748] - [pci] Rename dev_res_x to add_res or fail_res (Myron Stowe) [1033748] - [pci] Merge pci_dev_resource_x and pci_dev_resource (Myron Stowe) [1033748] - [pci] Replace resource_list with generic list (Myron Stowe) [1033748] - [pci] Move struct resource_list to setup-bus.c (Myron Stowe) [1033748] - [pci] Move pdev_sort_resources() to setup-bus.c (Myron Stowe) [1033748] - [pci] make re-allocation try harder by reassigning ranges higher (Myron Stowe) [1033748] - [pci] Make pci_rescan_bus handle add_list (Myron Stowe) [1033748] - [pci] Make rescan bus increase bridge resource size if needed (Myron Stowe) [1033748] - [pci] Use add_list in pcie hotplug path (Myron Stowe) [1033748] - [pci] try to assign required+option size first (Myron Stowe) [1033748] - [pci] Move get_res_add_size() function (Myron Stowe) [1033748] - [pci] Make add_to_list() return status (Myron Stowe) [1033748] - [pci] Calculate right add_size (Myron Stowe) [1033748] - [pci] set pci sriov page size before reading SRIOV BAR (Myron Stowe) [1033748] - [pci] delay configuration of SRIOV capability (Myron Stowe) [1033748] - [pci] Fix hotplug of Express Module with pci bridges (Myron Stowe) [1033748] - [pci] defer enablement of SRIOV BARS (Myron Stowe) [1033748] - [pci] Make pci_setup_bridge() non-static for use by arch code (Myron Stowe) [1033748] - [pci] code and comments cleanup (Myron Stowe) [1033748] - [pci] make cardbus-bridge resources optional (Myron Stowe) [1033748] - [pci] make SRIOV resources optional (Myron Stowe) [1033748] - [pci] ability to relocate assigned pci-resources (Myron Stowe) [1033748] - [pci] honor child buses add_size in hot plug configuration (Myron Stowe) [1033748] - [pci] remove printks about disabled bridge windows (Myron Stowe) [1033748] - [pci] ability to resize an allocated resource (Myron Stowe) [1033748] - [pci] pciehp: cleanup flow in pciehp_configure_device (Myron Stowe) [1033748] - [pci] Combined back-port of changes to drivers/pci/setup-bus.c to end up in sync with upstream at commit f483d39 (Myron Stowe) [1033748] - [pci] set PCI_PREF_RANGE_TYPE_64 in pci_bridge_check_ranges (Myron Stowe) [1033748] - [pci] rework "pci: add failed_list to pci_bus_assign_resources" (Myron Stowe) [1033748] - [pci] rework "pci: add pci_bridge_release_resources and pci_bus_release_bridge_resources" (Myron Stowe) [1033748] - [pci] rework "pci: separate pci_setup_bridge to small functions" (Myron Stowe) [1033748] - [pci] claim SR-IOV BARs in pcibios_allocate_resource (Myron Stowe) [1033748]- [x86] apic: Map the local apic when parsing the MP table (Prarit Bhargava) [1061873] - [kvm] x86: fix tsc catchup issue with tsc scaling (Marcelo Tosatti) [1005143] - [char] virtio-rng: don't register buffer if data isn't read out (Amos Kong) [1008273] - [netdrv] enic: remove enic->vlan_group check (Stefan Assmann) [1057704] - [netdrv] bonding: add NETIF_F_NO_CSUM vlan_features (Ivan Vecera) [1059777] - [infiniband] ipoib: Report operstate consistently when brought up without a link (Michal Schmidt) [995300]- [security] selinux: fix broken peer recv check (Paul Moore) [1043051] - [perf] tools: Enable branch profiling (Jiri Olsa) [1057869] - [perf] Fix hypervisor branch sampling permission check (Jiri Olsa) [1057869] - [perf] x86: Check branch sampling priv level in generic code (Jiri Olsa) [1057869] - [perf] Demand proper privileges for PERF_SAMPLE_BRANCH_KERNEL (Jiri Olsa) [1057869] - [perf] x86: Fix intel LBR filter (Jiri Olsa) [1057869] - [perf] Add callback to flush branch_stack on context switch (Jiri Olsa) [1057869] - [perf] Disable PERF_SAMPLE_BRANCH_* when not supported (Jiri Olsa) [1057869] - [perf] x86: Add LBR software filter support for Intel CPUs (Jiri Olsa) [1057869] - [perf] x86: Implement PERF_SAMPLE_BRANCH for Intel CPUs (Jiri Olsa) [1057869] - [perf] x86: Disable LBR support for older Intel Atom processors (Jiri Olsa) [1057869] - [perf] x86: Sync branch stack sampling with precise_sampling (Jiri Olsa) [1057869] - [char] n_tty: Fix unsafe update of available buffer space (Jiri Benc) [980188] - [char] n_tty: Fix stuck throttled driver (Jiri Benc) [980188] - [char] tty: Add safe tty throttle/unthrottle functions (Jiri Benc) [980188] - [char] tty: note race we need to fix (Jiri Benc) [980188] - [fs] nfsd: don't try to reuse an expired DRC entry off the list (Jeff Layton) [1036972] - [fs] nfsd: when reusing an existing repcache entry, unhash it first (Jeff Layton) [1036972] - [fs] GFS2: Fix slab memory leak in gfs2_bufdata (Robert S Peterson) [1024024] - [fs] GFS2: Fix use-after-free race when calling gfs2_remove_from_ail (Robert S Peterson) [1024024] - [fs] nfs: always make sure page is up-to-date before extending a write to cover the entire page (Scott Mayhew) [1054493] - [fs] GFS2: Increase i_writecount during gfs2_setattr_chown (Robert S Peterson) [1046168] - [fs] xfs: ensure we capture IO errors correctly (Lachlan McIlroy) [1021325] - [mm] get rid of unnecessary pageblock scanning in setup_zone_migrate_reserve (Motohiro Kosaki) [1043353]- [security] selinux: process labeled IPsec TCP SYN-ACK packets properly in selinux_ip_postroute() (Paul Moore) [1024631] - [security] selinux: look for IPsec labels on both inbound and outbound packets (Paul Moore) [1024631] - [security] selinux: handle TCP SYN-ACK packets correctly in selinux_ip_postroute() (Paul Moore) [1024631] - [security] selinux: handle TCP SYN-ACK packets correctly in selinux_ip_output() (Paul Moore) [1024631]- [edac] e752x_edac: Fix pci_dev usage count (Aristeu Rozanski) [1029530] - [md] fix lockdep warning in dm-thin (Mikulas Patocka) [952815] - [md] optimize use SRCU and RCU (Mikulas Patocka) [1011985] - [s390] mm: handle asce-type exceptions as normal page fault (Hendrik Brueckner) [1034268] - [s390] mm: correct tlb flush on page table upgrade (Hendrik Brueckner) [1034269] - [kvm] vmx: Properly return error to userspace on vmentry failure (Andrew Jones) [1054139] - [net] neigh: fix kabi breakage of the set (Jiri Pirko) [1023278] - [net] neigh: use neigh_parms_net() to get struct neigh_parms->net pointer (Jiri Pirko) [1023278] - [net] ipv4: loopback device: ignore value changes after device is upped (Jiri Pirko) [1023278] - [net] neigh: ipv6: respect default values set before an address is assigned to device (Jiri Pirko) [1023278] - [net] neigh: restore old behaviour of default parms values (Jiri Pirko) [1023278] - [net] neigh: introduce neigh_parms_family helper (Jiri Pirko) [1023278] - [net] neigh: wrap proc dointvec functions (Jiri Pirko) [1023278] - [net] neigh: do not use ctl_table->extra (Jiri Pirko) [1023278] - [net] neigh: convert parms to an array (Jiri Pirko) [1023278] - [net] fix memory information leaks in recv protocol handlers (Florian Westphal) [1039869] {CVE-2013-7271} - [net] ipv6: netfilter: ip6t_LOG: fix mark logging for IPv6 packets (Jiri Pirko) [1029970] - [net] netfilter: xt_socket: Make tproto signed in socket_mt6_v1() (Jiri Pirko) [1022201] - [net] af_unix: If we don't care about credentials coallesce all messages (Jiri Pirko) [1024635]- [mm] memcg: fix oom schedule_timeout() (Ulrich Obergfell) [1034237] - [mm] memcg: change memcg_oom_mutex to spinlock (Ulrich Obergfell) [1034237] - [mm] memcg: fix hierarchical oom locking (Ulrich Obergfell) [1034237] - [mm] memcg: make oom_lock 0 and 1 based rather than counter (Ulrich Obergfell) [1034237] - [usb] cdc-wdm: fix buffer overflow (Alexander Gordeev) [922001] {CVE-2013-1860} - [usb] cdc-wdm: Fix race between autosuspend and reading from the device (Alexander Gordeev) [922001] {CVE-2013-1860}- [perf] tools: Fix LIBNUMA build with glibc 2.12 and older (Jiri Olsa) [1034843] - [perf] probe: Fix segfault (Jiri Olsa) [1034843] - [perf] record: Fix -C option (Jiri Olsa) [1034843] - [perf] tools: check if -DFORTIFY_SOURCE=2 is allowed (Jiri Olsa) [1034843] - [perf] report: Fix build with NO_NEWT=1 (Jiri Olsa) [1034843] - [perf] annotate: Fix build with NO_NEWT=1 (Jiri Olsa) [1034843] - [perf] Enable building perf tools for Meta (Jiri Olsa) [1034843] - [perf] Enable building perf tools for ARC (Jiri Olsa) [1034843] - [perf] tools: Fix build with bison 2.3 and older (Jiri Olsa) [1034843] - [perf] tools: Limit unwind support to x86 archs (Jiri Olsa) [1034843] - [perf] annotate: Make it to be able to skip unannotatable symbols (Jiri Olsa) [1034843] - [perf] gtk/annotate: Fail early if it can't annotate (Jiri Olsa) [1034843] - [perf] gtk/annotate: Show source lines with gray color (Jiri Olsa) [1034843] - [perf] gtk/annotate: Support multiple event annotation (Jiri Olsa) [1034843] - [perf] ui/gtk: Implement basic GTK2 annotation browser (Jiri Olsa) [1034843] - [perf] annotate: Fix warning message on a missing vmlinux (Jiri Olsa) [1034843] - [perf] buildid-cache: Add --update option (Jiri Olsa) [1034843] - [perf] python: Link with sysfs.o (Jiri Olsa) [1034843] - [perf] evlist: Pass the event_group info via perf_attr_details (Jiri Olsa) [1034843] - [perf] tools: Fix calloc argument ordering (Jiri Olsa) [1034843] - [perf] tests: Adding automated parsing tests for group :GH modifiers (Jiri Olsa) [1034843] - [perf] tools: Fix perf_evsel::exclude_GH handling (Jiri Olsa) [1034843] - [perf] hists browser: Add support to display whole group data for raw columns (Jiri Olsa) [1034843] - [perf] stat: Add per processor socket count aggregation (Jiri Olsa) [1034843] - [perf] tools: Add cpu_map processor socket level functions (Jiri Olsa) [1034843] - [perf] evlist: Make event_copy local to mmaps (Jiri Olsa) [1034843] - [perf] sort: Check return value of strdup() (Jiri Olsa) [1034843] - [perf] sort: Make setup_sorting returns an error code (Jiri Olsa) [1034843] - [perf] sort: Drop ip_* arguments from _sort__sym_cmp() (Jiri Olsa) [1034843] - [perf] tools: Check for flex and bison before continuing building (Jiri Olsa) [1034843] - [perf] evlist: Fix set event list leader (Jiri Olsa) [1034843] - [perf] report: Enable the runtime switching of perf data file (Jiri Olsa) [1034843] - [perf] hists browser: Add option for runtime switching perf data file (Jiri Olsa) [1034843] - [perf] evlist: Add --group option (Jiri Olsa) [1034843] - [perf] report: Add report.group config option (Jiri Olsa) [1034843] - [perf] report: Add --group option (Jiri Olsa) [1034843] - [perf] report: Show group description when event group is enabled (Jiri Olsa) [1034843] - [perf] report: Bypass non-leader events when event group is enabled (Jiri Olsa) [1034843] - [perf] gtk/browser: Trim column header string when event group enabled (Jiri Olsa) [1034843] - [perf] gtk/browser: Add support for event group view (Jiri Olsa) [1034843] - [perf] hists browser: Add suppport for event group view (Jiri Olsa) [1034843] - [perf] hists browser: Move coloring logic to hpp functions (Jiri Olsa) [1034843] - [perf] ui/hist: Add support for event group view (Jiri Olsa) [1034843] - [perf] gtk/browser: Convert hpp helpers to a function (Jiri Olsa) [1034843] - [perf] hists browser: Convert hpp helpers to a function (Jiri Olsa) [1034843] - [perf] ui/hist: Consolidate hpp helpers (Jiri Olsa) [1034843] - [perf] hists: Resort hist entries using group members for output (Jiri Olsa) [1034843] - [perf] report: Make another loop for linking group hists (Jiri Olsa) [1034843] - [perf] header: Add HEADER_GROUP_DESC feature (Jiri Olsa) [1034843] - [perf] tests: Add group test conditions (Jiri Olsa) [1034843] - [perf] tools: Keep group information (Jiri Olsa) [1034843] - [perf] top: Delete maps on exit (Jiri Olsa) [1034843] - [perf] top: Stop using exit() (Jiri Olsa) [1034843] - [perf] header: Fix double fclose() on do_write() failure (Jiri Olsa) [1034843] - [perf] header: Fix memory leak for the "Not caching a kptr_restrict'ed /proc/kallsyms" case (Jiri Olsa) [1034843] - [perf] tools: Fix memory leak on error (Jiri Olsa) [1034843] - [perf] sort: Use pclose() instead of fclose() on pipe stream (Jiri Olsa) [1034843] - [perf] tools: Fix possible double free on error (Jiri Olsa) [1034843] - [perf] tools, powerpc: Fix compile warnings in tests/attr.c (Jiri Olsa) [1034843] - [perf] evsel: Fix memory leaks on evsel->counts (Jiri Olsa) [1034843] - [perf] stat: Add interval printing (Jiri Olsa) [1034843] - [perf] evsel: Add prev_raw_count field (Jiri Olsa) [1034843] - [perf] tools: Make numa benchmark optional (Jiri Olsa) [1034843] - [perf] Add 'perf bench numa mem' NUMA performance measurement suite (Jiri Olsa) [1034843] - [perf] tests: Fix leaks on PERF_RECORD_* test (Jiri Olsa) [1034843] - [perf] tests: Call machine__exit in the vmlinux matches kallsyms test (Jiri Olsa) [1034843] - [perf] ui browser: Free browser->helpline() on ui_browser__hide() (Jiri Olsa) [1034843] - [perf] header: Stop using die() calls when processing tracing data (Jiri Olsa) [1034843] - [perf] kmem: Use memdup() (Jiri Olsa) [1034843] - [perf] tools: Use memdup in map__clone (Jiri Olsa) [1034843] - [perf] tools: Stop using 'self' in map.c and map.h (Jiri Olsa) [1034843] - [perf] tools: Stop using 'self' in strlist (Jiri Olsa) [1034843] - [perf] test: Allow skipping tests (Jiri Olsa) [1034843] - [perf] tools: Allow passing a list to intlist__new (Jiri Olsa) [1034843] - [perf] tools: Allow passing NULL to intlist__find (Jiri Olsa) [1034843] - [perf] script: Remove workqueue-stats script (Jiri Olsa) [1034843] - [perf] script: hook up perf_scripting_context->pevent (Jiri Olsa) [1034843] - [perf] script: Don't display trace info when invoking scripts (Jiri Olsa) [1034843] - [perf] tools: Remove some needless die() calls from the main routine (Jiri Olsa) [1034843] - [perf] pmu: Privatize perf_pmu_format and perf_pmu_alias structs (Jiri Olsa) [1034843] - [perf] tests: Use ARRAY_SIZE() were applicable (Jiri Olsa) [1034843] - [perf] tools: Fix usage of __ in event parsing struct names (Jiri Olsa) [1034843] - [perf] ui browsers: Fix usage of __ in struct names (Jiri Olsa) [1034843] - [perf] pmu: Fix usage of __ in struct names (Jiri Olsa) [1034843] - [perf] tools: Fix usage of __ in parse_events_term struct (Jiri Olsa) [1034843] - [perf] tools: Move ltrim() to util/string.c (Jiri Olsa) [1034843] - [perf] tools: Fix PMU format parsing test failure (Jiri Olsa) [1034843] - [perf] tools: Do not include PERF-VERSION-FILE to Makefile (Jiri Olsa) [1034843] - [perf] tools: Get rid of unused include of config.mak (Jiri Olsa) [1034843] - [perf] tools: Remove unused 'unset' parameter from parse_events (Jiri Olsa) [1034843] - [perf] tools: Mark branch_info maps as referenced (Jiri Olsa) [1034843] - [perf] annotate browser: Fix segfault when drawing out-of-bounds jumps (Jiri Olsa) [1034843] - [perf] tools: Move get_term_dimensions from top to util.c (Jiri Olsa) [1034843] - [perf] symbols: Mark vmlinux filename as allocated (Jiri Olsa) [1034843] - [perf] symbols: Move name malloc to when needed in dso__load (Jiri Olsa) [1034843] - [perf] report: Update documentation for sort keys (Jiri Olsa) [1034843] - [perf] sort: Separate out branch stack specific sort keys (Jiri Olsa) [1034843] - [perf] sort: Clean up sort__first_dimension setting (Jiri Olsa) [1034843] - [perf] sort: Calculate parent column width too (Jiri Olsa) [1034843] - [perf] sort: Align cpu column to right (Jiri Olsa) [1034843] - [perf] sort: Fix --sort pid output (Jiri Olsa) [1034843] - [perf] sort: Get rid of unnecessary __maybe_unused (Jiri Olsa) [1034843] - [perf] sort: Move misplaced sort entry functions (Jiri Olsa) [1034843] - [perf] probe: Allow of casting an array of char to string (Jiri Olsa) [1034843] - [perf] tools: Add anonymous huge page recognition (Jiri Olsa) [1034843] - [perf] bench: Flush stdout before starting bench suite (Jiri Olsa) [1034843] - [perf] symbols: Include elf.h header regardless LIBELF_SUPPORT (Jiri Olsa) [1034843] - [perf] tools: Fix possible but unlikely buffer overflow (Jiri Olsa) [1034843] - [perf] tools: Fix GNU make v3.80 compatibility issue (Jiri Olsa) [1034843] - [perf] ui/gtk: Setup browser window early (Jiri Olsa) [1034843] - [perf] ui/gtk: Factor out common browser routines (Jiri Olsa) [1034843] - [perf] script: use ARRAY_SIZE instead of reinventing it (Jiri Olsa) [1034843] - [perf] kmem: use ARRAY_SIZE instead of reinventing it (Jiri Olsa) [1034843] - [perf] tools: remove redundant checks from _sort__sym_cmp (Jiri Olsa) [1034843] - [perf] tests: Don't fail if a matching vmlinux isn't found, skip that test (Jiri Olsa) [1034843] - [perf] tests: Add return states enum for tests (Jiri Olsa) [1034843] - [perf] machine: Simplify accessing the host machine (Jiri Olsa) [1034843] - [perf] tests: Fix PYTHONPATH for python-use test tracepoints (Jiri Olsa) [1034843] - [perf] machine: Introduce struct machines (Jiri Olsa) [1034843] - [perf] session: There is no need for a per session hists instance (Jiri Olsa) [1034843] - [perf] hists: Rename hists__fprintf_nr_events to events_stats__fprintf (Jiri Olsa) [1034843] - [perf] record: Don't pass host machine to guest synthesizer (Jiri Olsa) [1034843] - [perf] header: Ensure read/write finished successfully (Jiri Olsa) [1034843] - [perf] tests: Check python path on attr and binding test (Jiri Olsa) [1034843] - [perf] tests: Add event parsing test for '*:*' tracepoints (Jiri Olsa) [1034843] - [perf] tools: Add missing closedir in multi tracepoint processing (Jiri Olsa) [1034843] - [perf] test: Check for linking problems in the python binding (Jiri Olsa) [1034843] - [perf] evsel: Introduce perf_evsel__open_strerror method (Jiri Olsa) [1034843] - [perf] evsel: Introduce event fallback method (Jiri Olsa) [1034843] - [perf] evsel: Do missing feature fallbacks in just one place (Jiri Olsa) [1034843] - [perf] tests: Adjust some message log levels to help diagnosing problems in attr tests (Jiri Olsa) [1034843] - [perf] test: Remove leftover temp file left by one of the attr tests (Jiri Olsa) [1034843] - [perf] test: Add a test case for hists__match, hists__link (Jiri Olsa) [1034843] - [perf] diff: Use internal rb tree for compute resort (Jiri Olsa) [1034843] - [perf] hists: Link hist entries before inserting to an output tree (Jiri Olsa) [1034843] - [perf] hists: Exchange order of comparing items when collapsing hists (Jiri Olsa) [1034843] - [perf] top: Use perf_evlist__config() (Jiri Olsa) [1034843] - [perf] record: Export the callchain parsing routine and help (Jiri Olsa) [1034843] - [perf] record: Pass perf_record_opts to the callchain cmdline parsing callback (Jiri Olsa) [1034843] - [perf] evsel: Decode read_format and sample_type in perf_evsel__fprintf (Jiri Olsa) [1034843] - [perf] tools: Add install-bin Makefile target (Jiri Olsa) [1034843] - [perf] evsel: Adopt fprintf routine from 'perf evlist' (Jiri Olsa) [1034843] - [perf] evlist: Set the leader in the perf_evlist__config method (Jiri Olsa) [1034843] - [perf] evsel: No need to always ask for PERF_FORMAT_TOTAL_TIME_ENABLED/_RUNNING (Jiri Olsa) [1034843] - [perf] evsel: No need to always ask for PERF_FORMAT_ID in read_format (Jiri Olsa) [1034843] - [perf] evsel: Introduce method to request IDs be used (Jiri Olsa) [1034843] - [perf] test: Use perf_evsel__newtp constructor in the tracepoint tests (Jiri Olsa) [1034843] - [perf] test: Fixup error reporting in basic mmap test (Jiri Olsa) [1034843] - [perf] evsel: Update sample_size when setting sample_type bits (Jiri Olsa) [1034843] - [perf] machine: Move more machine methods to machine.c (Jiri Olsa) [1034843] - [perf] buildid-cache: Add option to show build ids that are missing in the cache (Jiri Olsa) [1034843] - [perf] symbols: Generalize filter in __fprintf_buildid methods (Jiri Olsa) [1034843] - [perf] diff: Remove displacement output option (Jiri Olsa) [1034843] - [perf] buildid-list: We need to check if a file is ELF first (Jiri Olsa) [1034843] - [perf] tools: Fix TUI helpline output (Jiri Olsa) [1034843] - [perf] tools: Don't check configuration on make tags (Jiri Olsa) [1034843] - [perf] diff: Change formula methods to work with pair directly (Jiri Olsa) [1034843] - [perf] diff: Change compute methods to work with pair directly (Jiri Olsa) [1034843] - [perf] diff: Remove displacement from struct hist_entry_diff (Jiri Olsa) [1034843] - [perf] evsel: Convert to _is_group_leader method (Jiri Olsa) [1034843] - [perf] evsel: Set leader evsel's ->leader to itself (Jiri Olsa) [1034843] - [perf] hists: Link hist entry pairs to leader (Jiri Olsa) [1034843] - [perf] hists: Fix typo on hist__entry_add_pair (Jiri Olsa) [1034843] - [perf] symbols: Ignore ABS symbols when loading data maps (Jiri Olsa) [1034843] - [perf] hists: Introduce perf_hpp__list for period related columns (Jiri Olsa) [1034843] - [perf] tools: Fix mmap limitations on 32-bit (Jiri Olsa) [1034843] - [perf] top: Add missing newline on pr_err call (Jiri Olsa) [1034843] - [perf] session: Free environment information when deleting session (Jiri Olsa) [1034843] - [perf] tools: Don't check configuration on make clean (Jiri Olsa) [1034843] - [perf] ui/helpline: Introduce ui_helpline__vshow() (Jiri Olsa) [1034843] - [perf] ui: Always compile error printing code (Jiri Olsa) [1034843] - [perf] symbols: Fix dso__fprintf() print statement (Jiri Olsa) [1034843] - [net] sctp: fix checksum marking for outgoing packets (Daniel Borkmann) [1040385]- [fs] fuse: never d_drop() dentry mountpoints on failed reval (Brian Foster) [1026952] - [fs] cifs: don't instantiate new dentries in readdir for inodes that need to be revalidated immediately (Sachin Prabhu) [1017883] - [fs] cifs: revalidate directories instiantiated via FIND_* in order to handle DFS referrals (Sachin Prabhu) [1017883] - [fs] cifs: only set ops for inodes in I_NEW state (Sachin Prabhu) [1017883] - [fs] nfs: fix handling of invalid mount options in nfs_remount (Jeff Layton) [968185] - [fs] nfs: reject version and minorversion changes on remount attempts (Jeff Layton) [968185] - [fs] nfsd: add private md5 hashing implementation to get around FIPS blacklisting (Jeff Layton) [1020176] - [fs] nfs: Always clear the NFS_INO_LAYOUTCOMMIT in layoutreturn (Jeff Layton) [921540] - [fs] nfs: Send atime and mtime as a 64bit value (Jeff Layton) [996548] - [fs] nfs: fix mknod() on nfs4 (Jeff Layton) [921684] - [fs] nfs: nameidata_to_nfs_open_context() doesn't need nameidata (Jeff Layton) [921684] - [md] Re-enable TRIM on MD RAID5 devices (Jes Sorensen) [1023424] - [md] raid5: avoid finding "discard" stripe (Jes Sorensen) [1023424] - [md] raid5: set bio bi_vcnt 0 for discard request (Jes Sorensen) [1023424] - [s390] fix save and restore of the floating-point-control register (Hendrik Brueckner) [1034270] - [s390] signal: change return values to -EFAULT (Hendrik Brueckner) [1034270] - [kernel] ptrace: Cleanup useless header (Aaron Tomlin) [1036312] - [kernel] ptrace: kill BKL in ptrace syscall (Aaron Tomlin) [1036312] - [x86] kvm: fix cross page vapic_addr access (Paolo Bonzini) [1032215] {CVE-2013-6368} - [x86] kvm: fix division by zero in apic_get_tmcct (Paolo Bonzini) [1032213] {CVE-2013-6367}- [scsi] scsi_debug: fix endianness bug in sdebug_build_parts() (Maurizio Lombardi) [563489] - [scsi] bfa: Chinook quad port 16G FC HBA claim issue (Vijay Guvva) [1038186] - [scsi] bfa: Fix crash when symb name set for offline vport (Vijay Guvva) [1032731] - [scsi] scsi_dh_alua: ALUA handler attach should succeed while TPG is transitioning (Maurizio Lombardi) [1019480] - [scsi] scsi_dh_alua: ALUA check sense should retry device internal reset unit attention (Maurizio Lombardi) [1019480] - [scsi] don't kfree an initialized struct device (Maurizio Lombardi) [908150] - [fs] nfs: Prevent a 3-way deadlock between layoutreturn, open and state recovery (Steve Dickson) [1034487] - [fs] nfs: Ensure that rmdir() waits for sillyrenames to complete (Steve Dickson) [1034348] - [fs] nfs: wait on recovery for async session errors (Steve Dickson) [1030049] - [fs] nfs: Re-use exit code in nfs4_async_handle_error() (Steve Dickson) [1030049] - [fs] nfs: Update list of irrecoverable errors on DELEGRETURN (Steve Dickson) [1030049] - [exec] ptrace: fix get_dumpable() incorrect tests (Petr Oros) [1039487] {CVE-2013-2929} - [net] ipv6: router reachability probing (Jiri Benc) [1029585] - [net] ipv6: remove the unnecessary statement in find_match() (Jiri Benc) [1029585] - [net] ipv6: fix route selection if kernel is not compiled with CONFIG_IPV6_ROUTER_PREF (Jiri Benc) [1029585] - [net] ipv6: Fix default route failover when CONFIG_IPV6_ROUTER_PREF=n (Jiri Benc) [1029585] - [net] ipv6: probe routes asynchronous in rt6_probe (Jiri Benc) [1030094] - [net] ndisc: Update neigh->updated with write lock (Jiri Benc) [1030094] - [net] ipv6: prevent fib6_run_gc() contention (Jiri Benc) [1030094] - [net] netfilter: push reasm skb through instead of original frag skbs (Jiri Pirko) [1011214] - [net] ip6_output: fragment outgoing reassembled skb properly (Jiri Pirko) [1011214] - [net] netfilter: nf_conntrack_ipv6: improve fragmentation handling (Jiri Pirko) [1011214] - [net] ipv4: fix path MTU discovery with connection tracking (Jiri Pirko) [1011214] - [net] ipv6: Make IP6CB(skb)->nhoff 16-bit (Jiri Pirko) [1011214] - [input] uinput: setup MT usage during device creation (Aristeu Rozanski) [903081] - [input] add static inline accessors for ABS properties (Aristeu Rozanski) [903081] - [edac] revert sdram_scrub_rate behavior change (Aristeu Rozanski) [738592] - [edac] Add error decoding support for AMD Fam16h processors (Prarit Bhargava) [1020290] - [hda] alsa: fix the no-sound issue for Creative Recon3D cards (Jaroslav Kysela) [1007460]- [powerpc] signals: Improved mark VSX not saved with small contexts fix (Seth Jennings) [1044117] - [powerpc] signals: Mark VSX not saved with small contexts (Seth Jennings) [1044117]- [pci] Remove pcie_cap_has_devctl() (Myron Stowe) [1025994] - [pci] Support PCIe Capability Slot registers only for ports with slots (Myron Stowe) [1025994] - [pci] Remove PCIe Capability version checks (Myron Stowe) [1025994] - [pci] Allow PCIe Capability link-related register access for switches (Myron Stowe) [1025994] - [pci] Add offsets of PCIe capability registers (Myron Stowe) [1025994] - [pci] Tidy bitmasks and spacing of PCIe capability definitions (Myron Stowe) [1025994] - [pci] Remove obsolete comment reference to pci_pcie_cap2() (Myron Stowe) [1025994] - [pci] Clarify PCI_EXP_TYPE_PCI_BRIDGE comment (Myron Stowe) [1025994] - [pci] Rename PCIe capability definitions to follow convention (Myron Stowe) [1025994] - [pci] Add PCI_EXP_TYPE_PCIE_BRIDGE value (Myron Stowe) [1025994] - [netdrv] bnx2x: correct VF-PF channel locking scheme (Michal Schmidt) [1029203] - [netdrv] bnx2x: handle known but unsupported VF messages (Michal Schmidt) [1029203] - [netdrv] bnx2x: Lock DMAE when used by statistic flow (Michal Schmidt) [1029200] - [net] ipv6: fix leaking uninitialized port number of offender sockaddr (Florian Westphal) [1035883] {CVE-2013-6405} - [net] inet: fix addr_len/msg->msg_namelen assignment in recv_error functions (Florian Westphal) [1035883] {CVE-2013-6405} - [net] inet: prevent leakage of uninitialized memory to user in recv syscalls (Florian Westphal) [1035883] {CVE-2013-6405} - [net] ipvs: Add boundary check on ioctl arguments (Denys Vlasenko) [1030818] {CVE-2013-4588}- [s390] qeth: avoid buffer overflow in snmp ioctl (Hendrik Brueckner) [1034266] - [md] fix calculation of stacking limits on level change (Jes Sorensen) [1026864] - [kernel] ipc/sem.c: fix up semctl_setval discrepancies with upstream (Rik van Riel) [880024] - [kernel] ipc/sem.c: fix race in sem_lock() (Rik van Riel) [880024] - [kernel] fix kABI issues (Rik van Riel) [880024] - [kernel] ipc/sem.c: Fix missing wakeups in do_smart_update_queue() (Rik van Riel) [880024] - [kernel] ipc/sem.c: fix GETNCNT semctl() case (Rik van Riel) [880024] - [kernel] ipc/sem.c: fix GETZCNT semctl() case (Rik van Riel) [880024] - [kernel] ipc: simplify rcu_read_lock() in semctl_nolock() (Rik van Riel) [880024] - [kernel] ipc: simplify semtimedop/semctl_main() common error path handling (Rik van Riel) [880024] - [kernel] ipc: move sem_obtain_lock() rcu locking into the only caller (Rik van Riel) [880024] - [kernel] ipc: fix double sem unlock in semctl error path (Rik van Riel) [880024] - [kernel] ipc: move the rcu_read_lock() from sem_lock_and_putref() into callers (Rik van Riel) [880024] - [kernel] ipc: sem_putref() does not need the semaphore lock any more (Rik van Riel) [880024] - [kernel] ipc: move rcu_read_unlock() out of sem_unlock() and into callers (Rik van Riel) [880024] - [kernel] ipc: fix GETALL/IPC_RM race for sysv semaphores (Rik van Riel) [880024] - [kernel] ipc: fine grained locking for semtimedop (Rik van Riel) [1024265 880024] {CVE-2013-4483} - [kernel] ipc/sem.c: have only one list in struct sem_queue (Rik van Riel) [880024] - [kernel] ipc/sem.c: open code and rename sem_lock (Rik van Riel) [880024] - [kernel] ipc/sem.c: do not hold ipc lock more than necessary (Rik van Riel) [880024] - [kernel] ipc: introduce lockless pre_down ipcctl (Rik van Riel) [880024] - [kernel] ipc: introduce obtaining a lockless ipc object (Rik van Riel) [880024] - [kernel] ipc: remove bogus lock comment for ipc_checkid (Rik van Riel) [880024] - [kernel] ipc/sem.c: get rid of union semop in sys_semctl() arguments (Rik van Riel) [880024] - [kernel] ipc/sem.c: handle spurious wakeups (Rik van Riel) [880024] - [kernel] ipc/sem.c: remove private structures from public header file (Rik van Riel) [880024] - [kernel] ipc/sem.c: update description of the implementation (Rik van Riel) [880024] - [kernel] ipc/sem.c: move wake_up_process out of the spinlock section (Rik van Riel) [880024] - [kernel] ipc/sem.c: optimize update_queue() for bulk wakeup calls (Rik van Riel) [880024] - [kernel] ipc: remove unreachable code in sem.c (Rik van Riel) [880024] - [kernel] ipc/sem.c: optimize single sops when semval is zero (Rik van Riel) [880024] - [kernel] ipc/sem.c: optimize single semop operations (Rik van Riel) [880024] - [kernel] ipc/sem.c: add a per-semaphore pending list (Rik van Riel) [880024] - [kernel] ipc/sem.c: optimize if semops fail (Rik van Riel) [880024] - [kernel] ipc/sem.c: sem preempt improve (Rik van Riel) [880024] - [kernel] ipc/sem.c: sem use list operations (Rik van Riel) [880024] - [kernel] ipc/sem.c: sem optimise undo list search (Rik van Riel) [880024] - [kernel] ipc/sem.c: fix race with concurrent semtimedop() timeouts and IPC_RMID (Rik van Riel) [880024] - [kernel] ipc/sem.c: bugfix for semop() not reporting successful operation (Rik van Riel) [880024] - [net] don't drop TSO features for NO_CSUM devices (Ivan Vecera) [1030631] - [ata] ahci: fix turning on LEDs in ahci_start_port() (David Milburn) [1017105] - [ata] libata: implement cross-port EH exclusion (David Milburn) [1017105] - [ata] libata add ap to ata_wait_register and intro ata_msleep (David Milburn) [1017105]- [netdrv] mlx4_en: Check device state when setting coalescing (Amir Vadai) [975908] - [netdrv] igb: Update link modes display in ethtool (Stefan Assmann) [1019578] - [block] fix race between request completion and timeout handling (Jeff Moyer) [919756]- [net] ip_output: do skb ufo init for peeked non ufo skb as well (Jiri Pirko) [1023491] {CVE-2013-4470} - [net] ip6_output: do skb ufo init for peeked non ufo skb as well (Jiri Pirko) [1023491] {CVE-2013-4470} - [net] bridge: disable snooping if there is no querier (Vlad Yasevich) [952012] - [net] Revert "bridge: only expire the mdb entry when query is received" (Vlad Yasevich) [952012] - [net] Revert "bridge: fix some kernel warning in multicast timer" (Vlad Yasevich) [952012] - [net] Revert "bridge: do not call setup_timer() multiple times" (Vlad Yasevich) [952012] - [net] Revert "bridge: update mdb expiration timer upon reports" (Vlad Yasevich) [952012] - [net] sunrpc: Fix a data corruption issue when retransmitting RPC calls (Jeff Layton) [1030046] - [fs] gfs2: Implement a "rgrp has no extents longer than X" scheme (Robert S Peterson) [998625] - [fs] gfs2: Drop inadequate rgrps from the reservation tree (Robert S Peterson) [998625] - [fs] gfs2: If requested is too large, use the largest extent in the rgrp (Robert S Peterson) [998625] - [fs] gfs2: Add allocation parameters structure (Robert S Peterson) [998625] - [fs] nfs: Don't check lock owner compatability unless file is locked - part 2 (Jeff Layton) [1007039] - [fs] nfs: Don't check lock owner compatibility in writes unless file is locked (Jeff Layton) [1007039] - [netdrv] ixgbevf: move API neg to reset path (Andy Gospodarek) [1019346] - [netdrv] ixgbe: fix inconsistent clearing of the multicast table (Andy Gospodarek) [975248] - [mm] Group e820 entries together and add map_individual_e820 boot option (Larry Woodman) [876275] - [mm] Exclude E820_RESERVED regions and memory holes above 4 GB from direct mapping (Larry Woodman) [876275] - [mm] Find_early_table_space based on ranges that are actually being mapped (Larry Woodman) [876275] - [fs] nfs: Fix the sync mount option for nfs4 mounts (Scott Mayhew) [915862] - [fs] nfsv4: Missing Chunk of Back Port Patch Causes Hang (Steve Dickson) [1024006] - [fs] xfs: Ensure sync updates the log tail correctly (Dave Chinner) [1025439] - [fs] xfs: only update the last_sync_lsn when a transaction completes (Dave Chinner) [1025439] - [fs] xfs: prevent deadlock trying to cover an active log (Dave Chinner) [1014867] - [kernel] signal: stop info leak via the tkill and the tgkill syscalls (Petr Holasek) [970878] {CVE-2013-2141} - [block] rsxx: Disallow discards from being unmapped (Steve Best) [1023897] - [netdrv] brcmsmac: Module alias support missing from backport (John Green) [1020461] - [netdrv] bonding: Remove redundant VLAN tag insertion logic (Nikolay Aleksandrov) [1025224] - [netdrv] mlx4_en: Fix pages never dma unmapped on rx (Steve Best) [1023272] - [netdrv] mlx4_en: Fix BlueFlame race (Amir Vadai) [987634] - [scsi] lpfc: Update lpfc version for 8.3.7.21.5p driver release (Rob Evers) [1024683] - [scsi] lpfc 8.3.42: Fixed failure to allocate SCSI buffer on PPC64 platform for SLI4 devices (Rob Evers) [1024683] - [scsi] Revert "qla2xxx: Ramp down queue depth for attached SCSI devices when driver resources are low." (Chad Dupuis) [995576] - [netdrv] tg3: avoid double-freeing of rx data memory (Ivan Vecera) [1020685] - [hda] alsa: Final fix for the Haswell HDMI audio 44.1kHz rate (Jaroslav Kysela) [1024548] - [input] wacom: do not report ABS_MISC on TPC2FG touch device (Aristeu Rozanski) [1032256]- [md] Disabling of TRIM on RAID5 for RHEL6.5 was too aggressive (Jes Sorensen) [1028426]- [x86] Revert "efi: be more paranoid about available space when creating variables" (Rafael Aquini) [1012370 1023173] - [x86] Revert "efivars: firmware bug workarounds should be in platform code" (Rafael Aquini) [1012370 1023173] - [x86] Revert "efi: Export efi_query_variable_store() for efivars.ko" (Rafael Aquini) [1012370 1023173] - [x86] Revert "efi: Check max_size only if it is non-zero" (Rafael Aquini) [1012370 1023173] - [x86] Revert "efi: Distinguish between "remaining space" and actually used space" (Rafael Aquini) [1012370 1023173] - [x86] Revert "efi: Implement efi_no_storage_paranoia parameter" (Rafael Aquini) [1012370 1023173] - [x86] Revert "Modify UEFI anti-bricking code" (Rafael Aquini) [1012370 1023173] - [x86] Revert "efi: Fix dummy variable buffer allocation" (Rafael Aquini) [1012370 1023173]- [fs] revert xfs: prevent deadlock trying to cover an active log (Eric Sandeen) [1014867]- [fs] Revert "vfs: allow umount to handle mountpoints without revalidating them" (Rafael Aquini) [1024607] - [fs] Revert "vfs: massage umount_lookup_last() a bit to reduce nesting" (Rafael Aquini) [1024607] - [fs] Revert "vfs: rename user_path_umountat() to user_path_mountpoint_at()" (Rafael Aquini) [1024607] - [fs] Revert "vfs: introduce kern_path_mountpoint()" (Rafael Aquini) [1024607] - [fs] Revert "autofs4: fix device ioctl mount lookup" (Rafael Aquini) [1024607]- [tools] perf: Add ref-cycles into array of tested events (Jiri Olsa) [968806] - [pci] Revert "make SRIOV resources optional" (Myron Stowe) [1022270] - [pci] Revert "ability to relocate assigned pci-resources" (Myron Stowe) [1022270] - [pci] Revert "honor child buses add_size in hot plug configuration" (Myron Stowe) [1022270] - [pci] Revert "make cardbus-bridge resources optional" (Myron Stowe) [1022270] - [pci] Revert "code and comments cleanup" (Myron Stowe) [1022270] - [pci] Revert "make re-allocation try harder by reassigning ranges higher in the heirarchy" (Myron Stowe) [1022270] - [pci] Revert "Calculate right add_size" (Myron Stowe) [1022270]- [block] loop: unplug_fn only when backing file is attached (Lukas Czerner) [1022997] - [fs] ext4: Remove warning from ext4_da_update_reserve_space() (Lukas Czerner) [1011876] - [kernel] async: Revert MAX_THREADS to 256 (Neil Horman) [1021705] - [net] ipv6: restrict neighbor entry creation to output flow (Jiri Pirko) [997103] - [net] ipv6: udp packets following an UFO enqueued packet need also be handled by UFO (Jiri Pirko) [1011930] {CVE-2013-4387} - [net] ipv4: blackhole route should always be recalculated (Herbert Xu) [1010347] - [net] unix: revert/fix race in stream sockets with SOCK_PASS* flags (Daniel Borkmann) [1019343] - [net] Loosen constraints for recalculating checksum in skb_segment() (Vlad Yasevich) [1020298] - [drm] nouveau: fix vblank deadlock (Rob Clark) [1013388] - [usb] xhci: refactor EHCI/xHCI port switching (Don Zickus) [970715] - [fs] compat_ioctl: VIDEO_SET_SPU_PALETTE missing error check (Phillip Lougher) [949573] {CVE-2013-1928} - [fs] vfs: fix d_mountpoint() (Ian Kent) [1011337] - [fs] autofs4: fix device ioctl mount lookup (Ian Kent) [999708] - [fs] vfs: introduce kern_path_mountpoint() (Ian Kent) [999708] - [fs] vfs: rename user_path_umountat() to user_path_mountpoint_at() (Ian Kent) [999708] - [fs] vfs: massage umount_lookup_last() a bit to reduce nesting (Ian Kent) [999708] - [fs] vfs: allow umount to handle mountpoints without revalidating them (Ian Kent) [999708] - [fs] nfs: Remove the 'FIFO' behaviour for nfs41_setup_sequence (Steve Dickson) [1022257] - [fs] nfs: Record the OPEN create mode used in the nfs4_opendata structure (Steve Dickson) [1019439] - [fs] nfs: Simulate the change attribute (Steve Dickson) [1018653] - [scsi] megaraid_sas: Fix synchronization problem between sysPD IO path and AEN path (Tomas Henzl) [1019811]- [md] dm-snapshot: fix data corruption (Mikulas Patocka) [974481] {CVE-2013-4299} - [watchdog] iTCO_wdt: add platform driver module alias (Neil Horman) [1019497] - [hda] alsa: disable 44.1kHz rate for Haswell HDMI/DP audio (Jaroslav Kysela) [831970] - [x86] Update UV3 hub revision ID (George Beshers) [1018962] - [fs] xfs: Don't reference the EFI after it is freed (Eric Sandeen) [1018469] - [security] keys: Fix a race between negating a key and reading the error set (Dave Wysochanski) [890231] - [fs] nfsv4: Ensure memory ordering between nfs4_ds_connect and nfs4_fl_prepare_ds (Jeff Layton) [1012439] - [fs] nfsv4: nfs4_fl_prepare_ds - fix bugs when the connect attempt fails (Jeff Layton) [1012439] - [md] Disable TRIM on RAID5 for RHEL 6.5 (Jes Sorensen) [837097] - [md] raid5: BIO_RW_SYNCIO is a bit number, not a bitmask (Jes Sorensen) [837097] - [virt] hyperv: framebuffer pci stub (Gerd Hoffmann) [1013335] - [netdrv] bnx2x: add missing enum channel_tlvs definitions (Michal Schmidt) [1015137] - [netdrv] bnx2x: KR2 disablement fix (Michal Schmidt) [1015137] - [netdrv] bnx2x: Specific Active-DAC is not detected on 57810 (Michal Schmidt) [1015137] - [netdrv] bnx2x: Generalize KR work-around (Michal Schmidt) [1015137] - [usb] usbnet: use ethd name for known ethernet devices (Don Zickus) [1014224] - [usb] cdc_ether: use ethd name for known ethernet devices (Don Zickus) [1014224] - [mm] Revert "Find_early_table_space based on ranges that are actually being mapped" (Rafael Aquini) - [mm] Revert "Exclude E820_RESERVED regions and memory holes above 4 GB from direct mapping" (Rafael Aquini) - [mm] Revert "Group e820 entries together and add map_individual_e820 boot option" (Rafael Aquini) - [net] bridge: update mdb expiration timer upon reports (Vlad Yasevich) [1013816] - [net] veth: Remove NETIF_F_HW_VLAN_RX capability (Thomas Graf) [1018158] - [net] gre/vxlan: handle 802.1Q inner header properly (Thomas Graf) [997632] - [net] disable the new NAPI weight error message for RHEL 6.5 (Michal Schmidt) [1012090] - [scsi] sd: Fix parsing of 'temporary ' cache mode prefix (Ewan Milne) [955441] - [scsi] sd: fix array cache flushing bug causing performance problems (Ewan Milne) [955441] - [scsi] bfa: firmware update to 3.2.1.1 (Rob Evers) [1002770] - [netdrv] bna: firmware update to 3.2.1.1 (Ivan Vecera) [1002771]- [block] loop: fix crash when using unassigned loop device (Mike Snitzer) [989795] - [fs] xfs: prevent deadlock trying to cover an active log (Dave Chinner) [1014867] - [x86] microcode: Fix patch level reporting for AMD family 15h (Prarit Bhargava) [1014401] - [hda] alsa: enable switcheroo code in the snd-hda-intel driver (Jaroslav Kysela) [1013993] - [x86] reboot: Fix a warning message triggered by stop_other_cpus() (Jerome Marchand) [840710] - [kernel] async: Bump up the MAX_THREADS count for the async subsystem (Neil Horman) [1010666] - [pci] Calculate right add_size (Myron Stowe) [997672] - [netdrv] iwlwifi: pcie: add SKUs for 6000, 6005 and 6235 series (Stanislaw Gruszka) [1013951] - [netdrv] iwlwifi: pcie: add new SKUs for 7000 & 3160 NIC series (Stanislaw Gruszka) [1013951] - [netdrv] iwlwifi: enable shadow registers for 7000 (Stanislaw Gruszka) [1013951] - [netdrv] iwlwifi: add new 7260 and 3160 series device IDs (Stanislaw Gruszka) [1013951] - [netdrv] be2net: pass if_id for v1 and V2 versions of TX_CREATE cmd (Ivan Vecera) [1014360] - [netdrv] be2net: call ENABLE_VF cmd for Skyhawk-R too (Ivan Vecera) [1014360] - [netdrv] be2net: Fix to prevent Tx stall on SH-R when packet size < 32 (Ivan Vecera) [1014360] - [scsi] pm8001: Queue rotation logic for inbound and outbound queues (Rich Bono) [1013771] - [scsi] lpfc: Update lpfc version for 8.3.7.21.4p driver release (Rob Evers) [1004841] - [scsi] lpfc: Fixed spinlock hang (Rob Evers) [1004841] - [scsi] lpfc: Fixed spinlock inversion problem (Rob Evers) [1004841] - [scsi] lpfc: Fixed inconsistent spin lock useage (Rob Evers) [1004841] - [scsi] qla2xxx: Update version number to 8.05.00.03.06.5-k2 (Chad Dupuis) [912652] - [scsi] qla2xxx: Fix request queue null dereference (Chad Dupuis) [912652] - [net] tcp: TSQ can use a dynamic limit (Jiri Pirko) [996802] - [net] tcp: TSO packets automatic sizing (Jiri Pirko) [996802] - [net] tcp: Apply device TSO segment limit earlier (Jiri Pirko) [996802] - [net] Allow driver to limit number of GSO segments per skb (Jiri Pirko) [996802] - [net] cleanups in RX queue allocation (Ivan Vecera) [1012388] - [net] Update kernel-doc for netif_set_real_num_rx_queues() (Ivan Vecera) [1012388] - [net] netif_set_real_num_rx_queues may cap num_rx_queues at init time (Ivan Vecera) [1012388]- [kvm] pmu: add proper support for fixed counter 2 (Gleb Natapov) [1000956] - [kvm] vmx: do not check bit 12 of EPT violation exit qualification when undefined (Gleb Natapov) [1006139] - [kvm] vmx: set "blocked by NMI" flag if EPT violation happens during IRET from NMI (Gleb Natapov) [1006139] - [edac] Fix workqueue-related crashes (Aristeu Rozanski) [831127] - [edac] amd64_edac: Fix driver module removal (Aristeu Rozanski) [831127] - [md] raid5: BIO flags adjust (Jes Sorensen) [837097] - [md] Fix skipping recovery for read-only arrays (Jes Sorensen) [1014102] - [kernel] audit: fix mq_open and mq_unlink to add the MQ root as a hidden parent audit_names record (Richard Guy Briggs) [1009386] - [kernel] audit: log the audit_names record type (Richard Guy Briggs) [1009386] - [kernel] audit: add child record before the create to handle case where create fails (Richard Guy Briggs) [1009386] - [kernel] audit: format user messages to size of MAX_AUDIT_MESSAGE_LENGTH (Richard Guy Briggs) [1007069] - [netdrv] tg3: Expand led off fix to include 5720 (Ivan Vecera) [991498] - [netdrv] tg3: Don't turn off led on 5719 serdes port 0 (Ivan Vecera) [991498] - [netdrv] tg3: Fix UDP fragments treated as RMCP (Ivan Vecera) [991498] - [netdrv] tg3: Remove incorrect switch to aux power (Ivan Vecera) [991498] - [i2c] ismt: initialize DMA buffer (Neil Horman) [1014753] - [scsi] libfcoe: Make fcoe_sysfs optional / fix fnic NULL exception (Neil Horman) [1014864] - [fs] gfs2: Fix race in iteration of glocks for unfreeze/umount (Abhijith Das) [999909] - [fs] gfs2: dirty inode correctly in gfs2_write_end (Benjamin Marzinski) [991596] - [x86] Mark Intel Atom Avoton processor as supported (Prarit Bhargava) [914842] - [mm] vmscan: fix zone shrinking exit when scan work is done (David Gibson) [985155] - [block] free bios when failing blk_execute_rq_nowait calls (Jeff Moyer) [1009312] - [netdrv] be2net: fix disabling TX in be_close() (Ivan Vecera) [951271] - [crypto] Fix race condition in larval lookup (Herbert Xu) [916361]- [fs] fuse: drop dentry on failed revalidate (Brian Foster) [924014] - [fs] fuse: clean up return in fuse_dentry_revalidate() (Brian Foster) [924014] - [fs] fuse: use d_materialise_unique() (Brian Foster) [924014] - [mm] Group e820 entries together and add map_individual_e820 boot option (Larry Woodman) [876275] - [mm] Exclude E820_RESERVED regions and memory holes above 4 GB from direct mapping (Larry Woodman) [876275] - [mm] Find_early_table_space based on ranges that are actually being mapped (Larry Woodman) [876275] - [hid] pantherlord: heap overflow flaw (Radomir Vrbovsky) [1000435] {CVE-2013-2892} - [virt] hv: Correctly support ws2008R2 and earlier (Jason Wang) [1007341] - [powerpc] iommu: Use GFP_KERNEL instead of GFP_ATOMIC in iommu_init_table() (Steve Best) [1012666] - [powerpc] Add isync to copy_and_flush (Steve Best) [1014475] - [block] rsxx: Kernel Panic caused by mapping Discards (Steve Best) [1013728] - [kernel] audit: avoid soft lockup due to audit_log_start() incorrect loop termination (Richard Guy Briggs) [990806] - [fs] nfsv4: Remove the BUG_ON() from nfs4_get_lease_time_prepare() (Steve Dickson) [1012688] - [netdrv] bnx2x: fix loss of VLAN priority information in received TPA-aggregated packets (Michal Schmidt) [1014694] - [fs] gfs2: garbage quota usage reported due to uninitialized inode during creation (Abhijith Das) [1008947] - [fs] nfs: fix filelayout_commit_call_ops (Scott Mayhew) [1012479] - [netdrv] igb: fix driver reload with VF assigned to guest (Stefan Assmann) [985733] - [md] Fix bio flags for md raid5 (Jes Sorensen) [837097] - [md] Fix bio flags for md raid10 (Jes Sorensen) [837097] - [scsi] qla4xxx: 5.03.00.00.06.05-k3 (Chad Dupuis) [1011476] - [scsi] qla4xxx: Support setting of local CHAP index for flash target entry (Chad Dupuis) [1011476] - [scsi] qla4xxx: Correct the check for local CHAP entry type (Chad Dupuis) [1011476] - [scsi] lpfc: Update lpfc version for 8.3.7.21.3p driver release (Rob Evers) [1012961] - [scsi] lpfc: Fixed function mode field defined too small for not recognizing dual-chute mode (Rob Evers) [1012961] - [net] Revert "net: more accurate skb truesize" (Francesco Fusco) [889181] - [net] fix multiqueue selection (Michal Schmidt) [1011939]- [scsi] bnx2fc: Bump version from 1.0.14 to 2.4.1 (Tomas Henzl) [1008733] - [scsi] bnx2fc: hung task timeout warning observed when rmmod bnx2x with active FCoE targets (Tomas Henzl) [1008733] - [scsi] bnx2fc: Fixed a SCSI CMD cmpl race condition between ABTS and CLEANUP (Tomas Henzl) [1008733] - [scsi] cnic: Fix crash in, cnic_bnx2x_service_kcq() (Tomas Henzl) [1004554] - [hid] zeroplus: validate output report details (Frantisek Hrbata) [999906] {CVE-2013-2889} - [hid] provide a helper for validating hid reports (Frantisek Hrbata) [999906] {CVE-2013-2889} - [netdrv] sfc: Add SIOCEFX:EFX_MCDI_REQUEST ioctl to workaround MTD limits (Nikolay Aleksandrov) [1008705] - [netdrv] sfc: deny changing of unsupported flags (Nikolay Aleksandrov) [1010840] - [kernel] __ptrace_may_access() should not deny sub-threads (Oleg Nesterov) [927360] - [tools] perf: Make kmem work for non numa machines (Jiri Olsa) [984788] - [powerpc] Bring all threads online prior to migration/hibernation (Steve Best) [1010528] - [kvm] introduce guest count uevent (Paolo Bonzini) [1004802] - [scsi] iscsi_tcp: consider session state in iscsi_sw_sk_state_check (Chris Leech) [840638] - [crypto] ansi_cprng: Fix off by one error in non-block size request (Neil Horman) [1007694] {CVE-2013-4345} - [infiniband] cache: don't fill the cache with junk (Doug Ledford) [920306] - [usb] core: don't try to reset_device() a port that got just disconnected (Don Zickus) [1000944] - [usb] Fix connected device switch to Inactive state (Don Zickus) [1000944] - [usb] Don't use EHCI port sempahore for USB 3.0 hubs (Don Zickus) [1000944] - [netdrv] macvtap: Ignore tap features when VNET_HDR is off (Vlad Yasevich) [987201] - [netdrv] macvtap: Correctly set tap features when IFF_VNET_HDR is disabled (Vlad Yasevich) [987201] - [netdrv] macvtap: simplify usage of tap_features (Vlad Yasevich) [987201] - [infiniband] mlx4: Use default pkey when creating tunnel QPs (Doug Ledford) [993587] - [infiniband] core: Create QP1 using the pkey index which contains the default pkey (Doug Ledford) [993587] - [infiniband] ipoib: Make sure child devices use valid/proper pkeys (Doug Ledford) [993587] - [infiniband] ipoib: Fix pkey change flow for virtualization environments (Doug Ledford) [993587] - [netdrv] igb: don't deprecate the max_vfs parameter (Stefan Assmann) [1005877] - [netdrv] igb: Read flow control for i350 from correct EEPROM section (Stefan Assmann) [1005877] - [netdrv] igb: Add additional get_phy_id call for i354 devices (Stefan Assmann) [1005877] - [netdrv] igb: Update version number (Stefan Assmann) [1005877] - [netdrv] igb: Implementation to report advertised/supported link on i354 devices (Stefan Assmann) [1005877] - [netdrv] igb: Get speed and duplex for 1G non_copper devices (Stefan Assmann) [1005877] - [netdrv] igb: Support to get 2_5G link status for appropriate media type (Stefan Assmann) [1005877] - [netdrv] igb: No PHPM support in i354 devices (Stefan Assmann) [1005877] - [netdrv] igb: M88E1543 PHY downshift implementation (Stefan Assmann) [1005877] - [netdrv] igb: New PHY_ID for i354 device (Stefan Assmann) [1005877] - [netdrv] igb: Implementation of 1-sec delay for i210 devices (Stefan Assmann) [1005877] - [netdrv] igb: Don't look for a PBA in the iNVM when flashless (Stefan Assmann) [1005877] - [netdrv] igb: Expose RSS indirection table for ethtool (Stefan Assmann) [1005877] - [netdrv] igb: Add macro for size of RETA indirection table (Stefan Assmann) [1005877] - [netdrv] igb: Fix get_fw_version function for all parts (Stefan Assmann) [1005877] - [netdrv] igb: Add device support for flashless SKU of i210 device (Stefan Assmann) [1005877] - [netdrv] igb: Refactor NVM read functions to accommodate devices with no flash (Stefan Assmann) [1005877] - [netdrv] igb: Refactor of init_nvm_params (Stefan Assmann) [1005877] - [netdrv] igb: Update MTU so that it is always at least a standard frame size (Stefan Assmann) [1005877] - [netdrv] igb: don't allow SR-IOV without MSI-X (Stefan Assmann) [1005877] - [netdrv] igb: Added rcu_lock to avoid race (Stefan Assmann) [1005877] - [netdrv] igb: Read register for latch_on without return value (Stefan Assmann) [1005877] - [netdrv] igb: Reset the link when EEE setting changed (Stefan Assmann) [1005877] - [netdrv] treewide: relase -> release (Stefan Assmann) [1005877] - [scsi] iterate over devices individually for /proc/scsi/scsi (David Milburn) [966170] - [scsi] zfcp: fix lock imbalance by reworking request queue locking (Mikulas Patocka) [803592] - [kernel] pidns: fix two invalid task_active_pid_ns() usages (Aristeu Rozanski) [984597] - [netdrv] be2net: implement ethtool set/get_channel hooks (Ivan Vecera) [975885] - [netdrv] be2net: refactor be_setup() to consolidate queue creation routines (Ivan Vecera) [975885] - [netdrv] be2net: Fix be_cmd_if_create() to use MBOX if MCCQ is not created (Ivan Vecera) [975885] - [netdrv] be2net: refactor be_get_resources() code (Ivan Vecera) [975885] - [netdrv] be2net: don't limit max MAC and VLAN counts (Ivan Vecera) [975885] - [netdrv] be2net: Fixup profile management routines (Ivan Vecera) [975885] - [netdrv] be2net: use EQ_CREATEv2 for SH-R (Ivan Vecera) [975885] - [netdrv] be2net: delete primary MAC address while unloading (Ivan Vecera) [874733] - [netdrv] be2net: use SET/GET_MAC_LIST for SH-R (Ivan Vecera) [874733] - [netdrv] be2net: refactor MAC-addr setup code (Ivan Vecera) [874733] - [netdrv] be2net: fix pmac_id for BE3 VFs (Ivan Vecera) [874733] - [netdrv] be2net: allow VFs to program MAC and VLAN filters (Ivan Vecera) [874733] - [netdrv] be2net: fix MAC address modification for VF (Ivan Vecera) [874733] - [netdrv] be2net: don't use dev_err when AER enabling fails (Ivan Vecera) [986513] - [netdrv] be2net: Clear any capability flags that driver is not interested in (Ivan Vecera) [998856] - [net] ethtool: fix RHEL backport of ETHTOOL_RESET (Jiri Benc) [1008678] - [net] gact: Fix potential panic in tcf_gact() (Jiri Benc) [1003781] - [net] tcp: fix FIONREAD/SIOCINQ (Francesco Fusco) [1001479] - [net] vxlan: Avoid creating fdb entry with NULL destination (Amerigo Wang) [923915] - [net] bridge: sync the definition of struct br_mdb_entry with upstream (Amerigo Wang) [1010251] - [fs] proc/ns: Fix ABI of proc_inode (Thomas Graf) [1005224] - [fs] nfs: Fix writeback performance issue on cache invalidation (Scott Mayhew) [1010038] - [fs] xfs: switch stacks for bmap btree modifications (Dave Chinner) [918359] - [fs] GFS2: Dont flag consistency error if first mounter is a spectator (Robert S Peterson) [997929] - [x86] Mark Intel Haswell-EP as supported (Prarit Bhargava) [948339] - [s390] tx: allow program interruption filtering in user space (Hendrik Brueckner) [1006523] - [tty] hvc_iucv: Disconnect IUCV connection when lowering DTR (Hendrik Brueckner) [1007570] - [tty] hvc_console: Add DTR/RTS callback to handle HUPCL control (Hendrik Brueckner) [1007570] - [netdrv] bonding: fix bond_arp_rcv setting and arp validate desync state (Nikolay Aleksandrov) [1003697] - [netdrv] bonding: fix store_arp_validate race with mode change (Nikolay Aleksandrov) [1003697] - [netdrv] bonding: fix set mode race conditions (Nikolay Aleksandrov) [1003697] - [bluetooth] rfcomm: Fix info leak in RFCOMMGETDEVLIST ioctl() (Radomir Vrbovsky) [922409] {CVE-2012-6545} - [bluetooth] rfcomm: Fix info leak via getsockname() (Radomir Vrbovsky) [922409] {CVE-2012-6545} - [mm] mlock: operate on any regions with protection != PROT_NONE (Larry Woodman) [982460] - [mm] mlock: avoid dirtying pages and triggering writeback (Larry Woodman) [982460]- [net] ipv6: Don't depend on per socket memory for neighbour discovery messages (Thomas Graf) [963317] - [netdrv] bnx2x: add missing ethtool ops of virtual functions (Michal Schmidt) [1009492] - [netdrv] bnx2x: avoid atomic allocations during initialization (Michal Schmidt) [1004645 1007900] - [netdrv] bnx2x: Fix VF stats sync (Michal Schmidt) [1007900] - [netdrv] bnx2x: Fix VF memory leak unload (Michal Schmidt) [1007900] - [netdrv] bnx2x: Fix functionality of configuring vlan list (Michal Schmidt) [1007900] - [netdrv] bnx2x: Fix move FP memory deallocations (Michal Schmidt) [1007900] - [netdrv] bnx2x: vf mark stats started (Michal Schmidt) [1007900] - [netdrv] bnx2x: set VF DMAE when first function has 0 supported VFs (Michal Schmidt) [1007900] - [netdrv] bnx2x: Protect against VFs' ndos when SR-IOV is disabled (Michal Schmidt) [1007900] - [netdrv] bnx2x: prevent VF benign attentions (Michal Schmidt) [1007900] - [netdrv] bnx2x: Consider DCBX remote error (Michal Schmidt) [1007900] - [netdrv] bnx2x: Change DCB context handling (Michal Schmidt) [1007900] - [netdrv] bnx2x: dropless flow control not always functional (Michal Schmidt) [1007900] - [netdrv] bnx2x: fix PTE write access error (Michal Schmidt) [1007900] - [netdrv] bnx2x: fix memory leak in VF (Michal Schmidt) [1007900] - [netdrv] bnx2x: update fairness parameters following DCB negotiation (Michal Schmidt) [1007900] - [netdrv] bnx2x: protect different statistics flows (Michal Schmidt) [1007900] - [scsi] lpfc: update version for 8.3.7.21.2p driver release (Rob Evers) [1007485] - [scsi] lpfc: 8.3.42: Fixed issue of task management commands having a fixed timeout (Rob Evers) [1007485] - [scsi] rdac: Add new IBM product id to the RDAC devlist (Rob Evers) [1006061] - [block] hpsa: remove unused Smart Array ID (Tomas Henzl) [1002788] - [block] hpsa: bump driver version to reflect changes (Tomas Henzl) [1002788] - [block] hpsa: housekeeping patch for device_id and product arrays (Tomas Henzl) [1002788] - [block] hpsa: add HP Smart Array Gen8 names (Tomas Henzl) [1002788] - [block] hpsa: add HP Smart Array Gen9 PCI ID's (Tomas Henzl) [1002788] - [block] hpsa: remove unneeded variable (Tomas Henzl) [893773] - [block] hpsa: fix a race in cmd_free/scsi_done (Tomas Henzl) [893773] - [scsi] qla4xxx: 5.03.00.00.06.05-k2 (Chad Dupuis) [982175] - [scsi] qla4xxx: Export more firmware info in sysfs (Chad Dupuis) [982175] - [scsi] qla4xxx: Only BIOS boot target entries should be at index 0 and 1 (Chad Dupuis) [982175] - [scsi] qla4xxx: discovery_parent_idx can be shown without any check (Chad Dupuis) [982175] - [scsi] qla4xxx: Set IPv6 traffic class if device type is IPv6 (Chad Dupuis) [982175] - [scsi] qla4xxx: Use discovery_parent_idx instead of discovery_parent_type (Chad Dupuis) [982175] - [scsi] qla4xxx: Allow removal of failed session using logout (Chad Dupuis) [982175] - [scsi] libiscsi: Add missing prints for session and connection sysfs attrs (Chad Dupuis) [982175] - [scsi] megaraid_sas: Add High Availability clustering support using shared Logical Disks (Tomas Henzl) [997004] - [scsi] megaraid_sas: Version and Changelog update (Tomas Henzl) [997004] - [net] cnic: Use CHIP_NUM macros from bnx2x.h (Tomas Henzl) [1004554] - [hid] validate HID report id size (Frantisek Hrbata) [1000453] {CVE-2013-2888} - [infiniband] cma: Check for GID on listening device first (Doug Ledford) [920306] - [infiniband] cma: use cached gids (Doug Ledford) [920306] - [input] wacom: collect device quirks into single function (Aristeu Rozanski) [815589] - [input] wacom: add device type to device name string (Aristeu Rozanski) [815589] - [input] wacom: request tablet data for Bamboo Pens (Aristeu Rozanski) [815589] - [input] wacom: implement missing multitouch wrappers (Aristeu Rozanski) [815589] - [input] wacom: fix bug in HID parsing introduced by last patchset (Aristeu Rozanski) [815589] - [fs] nfsv4: Clean up delegation recall error handling (Steve Dickson) [1007556] - [fs] nfsv4: Clean up nfs4_open_delegation_recall (Steve Dickson) [1007556] - [fs] nfsv4: Clean up nfs4_lock_delegation_recall (Steve Dickson) [1007556] - [fs] nfs: It is not safe to dereference lsp->ls_state in release_lockowner (Steve Dickson) [962844] - [fs] nfs: Ensure that we free the lock stateid on the server (Steve Dickson) [962844] - [fs] nfs: Don't free the nfs4_lock_state until after the release_lockowner (Steve Dickson) [962844] - [fs] nfs: Convert nfs41_free_stateid to use an asynchronous RPC call (Steve Dickson) [962844] - [fs] nfs: Clean up TEST_STATEID and FREE_STATEID error reporting (Steve Dickson) [962844] - [fs] nfs: Clean up handling of privileged operations (Steve Dickson) [962844] - [fs] nfs: Clean up nfs41_setup_sequence (Steve Dickson) [962844] - [fs] nfs: Pass a stateid to test_stateid() and free_stateid() (Steve Dickson) [962844] - [fs] nfs: added FREE_STATEID call (Steve Dickson) [962844] - [virt] xen: mask cpu feature avx (Andrew Jones) [1006549] - [fs] nfsv4: Fix up nfs4_proc_lookup_mountpoint (Jeff Layton) [997133] - [block] rsxx: Moving pci_map_page to prevent overflow (Steve Best) [1001555] - [block] rsxx: Handling failed pci_map_page on PowerPC and double free (Steve Best) [1001545] - [kernel] sched/rt: Add a tuning knob to allow changing SCHED_RR timeslice (Herbert Xu) [919238] - [kernel] sched: Make initial SCHED_RR timeslace DEF_TIMESLICE (Herbert Xu) [919238] - [block] nvme: nvme_submit_bio_queue fixup check for DISCARD (David Milburn) [1006051] - [block] nvme: Update nvme_id_power_state with latest spec (David Milburn) [1006051] - [block] nvme: Split header file into user-visible and kernel-visible pieces (David Milburn) [1006051] - [block] nvme: Merge issue on character device bring-up (David Milburn) [1006051] - [block] nvme: Handle ioremap failure (David Milburn) [1006051] - [block] nvme: Add pci suspend/resume driver callbacks (David Milburn) [1006051] - [block] nvme: Use normal shutdown (David Milburn) [1006051] - [block] nvme: Separate controller init from disk discovery (David Milburn) [1006051] - [block] nvme: Separate queue alloc/free from create/delete (David Milburn) [1006051] - [block] nvme: Group pci related actions in functions (David Milburn) [1006051] - [block] nvme: Disk stats for read/write commands only (David Milburn) [1006051] - [block] nvme: Bring up cdev on set feature failure (David Milburn) [1006051] - [block] nvme: Fix checkpatch issues (David Milburn) [1006051] - [block] nvme: Namespace IDs are unsigned (David Milburn) [1006051] - [block] nvme: Call nvme_process_cq from submission path (David Milburn) [1006051] - [block] nvme: Remove "process_cq did something" message (David Milburn) [1006051] - [block] nvme: Return correct value from interrupt handler (David Milburn) [1006051] - [block] nvme: Disk IO statistics (David Milburn) [1006051] - [block] nvme: Restructure MSI / MSI-X setup (David Milburn) [1006051] - [block] nvme: Use kzalloc instead of kmalloc+memset (David Milburn) [1006051] - [netdrv] e1000e: Add code to check for failure of pci_disable_link_state call (John Green) [1000548] - [tools] perf: Fix missing tool parameter (Jiri Olsa) [984785] - [tools] perf: Remove builtin-inject unused parameter (Jiri Olsa) [984785] - [mm] pagewalk: walk_page_range should avoid VM_PFNMAP areas (Larry Woodman) [990753] - [mm] pagemap: set pagemap walk limit to PMD boundary (Motohiro Kosaki) [991260] - [mm] task_mmu: fix buffer overflow in add_page_map() (Motohiro Kosaki) [991260] - [mm] proc: copy_to_user() returns unsigned (Motohiro Kosaki) [991260] - [mm] pagemap: Hold mmap_sem during page walk (Motohiro Kosaki) [991260] - [netdrv] ixgbe: fix lockdep annotation issue for ptp's work item (Andy Gospodarek) [986967] - [netdrv] ixgbe: add support for quad-port x520 adapter (Andy Gospodarek) [986967] - [netdrv] ixgbe: clear semaphore bits on timeouts (Andy Gospodarek) [986967] - [netdrv] ixgbe: fix semaphore lock for I2C read/writes on 82598 (Andy Gospodarek) [986967] - [netdrv] ixgbe: add new media type (Andy Gospodarek) [986967] - [netdrv] ixgbe: bump version number (Andy Gospodarek) [986967] - [netdrv] ixgbe: fix SFF data dumps of SFP+ modules (Andy Gospodarek) [986967] - [netdrv] ixgbe: Fix Tx Hang issue with lldpad on 82598EB (Andy Gospodarek) [986967] - [netdrv] ixgbe: fix fc autoneg ethtool reporting (Andy Gospodarek) [986967] - [netdrv] ixgbe: Retain VLAN filtering in promiscuous + VT mode (Andy Gospodarek) [986967] - [netdrv] ixgbe: Use pci_vfs_assigned instead of ixgbe_vfs_are_assigned (Andy Gospodarek) [986967] - [lib] dma-debug: Fix comparison using wrong pointer variable in dma debug code (Stefan Assmann) [1002992] - [lib] dma-debug: hash_bucket_find needs to allow for offsets within an entry (Stefan Assmann) [1002992] - [mm] x86-64: fall back to regular page vmemmap on allocation failure (Johannes Weiner) [854363] - [mm] x86-64: use vmemmap_populate_basepages() for !pse setups (Johannes Weiner) [854363] - [mm] x86-64: remove dead debugging code for !pse setups (Johannes Weiner) [854363] - [mm] sparse-vmemmap: specify vmemmap population range in bytes (Johannes Weiner) [854363]- [netdrv] bonding: Fix corrupted queue_mapping (Veaceslav Falico) [991799] - [fs] xfs: fallback to vmalloc for large buffers in xfs_attrlist_by_handle (Eric Sandeen) [905086] - [fs] nfs: set open access operation call flag in nfs4_init_opendata_res (Jeff Layton) [1002855] - [kernel] Prevent RT process stall due to missing upstream scheduler bug fix (Larry Woodman) [1002765]- [netdrv] bnx2x: prevent crash in shutdown flow with CNIC (Michal Schmidt) [1003436] - [fs] nfs: Minor cleanups for nfs4_handle_exception and nfs4_async_handle_error (Dave Wysochanski) [998752] - [wireless] iwl4965: fix rfkill set state regression (Stanislaw Gruszka) [992969] - [wireless] rt2800: fix wrong TX power compensation (Stanislaw Gruszka) [992969] - [wireless] mac80211: add missing channel context release (Stanislaw Gruszka) [992969] - [wireless] mac80211: add a flag to indicate CCK support for HT clients (Stanislaw Gruszka) [992969] - [wireless] ath9k_htc: Restore skb headroom when returning skb to mac80211 (Stanislaw Gruszka) [992969] - [wireless] ath9k: Enable PLL fix only for AR9340/AR9330 (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: pcie: disable L1 Active after pci_enable_device (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: dvm: fix calling ieee80211_chswitch_done() with NULL (Stanislaw Gruszka) [992969] - [wireless] Hostap: copying wrong data prism2_ioctl_giwaplist() (Stanislaw Gruszka) [992969] - [wireless] zd1201: do not use stack as URB transfer_buffer (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: unregister leds when registration failed (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: take the seqno from packet if transmit failed (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: don't set the MCAST queue in STA's queue list (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: properly tell the fw that a STA is awake (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: fix MCAST in AP mode (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: correctly configure MCAST in AP mode (Stanislaw Gruszka) [992969] - [wireless] mac80211: don't wait for TX status forever (Stanislaw Gruszka) [992969] - [wireless] nl80211: fix another nl80211_fam.attrbuf race (Stanislaw Gruszka) [992969] - [wireless] cfg80211: fix P2P GO interface teardown (Stanislaw Gruszka) [992969] - [wireless] mac80211: continue using disabled channels while connected (Stanislaw Gruszka) [992969] - [wireless] mac80211: fix infinite loop in ieee80211_determine_chantype (Stanislaw Gruszka) [992969] - [wireless] mac80211: ignore HT primary channel while connected (Stanislaw Gruszka) [992969] - [wireless] iwl4965: reset firmware after rfkill off (Stanislaw Gruszka) [992969] - [wireless] iwl4965: set power mode early (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: dvm: don't send BT_CONFIG on devices w/o Bluetooth (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: set SSID bits for passive channels (Stanislaw Gruszka) [992969] - [wireless] rt2x00: fix stop queue (Stanislaw Gruszka) [992969] - [wireless] mac80211: fix monitor interface suspend crash regression (Stanislaw Gruszka) [992969] - [wireless] mac80211: fix ethtool stats for non-station interfaces (Stanislaw Gruszka) [992969] - [wireless] mac80211: fix duplicate retransmission detection (Stanislaw Gruszka) [992969] - [wireless] mac80211/minstrel_ht: fix cck rate sampling (Stanislaw Gruszka) [992969] - [wireless] mac80211/minstrel: fix NULL pointer dereference issue (Stanislaw Gruszka) [992969] - [wireless] nl80211: fix mgmt tx status and testmode reporting for netns (Stanislaw Gruszka) [992969] - [wireless] ath9k_htc: reboot firmware if it was loaded (Stanislaw Gruszka) [992969] - [wireless] ath9k_htc: do some initial hardware configuration (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: fix flushing not started aggregation sessions (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: add DELL SKU for 5150 HMC (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: refuse connection to APs with BI < 16 (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: fix bug in scan ssid (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: mvm: fix L2P BA ressources leak (Stanislaw Gruszka) [992969] - [wireless] mac80211: close AP_VLAN interfaces before unregistering all (Stanislaw Gruszka) [992969] - [wireless] b43: ensue that BCMA is "y" when B43 is "y" (Stanislaw Gruszka) [992969] - [wireless] ath9k: Do not assign noise for NULL caldata (Stanislaw Gruszka) [992969] - [wireless] ath9k: Fix noisefloor calibration (Stanislaw Gruszka) [992969] - [wireless] ath9k_hw: Assign default xlna config for AR9485 (Stanislaw Gruszka) [992969] - [wireless] rt2x00: rt2800lib: fix default TX power check for RT55xx (Stanislaw Gruszka) [992969] - [wireless] rt2x00: read 5GHz TX power values from the correct offset (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: pcie: wake the queue if stopped when being unmapped (Stanislaw Gruszka) [992969] - [wireless] iwlwifi: pcie: fix race in queue unmapping (Stanislaw Gruszka) [992969] - [fs] ext4: don't let i_reserved_meta_blocks go negative (Lukas Czerner) [916592] - [fs] ext4: introduce reserved space (Lukas Czerner) [916592]- [target] Set bi_destructor in iblock_get_bio (Andy Grover) [999490] - [target] Fix calling bdev_get_queue on a NULL *bio (Andy Grover) [999490] - [net] ipv6: remove max_addresses check from ipv6_create_tempaddr (Petr Holasek) [999365] {CVE-2013-0343} - [net] soreuseport: UDP/IPv6 implementation (Thomas Graf) [991600] - [net] soreuseport: TCP/IPv6 implementation (Thomas Graf) [991600] - [net] soreuseport: UDP/IPv4 implementation (Thomas Graf) [991600] - [net] soreuseport: TCP/IPv4 implementation (Thomas Graf) [991600] - [net] soreuseport: infrastructure (Thomas Graf) [991600] - [kernel] prevent an older auditd shutdown from orphaning a newer auditd startup (Richard Guy Briggs) [742562] - [kernel] audit: add an option to control logging of passwords with pam_tty_audit (Richard Guy Briggs) [725100] - [misc] hpilo: Correct panic when an AUX iLO is detected (Nigel Croxon) [996600] - [watchdog] hpwdt: Patch to ignore auxilary iLO devices (Nigel Croxon) [996608] - [netdrv] igb: fix vlan filtering in promisc mode when not in VT mode (Stefan Assmann) [996277] - [char] random: fix priming of last_data (Jarod Wilson) [997985] - [char] random: prime last_data value per fips requirements (Jarod Wilson) [997985] - [char] random: simplify fips mode (Jarod Wilson) [997985] - [fs] nfs: don't extend writes to cover entire page if pagecache is invalid (Jeff Layton) [1002830] - [fs] nfs: fix inode reference leak (Steve Dickson) [998694] - [fs] nfs: Use session max response size for GETDEVICEINFO gdia_maxcount (Steve Dickson) [922810] - [fs] nfs: Simplify the NFSv4 REMOVE, LINK and RENAME compounds (Steve Dickson) [998697] - [fs] nfs: Simplify the NFSv4 CREATE compound (Steve Dickson) [998697] - [fs] nfs: Simplify the NFSv4 OPEN compound (Steve Dickson) [998697] - [fs] nfs: Simplify the cache invalidation code (Steve Dickson) [998697] - [fs] nfs: Change attribute updates should set NFS_INO_REVAL_PAGECACHE (Steve Dickson) [998697] - [fs] nfs: Simplify nfs_fhget() (Steve Dickson) [998697] - [fs] nfs: Always trust the PageUptodate flag when we have a delegation (Steve Dickson) [998697] - [fs] nfs: Optimise away nfs_check_inode_attributes() when holding a delegation (Steve Dickson) [998697] - [fs] nfs: Dont force page cache revalidations when holding a delegation (Steve Dickson) [998697] - [fs] nfs: Retrieve attributes _before_ calling delegreturn (Steve Dickson) [998697] - [fs] nfs: Fix a typo in NFS4_enc_link_sz (Steve Dickson) [998697] - [scsi] Fix bug on some bnx2x devices that don't support iSCSI (Tomas Henzl) [957217] - [scsi] mpt3sas: Added a driver module parameter max_msix_vectors (Tomas Henzl) [997045] - [scsi] aacraid: Fix for arrays going offline in the system. System hangs (Rich Bono) [996207]- [fs] gfs2: dont overrun reserved revokes (Benjamin Marzinski) [996637] - [s390] qeth: change default standard blkt settings for OSA (Hendrik Brueckner) [997625] - [s390] kernel: z90crypt module load crash (Hendrik Brueckner) [997621] - [s390] dasd: fix hanging devices after path events (Hendrik Brueckner) [996185] - [cpufreq] revert "remove rwsem lock from CPUFREQ_GOV_STOP call -- second call site" (Prarit Bhargava) [869899] - [perf] Fix regs retrieval for tracepoints events (Jiri Olsa) [1000706] - [tools] perf: Fix period symbol_conf.field_sep display (Jiri Olsa) [985968] - [tools] traceevent: Handle dynamic array's element size properly (Jiri Olsa) [664899] - [tools] perf: Fix perf build make command and BuildRequires (Jiri Olsa) [968186] - [tools] perf: Add support for wildcard in tracepoint system name (Jiri Olsa) [664899] - [perf] Add support for PERF_HW_COUNT_REF_CPU_CYCLES (Jiri Olsa) [968806] - [perf] events: Add Intel x86 mapping for PERF_COUNT_HW_REF_CPU_CYCLES (Jiri Olsa) [968806] - [perf] events: Add PERF_COUNT_HW_REF_CPU_CYCLES generic PMU event (Jiri Olsa) [968806] - [perf] events: Enable raw event support for Intel unhalted_reference_cycles event (Jiri Olsa) [968806] - [net] phonet: some signedness bugs (Francesco Fusco) [1000271] - [net] phonet: put protocols array under RCU (Francesco Fusco) [1000271] - [net] openvswitch: Add vxlan tunneling support (Amerigo Wang) [981285] - [net] vxlan: Add tx-vlan offload support (Amerigo Wang) [981285] - [net] vxlan: Improve vxlan headroom calculation (Amerigo Wang) [981285] - [net] vxlan: Factor out vxlan send api (Amerigo Wang) [981285] - [net] vxlan: Extend vxlan handlers for openvswitch (Amerigo Wang) [981285] - [net] vxlan: Add vxlan recv demux (Amerigo Wang) [981285] - [net] vxlan: Restructure vxlan receive (Amerigo Wang) [981285] - [net] vxlan: Restructure vxlan socket apis (Amerigo Wang) [981285] - [net] openvswitch: Reset tunnel key between input and output (Amerigo Wang) [981285] - [net] openvswitch: Use correct type while allocating flex array (Amerigo Wang) [981285] - [net] openvswitch: Fix bad merge resolution (Amerigo Wang) [981285] - [net] vxlan: fix a soft lockup in vxlan module removal (Amerigo Wang) [923915] - [net] vxlan: fix a regression of igmp join (Amerigo Wang) [923915] - [net] vxlan: fix rcu related warning (Amerigo Wang) [923915] - [net] vxlan: fdb: replace an existing entry (Amerigo Wang) [923915] - [kernel] list: introduce list_first_entry_or_null (Amerigo Wang) [923915] - [net] vxlan: fix igmp races (Amerigo Wang) [923915] - [net] vxlan: unregister on namespace exit (Amerigo Wang) [923915] - [net] vxlan: add necessary locking on device removal (Amerigo Wang) [923915] - [net] vxlan: Fix kernel crash on rmmod (Amerigo Wang) [923915] - [net] vxlan: fix function name spelling (Amerigo Wang) [923915] - [net] vxlan: fdb: allow specifying multiple destinations for zero MAC (Amerigo Wang) [923915] - [net] rtnetlink: allow using zero MAC address in rtnl_fdb_add, rtnl_fdb_del (Amerigo Wang) [923915] - [net] fix address check in rtnl_fdb_del (Amerigo Wang) [923915] - [net] vxlan: allow removal of single destination from fdb entry (Amerigo Wang) [923915] - [net] vxlan: introduce vxlan_fdb_parse (Amerigo Wang) [923915] - [net] vxlan: introduce vxlan_fdb_find_rdst (Amerigo Wang) [923915] - [net] vxlan: add implicit fdb entry for default destination (Amerigo Wang) [923915] - [net] vxlan: Fix sparse warnings (Amerigo Wang) [923915] - [net] vxlan: cosmetic cleanup's (Amerigo Wang) [923915] - [net] vxlan: Use initializer for dummy structures (Amerigo Wang) [923915] - [net] vxlan: port module param should be ushort (Amerigo Wang) [923915] - [net] vxlan: convert remotes list to list_rcu (Amerigo Wang) [923915] - [net] vxlan: make vxlan_xmit_one void (Amerigo Wang) [923915] - [net] vxlan: move cleanup to uninit (Amerigo Wang) [923915] - [net] vxlan: fix race caused by dropping rtnl_unlock (Amerigo Wang) [923915] - [net] vxlan: send notification when MAC migrates (Amerigo Wang) [923915] - [net] vxlan: move IGMP join/leave to work queue (Amerigo Wang) [923915] - [net] vxlan: fix crash from work pending on module removal (Amerigo Wang) [923915] - [net] vxlan: fix out of order operation on module removal (Amerigo Wang) [923915] - [net] vxlan: fix check for migration of static entry (Amerigo Wang) [923915] - [net] vxlan: handle skb_clone failure (Amerigo Wang) [923915] - [net] vxlan: only migrate dynamic FDB entries (Amerigo Wang) [923915] - [net] vxlan: fix race between flush and incoming learning (Amerigo Wang) [923915] - [net] vxlan: defer vxlan init as late as possible (Amerigo Wang) [923915] - [net] vxlan: use unsigned int instead of unsigned (Amerigo Wang) [923915] - [net] vxlan: remove the unused rcu head from struct vxlan_rdst (Amerigo Wang) [923915] - [net] vxlan: Update vxlan fdb 'used' field after each usage (Amerigo Wang) [923915] - [net] vxlan: listen on multiple ports (Amerigo Wang) [923915] - [net] vxlan: do not set SKB_GSO_UDP (Amerigo Wang) [923915] - [net] vxlan: allow choosing destination port per vxlan (Amerigo Wang) [923915] - [net] vxlan: compute source port in network byte order (Amerigo Wang) [923915] - [net] vxlan: source compatiablity with IFLA_VXLAN_GROUP (Amerigo Wang) [923915] - [net] vxlan: fix byte order issues with NDA_PORT (Amerigo Wang) [923915] - [net] vxlan: document UDP default port (Amerigo Wang) [923915] - [net] vxlan: update mail address and copyright date (Amerigo Wang) [923915] - [net] vxlan: Allow L2 redirection with L3 switching (Amerigo Wang) [923915] - [net] vxlan: Allow setting destination to unicast address (Amerigo Wang) [923915] - [net] vxlan: don't bypass encapsulation for multi- and broadcasts (Amerigo Wang) [923915] - [net] vxlan: use htonl when snooping for loopback address (Amerigo Wang) [923915] - [net] vxlan: fix some sparse warnings (Amerigo Wang) [923915] - [net] vxlan: Bypass encapsulation if the destination is local (Amerigo Wang) [923915] - [net] vxlan: Fix sparse warnings (Amerigo Wang) [923915] - [net] vxlan: Use IP Tunnels tunnel ENC encap API (Amerigo Wang) [923915] - [net] vxlan: generalize forwarding tables (Amerigo Wang) [923915] - [net] vxlan: Add vlan support to static neighbors (Amerigo Wang) [923915] - [net] vxlan: allow live mac address change (Amerigo Wang) [923915] - [net] vxlan: add DOVE extensions for VXLAN (Amerigo Wang) [923915] - [net] vxlan: move SET_ETHTOOL_OPS() to vxlan_newlink() (Amerigo Wang) [923915] - [net] vxlan: specify fl4.proto before calling ip_route_output_key() (Amerigo Wang) [923915] - [net] vxlan: Depend on CONFIG_INET (Amerigo Wang) [923915] - [net] fix invalid usage of netdev->priv_flags (Stanislaw Gruszka) [984373]- [drm] upstream sync to 3.9.9 (Rob Clark) [818344 902637 962824] - [uapi] install UAPI headers in the correct path (Rob Clark) [962824] - [debug] lockdep: provide mutex_lock_nest_lock (Rob Clark) [962824] - [pci] backport PCIE_SPEED_* (Rob Clark) [962824] - [pci] Add PCIe Link Capability link speed and width names (Rob Clark) [962824] - [fs] export get_task_comm() (Rob Clark) [962824] - [x86] sgi-xp: handle non-fatal traps - headers (George Beshers) [956876] - [x86] sgi-xp: handle non-fatal traps (George Beshers) [956876] - [x86] irq: Rename gsi_end gsi_top, and fix off by one errors (Prarit Bhargava) [998602] - [x86] ioapic: In mpparse use mp_register_ioapic (Prarit Bhargava) [998602] - [x86] ioapic: Teach mp_register_ioapic to compute a global gsi_end (Prarit Bhargava) [998602] - [x86] Reinsert "io_apic: initialize nr_ioapic_registers early in mp_register_ioapic()" (Prarit Bhargava) [855057 998602] - [virt] Add a check to catch KVM emulation of Hyper-V (Jason Wang) [985747] - [virt] kvm: Switch to use hypervisor_cpuid_base() (Jason Wang) [985747] - [x86] Introduce hypervisor_cpuid_base() (Jason Wang) [985747] - [kernel] kexec: add the values related to buddy system for filtering free pages (Nigel Croxon) [960746] - [virt] hv_balloon: Initialize the transaction ID just before sending the packet (Jason Wang) [993473] - [virt] hv_balloon: Do not post pressure status if interrupted (Jason Wang) [993473] - [virt] hv_balloon: Fix a bug in the hot-add code (Jason Wang) [993473] - [kernel] sysctl: range checking in do_proc_dointvec_ms_jiffies_conv (Francesco Fusco) [972430] - [net] neigh: prevent overflowing params in /proc/sys/net/ipv4/neigh/ (Francesco Fusco) [972430] - [net] neigh: fix some compiler warning in net/core/neighbour.c (Francesco Fusco) [972430] - [net] neigh: prohibit negative value for unres_qlen_bytes parameter (Francesco Fusco) [972430] - [net] netfilter: don't permit ct creation with random tuple (Thomas Graf) [994393] - [net] netfilter: fix BUG_ON while removing nf_conntrack with netns (Thomas Graf) [991246] - [net] gro: Fix kcalloc argument order (Amerigo Wang) [995405] - [net] gro: fix a race in gro_cell_poll() (Amerigo Wang) [995405] - [net] ip_tunnel: fix a pointer cast in ip_tunnel_xmit() (Amerigo Wang) [995405] - [virt] xen: avoid allocation causing potential swap activity on the resume path (Radim Krcmar) [996631] - [virt] xen: ensure timer tick is resumed even on CPU driving the resume (Radim Krcmar) [996631] - [infiniband] ipoib: Fix race in deleting ipoib_neigh entries (Doug Ledford) [987174] - [scsi] libiscsi: Added new boot entries in the session sysfs (Chris Leech) [994743] - [x86] kvm: use kernel_fpu_begin/end() in kvm_load/put_guest_fpu() (Fam Zheng) [988658] - [block] do not pass disk names as format strings (Alexander Gordeev) [971372] {CVE-2013-2851}- [fs] Revert "ext4: dont let i_reserved_meta_blocks go negative" (Rafael Aquini) [916592] - [fs] Revert "ext4: introduce reserved space" (Rafael Aquini) [916592] - [netdrv] bnx2x: fill in sane dump flag information (Michal Schmidt) [995475 996988] - [netdrv] bnx2x: remove zeroing of dump data buffer (Michal Schmidt) [995475 996988] - [netdrv] bnx2x: fix dump flag handling (Michal Schmidt) [995475 996988] - [netdrv] bnx2x: fix crash in bnx2x_set_vlan_stripping() (Michal Schmidt) [995475] - [scsi] lpfc: Update lpfc version for 8.3.7.21.1p driver release (Rob Evers) [947546] - [scsi] lpfc: Merge with "lpfc 8.3.31: Fixed system panic due to midlayer abort and (Rob Evers) [947546] - [scsi] lpfc: Removed obsolete fcp_eq_count and fcp_wq_count driver attributes (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Update Copyrights to 2013 for 8.3.38, 8.3.39, and 8.3.40 modifications (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fixed a race condition between SLI host and port failed FCF rediscovery (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fixed issue mailbox wait routine failed to issue dump memory mbox command (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fixed system panic due to unsafe walking and deleting linked list (Rob Evers) [947546] - [scsi] lpfc: lpfc 8.3.40: Fixed FCoE connection list vlan identifier and add FCF list debug (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Clarified the behavior of the lpfc_max_luns module parameter (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fix to allow OCM to report FEC status (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fixed a missing return code in a logging message (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fixed some logging message fields (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fixed list corruption when lpfc_drain_tx runs (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fix starting reference tag when calculating BG error (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fix inconsistent list removal causes crash (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fixed system panic during handling unsolicited receive buffer error condition (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fix BlockGuard error checking (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fixed crash during FCoE failover testing (Rob Evers) [947546] - [scsi] lpfc: 8.3.40: Fix lpfc_used_cpu to be more dynamic (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed driver handling of CLEAR_LA with NPIV enabled causing SID=0 frames out (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Reduced tmo value set to FLOGI WQE for quick recovery from FLOGI sequence timeout (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Add log message when completes with clean address bit set to zero (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed driver vector mapping to CPU affinity (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed iocb flags not being reset for scsi commands (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed system panic during EEH recovery due to midlayer acting on outstanding I/O (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed not returning FAILED status when SCSI invoking host reset handler failed (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed bad book keeping in posting els sgls to port (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed BlockGuard to take advantage of rdprotect/wrprotect info when available (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Reduced spinlock contention on SCSI buffer list (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed crash when processing bsg's sg list with high memory pages (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Remove lpfc_fcp_look_ahead module parameter (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fix driver issues with SCSI Host reset (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Doorbell formation information logged in dual-chute mode WQ and RQ setup (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fix driver issues with large s/g lists for BlockGuard (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fix driver issues with large lpfc_sg_seg_cnt values (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed pt2pt and loop discovery problems on topology changes (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Remove driver dependency on HZ (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed BlockGuard error reporting (Rob Evers) [947546] - [scsi] lpfc: 8.3.39: Fixed VPI allocation issues after firmware dump is performed (Rob Evers) [947546] - [scsi] lpfc: fix potential NULL pointer dereference in lpfc_sli4_rq_put() (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fixed potential mis-interpretation of READ_TOPOLOGY reserved fields (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fix default value for lpfc_enable_rrq (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fixed circular locking dependency and inconsistent lock state issues (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fixed PT2PT bring up problem for FC SLI4 (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fixed OXID reuse issue (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fixed async FCF modified event to in-use FCF failure to trigger recovery (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fixed deadlock condition in FCF round robin handling (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fixed bsg timeout handling issues that would result in crashes ? applied and checked into RHEL6.5 (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fixed degraded performance after cable pulls (Rob Evers) [947546] - [scsi] lpfc: 8.3.38: Fixed NMI watch dog panic's when resetting the hba (Rob Evers) [947546] - [scsi] lpfc: treewide: Fix typos in kernel messages (Rob Evers) [947546] - [scsi] lpfc: fix lpfc build when wmb() is defined as mb() (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Fixed infinite loop in lpfc_sli4_fcf_rr_next_index_get (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Fixed crash due to SLI Port invalid resource count (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Provide support for FCoE protocol dual-chute (ULP) operation (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Fixed stale ndlp state when the node is marked for deferred removal (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Fix potential memory corruption bug (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Fixed no-context ABTS failed with BA_RJT (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Removed use of NOP mailboxes for interrupt verification (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Fixed exhausted retry for plogi to nameserver (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Fixed ELS_REC received on the unsolicited receive queue (Rob Evers) [947546] - [scsi] lpfc: 8.3.37: Provide support for change_queue_type (Rob Evers) [947546] - [scsi] lpfc: 8.3.36: Correct mask error (Rob Evers) [947546] - [scsi] lpfc: 8.3.36: Correct buffer length overrun (Rob Evers) [947546] - [scsi] lpfc: 8.3.36: Update DIF support for passthru/strip/insert (Rob Evers) [947546] - [scsi] lpfc: 8.3.36: Fix bug with Target Resets and FCP2 devices (Rob Evers) [947546] - [scsi] lpfc: 8.3.35: Fixed not checking solicition in progress bit when verifying FCF record for use (Rob Evers) [947546] - [scsi] lpfc: 8.3.35: Fixed PRLI not being retried if a LS_RJT with a reason (Rob Evers) [947546] - [scsi] lpfc: 8.3.35: Expand I/O channel support for large systems (Rob Evers) [947546] - [scsi] lpfc: 8.3.34: Adjust IO Channels to 1 when INTx (Rob Evers) [947546] - [scsi] lpfc: 8.3.35: Fix interrupt delay multipler conversion for eq_create (Rob Evers) [947546] - [scsi] lpfc 8.3.34: Correct typecasts for snprintf messages (Rob Evers) [947546] - [scsi] lpfc: 8.3.34: Fix number of IO channels to match CPUs (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Fixed debugfs queInfo to include queue stats (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Add lpfc_fcp_look_ahead module parameter (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Make I/O to hw queue distribution algorithm a module parameter (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Change Naming convention for SLI4 Interrupt vector (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Allow per-hba interrupt rate tuning (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Tie parallel I/O queues into separate MSIX vectors (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Add Interrupts per second stats via debugfs (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Parallelize SLI-4 Q distribution (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Formally separate lpfc_sli_ring SLI-3 and SLI-4 variantions (Rob Evers) [947546] - [scsi] lpfc: 8.3.33: Add debugfs interface to display SLI queue information (Rob Evers) [947546] - [scsi] lpfc: treewide: fix comment/printk/variable typos (Rob Evers) [947546] - [netdrv] qlcnic: Update version to 5.2.43 (Chad Dupuis) [927395] - [netdrv] qlcnic: Enhance virtual NIC logging (Chad Dupuis) [927395] - [netdrv] qlcnic: qlcnic_get_board_name() function cleanup (Chad Dupuis) [927395] - [netdrv] qlcnic: Implement GET_LED_STATUS command for 82xx adapter (Chad Dupuis) [927395] - [netdrv] qlcnic: modify reset recovery path in diag mode (Chad Dupuis) [927395] - [netdrv] qlcnic: diagnostics routine changes (Chad Dupuis) [927395] - [netdrv] qlcnic: Convert nested if-else to switch-case (Chad Dupuis) [927395] - [netdrv] qlcnic: Initialize trans_work and idc_aen_work at VF probe (Chad Dupuis) [927395] - [netdrv] qlcnic: Remove qlcnic_config_npars module parameter (Chad Dupuis) [927395] - [netdrv] qlcnic: Update IRQ name for 8200 and 8300 Series adapter (Chad Dupuis) [927395] - [netdrv] qlcnic: Disable INT-x interrupt for 83xx on driver unload (Chad Dupuis) [927395] - [netdrv] qlcnic: Support spoof check config (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix LRO bugs while tuning offloads using Q application (Chad Dupuis) [927395] - [netdrv] qlcnic: Enable LRO if it was disabled by RX checksum (Chad Dupuis) [927395] - [netdrv] qlcnic: remove netdev->trans_start updates within the driver (Chad Dupuis) [927395] - [netdrv] qlcnic: Return proper error codes from probe failure paths (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix validation of link event command (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix mailbox response handling (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix bug in diagnostics test reset recovery path (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix reset recovery after transmit timeout (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix ethtool supported port status for 83xx (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix missing bracket in module parameter (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix ethtool strings (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix setting MAC address (Chad Dupuis) [927395] - [netdrv] qlcnic: Update version to 5.2.42 (Chad Dupuis) [927395] - [netdrv] qlcnic: Add identifying string for 83xx adapter (Chad Dupuis) [927395] - [netdrv] qlcnic: Rename the IRQ description (Chad Dupuis) [927395] - [netdrv] qlcnic: Enable Interrupt Coalescing for 83xx adapter (Chad Dupuis) [927395] - [netdrv] qlcnic: Add eSwitch statistics support (Chad Dupuis) [927395] - [netdrv] qlcnic: Take EPORT out of reset sequence before disabling PAUSE (Chad Dupuis) [927395] - [netdrv] qlcnic: Enhance channel configuration logs (Chad Dupuis) [927395] - [netdrv] qlcnic: Update version to 5.2.41 (Chad Dupuis) [927395] - [netdrv] qlcnic: Support polling for mailbox events (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix loopback test for SR-IOV PF (Chad Dupuis) [927395] - [netdrv] qlcnic: Support VLAN id config (Chad Dupuis) [927395] - [netdrv] qlcnic: Support MAC address, Tx rate config (Chad Dupuis) [927395] - [netdrv] qlcnic: VF reset recovery implementation (Chad Dupuis) [927395] - [netdrv] qlcnic: VF FLR implementation (Chad Dupuis) [927395] - [netdrv] qlcnic: Change 82xx adapter VLAN id endian type (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix typo in logs (Chad Dupuis) [927395] - [netdrv] qlcnic: fix TSO race condition (Chad Dupuis) [927395] - [netdrv] qlcnic: Stop traffic before performing loopback test (Chad Dupuis) [927395] - [netdrv] qlcnic: fix beaconing test for 82xx adapter (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix set_flags handler for ethtool (Chad Dupuis) [927395] - [netdrv] qlcnic: Bump up the version to 5.2.40 (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix sparse warnings (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix NULL dereference in error path (Chad Dupuis) [927395] - [netdrv] qlcnic: Fix potential NULL dereference (Chad Dupuis) [927395] - [netdrv] qlcnic: Bump up the version to 5.2.39 (Chad Dupuis) [927395] - [netdrv] qlcnic: Support atomic commands (Chad Dupuis) [927395] - [netdrv] qlcnic: Support VF-PF communication channel commands (Chad Dupuis) [927395] - [netdrv] qlcnic: VF-PF communication channel implementation (Chad Dupuis) [927395] - [netdrv] qlcnic: Use shared interrupt vector for Tx and Rx (Chad Dupuis) [927395] - [netdrv] qlcnic: SR-IOV VF probe (Chad Dupuis) [927395] - [netdrv] qlcnic: Support SR-IOV enable and disable (Chad Dupuis) [927395] - [netdrv] qlcnic: Add QLCNIC_SRIOV to Kconfig (Chad Dupuis) [927395]- [mm] reinstate mmap -EINVAL return error code when mapping length is zero (Rafael Aquini) [995339] - [fs] ext4: introduce reserved space (Lukas Czerner) [916592] - [fs] ext4: dont let i_reserved_meta_blocks go negative (Lukas Czerner) [916592] - [firmware] efivars: Use correct efi_pstore_info struct when calling pstore_register (Lenny Szubowicz) [867689] - [s390] zfcp: block queue limits with data router (Hendrik Brueckner) [952734] - [char] ipmi: eliminate long delay in ipmi_si on SGI UV2 (George Beshers) [876778] - [net] bridge: fix a conflict in if_bridge.h with glibc headers (Amerigo Wang) [981325] - [usb] fix endpoint-disabling for failed config changes (Don Zickus) [889391] - [usb] Free the allocated memory before exiting on error (Don Zickus) [889391] - [usb] xhci: fix list access before init (Don Zickus) [889391] - [usb] xhci-mem: init list heads at the beginning of init (Don Zickus) [889391] - [usb] xhci: override bogus bulk wMaxPacketSize values (Don Zickus) [889391] - [usb] enclose USB_XHCI_HCD related symbols within a if USB_XHCI_HCD block (Don Zickus) [889391] - [usb] xhci: clarify compliance mode debug messages (Don Zickus) [889391] - [usb] xhci: Rename SEGMENT_SIZE and SEGMENT_SHIFT as the former is used in a.out.h (Don Zickus) [889391] - [usb] xhci: Use ilog2() rather than __ffs() for calculating SEGMENT_SHIFT (Don Zickus) [889391] - [usb] xhci: Don't warn on empty ring for suspended devices (Don Zickus) [889391] - [usb] xhci: Fix TRB transfer length macro used for Event TRB (Don Zickus) [889391] - [usb] xhci: fix build warning (Don Zickus) [889391] - [usb] xhci: fix bit definitions for IMAN register (Don Zickus) [889391] - [usb] xhci: correctly enable interrupts (Don Zickus) [889391] - [usb] xhci: fix memory leak of URB-private data (Don Zickus) [889391] - [usb] xhci: fix incorrect bit test (Don Zickus) [889391] - [usb] xhci: Fix TD size for isochronous URBs (Don Zickus) [889391] - [usb] xhci: Fix isoc TD encoding (Don Zickus) [889391] - [usb] xhci: remove unused trb var in xhci_irq() (Don Zickus) [889391] - [usb] xhci: Add Lynx Point LP to list of Intel switchable hosts (Don Zickus) [889391] - [usb] xhci: move HC_STATE_SUSPENDED check to xhci_suspend() (Don Zickus) [889391] - [usb] xhci: Stricter conditional for Z1 system models for Compliance Mode Patch (Don Zickus) [889391] - [usb] xhci: Extend Fresco Logic MSI quirk (Don Zickus) [889391] - [usb] xhci: fix null-pointer dereference when destroying half-built segment rings (Don Zickus) [889391] - [usb] xhci: Fix TD Size calculation on 1.0 hosts (Don Zickus) [889391] - [usb] xhci: Fix conditional check in bandwidth calculation (Don Zickus) [889391] - [usb] xhci: Avoid global symbol pollution with handshake (Don Zickus) [889391] - [usb] xhci: Remove assigned but unused ep_ctx (Don Zickus) [889391] - [usb] xhci: Remove assigned but unused slot_ctx (Don Zickus) [889391] - [usb] xhci: Fix missing break in xhci_evaluate_context_result (Don Zickus) [889391] - [usb] xhci: Fix potential NULL ptr deref in command cancellation (Don Zickus) [889391] - [usb] xhci: Remove __force__ __u16 before assigning DeviceRemovable and assign directly (Don Zickus) [889391] - [usb] xhci-ring: removes unnecessary semicolon (Don Zickus) [889391] - [usb] xhci: update a comment regarding the BOS descriptor to reflect the code (Don Zickus) [889391] - [usb] xhci: sparse fixes (Don Zickus) [889391] - [usb] Fail a get config when the port is powered off (Don Zickus) [889391] - [usb] xhci: Handle clear PORT_POWER feature (Don Zickus) [889391] - [usb] redefine DeviceRemovable and wHubDelay as _le16 (Don Zickus) [889391] - [usb] xhci: Avoid "dead ports", add roothub port polling (Don Zickus) [894180] - [usb] Handle warm reset failure on empty port (Don Zickus) [894180] - [usb] Ignore port state until reset completes (Don Zickus) [894180] - [usb] Increase reset timeout (Don Zickus) [894180] - [usb] Allow USB 3.0 ports to be disabled (Don Zickus) [894180] - [usb] Ignore xHCI Reset Device status (Don Zickus) [894180] - [usb] Handle auto-transition from hot to warm reset (Don Zickus) [894180] - [usb] xhci: Handle HS bulk/ctrl endpoints that don't NAK (Don Zickus) [894180] - [usb] Enable LPM after a failed probe (Don Zickus) [815547] - [usb] Don't enable LPM if the exit latency is zero (Don Zickus) [815547] - [usb] Send Set SEL before enablng parent U1/U2 timeout (Don Zickus) [815547] - [usb] xhci: endianness xhci_calculate_intel_u2_timeout (Don Zickus) [815547] - [usb] xhci: fix integer overflow (Don Zickus) [815547] - [usb] Fix LPM disable count mismatch on driver unbind (Don Zickus) [815547] - [usb] Disable LPM while the device is unconfigured (Don Zickus) [815547] - [usb] Fix LPM disable/enable during device reset (Don Zickus) [815547] - [usb] xhci: Fix DIV_ROUND_UP compile error (Don Zickus) [815547] - [usb] xhci: Fix compile with CONFIG_USB_SUSPEND=n (Don Zickus) [815547] - [usb] Fix core compile with CONFIG_USB_SUSPEND=n (Don Zickus) [815547] - [usb] Disable hub-initiated LPM for comms devices (Don Zickus) [815547] - [usb] xhci: Add Intel U1/U2 timeout policy (Don Zickus) [815547] - [usb] xhci: Add infrastructure for host-specific LPM policies (Don Zickus) [815547] - [usb] Add macros for interrupt endpoint types (Don Zickus) [815547] - [usb] xhci: Reserve one command for USB3 LPM disable (Don Zickus) [815547] - [usb] xhci: Some Evaluate Context commands must succeed (Don Zickus) [815547] - [usb] Disable USB 3.0 LPM in critical sections (Don Zickus) [815547] - [usb] Add support to enable/disable USB3 link states (Don Zickus) [815547] - [usb] Allow drivers to disable hub-initiated LPM (Don Zickus) [815547] - [usb] Calculate USB 3.0 exit latencies for LPM (Don Zickus) [815547] - [usb] Refactor code to set LPM support flag (Don Zickus) [815547] - [usb] Make sure to fetch the BOS desc for roothubs (Don Zickus) [815547] - [usb] xhci: Add roothub code to set U1/U2 timeouts (Don Zickus) [815547] - [scsi] pm8001: Add new driver pmc8001 to RHEL 6.5 (Rich Bono) [922129] - [scsi] bnx2fc: introduce missing kfree (Jan Vesely) [916004] - [scsi] bnx2fc: Fix common misspellings (Jan Vesely) [916004] - [scsi] bnx2fc: Drivers: scsi: remove __dev* attributes (Jan Vesely) [916004] - [scsi] bnx2fc: Make the fcoe_cltr the SCSI host parent (Jan Vesely) [916004] - [scsi] bnx2fc: Bumped version to 1.0.14 (Jan Vesely) [916004] - [scsi] bnx2fc: Update copyright dates (Jan Vesely) [916004] - [scsi] bnx2fc: Fix race condition between IO completion and abort (Jan Vesely) [916004] - [scsi] bnx2fc: Include chip number in the symbolic name (Jan Vesely) [916004] - [scsi] bnx2fc: Enable cached tasks to improve performance (Jan Vesely) [916004] - [scsi] bnx2fc: adjust duplicate test (Jan Vesely) [916004] - [scsi] bnx2fc: Bumped version to 1.0.13 (Jan Vesely) [916004] - [scsi] bnx2fc: Support max IO size to 512KB (Jan Vesely) [916004] - [scsi] bnx2fc: Tx/Rx byte counts reset to 0 when exceeding 32 bit values (Jan Vesely) [916004] - [scsi] bnx2fc: Map the doorbell register between offload and enable requests (Jan Vesely) [916004] - [scsi] bnx2fc: Move offload/upload wait logic into a function (Jan Vesely) [916004] - [scsi] bnx2fc: support software fcoe target (Jan Vesely) [916004] - [scsi] bnx2fc: remove useless calls to memset() (Jan Vesely) [916004] - [scsi] bnx2fc: use fcoe_get_lesb/fcoe_ctlr_get_lesb() directly from libfcoe (Jan Vesely) [916004] - [scsi] bnx2fc: use fcoe_link_speed_update() from the exported symbol in libfcoe (Jan Vesely) [916004] - [scsi] bnx2fc: add support to get_netdev for bnx2f_interface (Jan Vesely) [916004] - [scsi] bnx2fc: Use the fcoe_sysfs control interface (Jan Vesely) [916004] - [scsi] libfcoe, fcoe, bnx2fc: Add new fcoe control interface (Jan Vesely) [916004] - [scsi] bnx2fc: treewide: fix typo of "suppport" in various comments (Jan Vesely) [916004] - [scsi] fix various printk and comment typos (Jan Vesely) [916004] - [scsi] fcoe, bnx2fc, libfcoe: SW FCoE and bnx2fc use FCoE Syfs (Jan Vesely) [916004] - [scsi] bnx2fc: Allocate fcoe_ctlr with bnx2fc_interface, not as a member (Jan Vesely) [916004] - [scsi] bnx2i: Fixed bugs in the handling of unsolicited NOP-Ins (Jan Vesely) [916003] - [scsi] bnx2i: Update version and copyright year 2013 (Jan Vesely) [916003] - [scsi] bnx2i: Drivers: scsi: remove __dev* attributes (Jan Vesely) [916003] - [scsi] bnx2i: Fix typo in printk and comments (Jan Vesely) [916003] - [scsi] bnx2i: fix the bit manipulation when setting the error mask (Jan Vesely) [916003] - [scsi] bnx2i: removed the individual PCI DEVICE ID checking (Jan Vesely) [916003]- [netdrv] ixgbe: fix broken module parameter IntMode (Andy Gospodarek) [958967] - [netdrv] ixgbe: fix broken module parameter FdirMode (Andy Gospodarek) [958967] - [fs] fuse: initialize dentry->d_op properly in fuse_direntplus_link() (Brian Foster) [994492] - [fs] nfs4: Fix infinite loop in nfs4_lookup_root (Scott Mayhew) [987426] - [tracing] Replace syscall_meta_data struct array with pointer array (Jiri Olsa) [992987] - [tracing] Replace trace_event struct array with pointer array (Jiri Olsa) [992987] - [mm] percpu: don't implicitly include slab.h from percpu.h (Baoquan He) [878312] - [mm] percpu: fix per_cpu_ptr_to_phys() handling of non-page-aligned addresses (Baoquan He) [878312] - [mm] percpu: explain why per_cpu_ptr_to_phys() is more complicated than necessary (Baoquan He) [878312] - [mm] percpu: fix chunk range calculation (Baoquan He) [878312] - [mm] percpu: should use is_vmalloc_addr() (Baoquan He) [878312] - [mm] percpu: fix pcpu_last_unit_cpu (Baoquan He) [878312] - [mm] percpu: fix first chunk match in per_cpu_ptr_to_phys() (Baoquan He) [878312] - [mm] percpu: fix trivial bugs in pcpu_build_alloc_info() (Baoquan He) [878312] - [mm] percpu: move vmalloc based chunk management into percpu-vm.c (Baoquan He) [878312] - [mm] percpu: misc preparations for nommu support (Baoquan He) [878312] - [mm] percpu: reorganize chunk creation and destruction (Baoquan He) [878312] - [mm] percpu: factor out pcpu_addr_in_first/reserved_chunk() and update per_cpu_ptr_to_phys() (Baoquan He) [878312] - [mm] percpu: add __percpu sparse annotations to core kernel subsystems (Baoquan He) [878312] - [mm] percpu: avoid calling __pcpu_ptr_to_addr() (Baoquan He) [878312] - [mm] percpu: refactor the code in pcpu_depopulate_chunk() (Baoquan He) [878312] - [mm] percpu: add missing per_cpu_ptr_to_phys() definition for UP (Baoquan He) [878312] - [mm] percpu: Fix kdump failure if booted with percpu_alloc=page (Baoquan He) [878312] - [mm] Revert: percpu: fix chunk range calculation (Baoquan He) [878312] - [mm] Revert: percpu: Fix kdump crash_notes content lost in case i386 debug (Baoquan He) [878312] - [md] raid5: fix interaction of 'replace' and 'recovery' (Jes Sorensen) [994382] - [md] raid10: remove use-after-free bug (Jes Sorensen) [994382] - [md] Remove recent change which allows devices to skip recovery (Jes Sorensen) [994382] - [md] raid10: fix two problems with RAID10 resync (Jes Sorensen) [994382] - [infiniband] ocrdma: Fix several stack info leaks (Doug Ledford) [827601] - [infiniband] ocrdma: Remove unused include (Doug Ledford) [827601] - [infiniband] hw: import new ocrdma driver from upstream tree (Doug Ledford) [827601] - [infiniband] cma: Export AF_IB statistics (Michal Schmidt) [908111] - [infiniband] ucma: Allow user space to specify AF_IB when joining multicast (Michal Schmidt) [908111] - [infiniband] ucma: Allow user space to pass AF_IB into resolve (Michal Schmidt) [908111] - [infiniband] ucma: Allow user space to bind to AF_IB (Michal Schmidt) [908111] - [infiniband] ucma: Name changes to indicate only IP addresses supported (Michal Schmidt) [908111] - [infiniband] ucma: Add ability to query GID addresses (Michal Schmidt) [908111] - [infiniband] cma: Export cma_get_service_id() (Michal Schmidt) [908111] - [infiniband] ucma: Support querying when IB paths are not reversible (Michal Schmidt) [908111] - [infiniband] sa: Export function to pack a path record into wire format (Michal Schmidt) [908111] - [infiniband] ucma: Support querying for AF_IB addresses (Michal Schmidt) [908111] - [infiniband] cma: Only listen on IB devices when using AF_IB (Michal Schmidt) [908111] - [infiniband] cma: Set qkey for AF_IB (Michal Schmidt) [908111] - [infiniband] cma: Expose private data when using AF_IB (Michal Schmidt) [908111] - [infiniband] cma: Merge cma_get/save_net_info (Michal Schmidt) [908111] - [infiniband] cma: Remove unused SDP related code (Michal Schmidt) [908111] - [infiniband] cma: Add support for AF_IB to cma_get_service_id() (Michal Schmidt) [908111] - [infiniband] cma: Add support for AF_IB to rdma_resolve_route() (Michal Schmidt) [908111] - [infiniband] cma: Add support for AF_IB to rdma_resolve_addr() (Michal Schmidt) [908111] - [infiniband] cma: Verify that source and dest sa_family are the same (Michal Schmidt) [908111] - [infiniband] cma: Restrict AF_IB loopback to binding to IB devices only (Michal Schmidt) [908111] - [infiniband] cma: Add helper functions to return id address information (Michal Schmidt) [908111] - [infiniband] cma: Do not modify sa_family when setting loopback address (Michal Schmidt) [908111] - [infiniband] cma: Allow user to specify AF_IB when binding (Michal Schmidt) [908111] - [infiniband] cma: Update port reservation to support AF_IB (Michal Schmidt) [908111] - [infiniband] cma: Add AF_IB support to ip_addr_size (Michal Schmidt) [908111] - [infiniband] cma: Include AF_IB in loopback and any address checks (Michal Schmidt) [908111] - [infiniband] cma: Allow enabling reuseaddr in any state (Michal Schmidt) [908111] - [infiniband] rdma: Define native IB address (Michal Schmidt) [908111] - [netdrv] mlx4: Set link type for RAW PACKET QPs in the QP context (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Disable VLAN stripping for RAW PACKET QPs (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Fetch XRC SRQ in the CQ polling code (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Advertise MW support (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Support memory window binding (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Remove redundant NULL check before kfree (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Fix compiler warning about uninitialized 'vlan' variable (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Convert is_xxx variables in build_mlx_header() to bool (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Remove local invalidate segment unused fields (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Adjust duplicate test (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Fix bug unwinding on error in mlx4_ib_init_sriov() (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Fix build error on platforms where UL is not 64 bits (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: fix unresolved 64bit math in mellanox/mlx4/en_dcb_nl.c (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Can set maxrate only for TC0 (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Set max rate-limit for a TC (Amir Vadai) [950401 950910 950913 950915] - [netdrv] dcb: Add an optional max rate attribute (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Disable RFS when running in SRIOV mode (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Initialize RFS filters lock and list in init_netdev (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Limit the RFS filter IDs to be < RPS_NO_FILTER (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Add accelerated RFS support (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Add rmap support to mlx4_assign_eq (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: fix small memory leak on error (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Dynamic VST to VST vlan/qos changes (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Fail device init if num_vfs is negative (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Add warning in case of command timeouts (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Replace sscanf() with kstrtoint() (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Add prints when TX timeout occurs (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix a race between napi poll function and RX ring cleanup (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Change log level from error to debug for vlan related messages (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Move register_netdev() to the end of initialization function (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Do not query stats when device port is down (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix resource leak in error flow (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: allow order-0 memory allocations in RX path (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: use one page fragment per incoming frame (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx_en: Timestamping is not supported in slave mode (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Keep VF assigned MAC in the PF admin table (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Handle unassigned VF MAC address correctly (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix adaptive moderation cq update (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Strengthen VLAN tags/priorities enforcement in VST mode (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Add missing report on VST and spoof-checking dev caps (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: fix a build error on 32bit arches (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Add support to get VF config (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Add set VF default vlan ID and priority support (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Add set VF mac address support (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Add structures to keep VF Ethernet ports information (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Add reference counting to MAC registeration (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Disable HW clock overflow check when no HW support (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Disable HW timestamping for VFs (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Expose a few helpers to fill DMFS HW strucutures (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Directly expose fields of DMFS HW rule control segment (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Change a few DMFS fields names to match firmare spec (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Match DMFS promiscuous field names to firmware spec (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Move DMFS HW structs to common header file (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Reduce warning message for SRQ_LIMIT event to debug level (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Add a service task (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Support software timestamping (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Add HW timestamping support (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Read HCA frequency and map internal clock (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Add timestamping device capability (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Implement SRQ object lookup from srqn (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: set correct MTU in SRIOV (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Translate guest B0 steering rules to DMFS (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Add helper function to translate B0 steering rules to DMFS (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Advertize DCB_CAP_DCBX_HOST in getdcbx (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Enable DCB ETS ops only when supported by the firmware (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Added proper description for two device capabilities (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix setting initial MAC address (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Disallow releasing VF QPs which have steering rules (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Always use 64 bit resource ID when doing lookup (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Remove ethtool flow steering rules before releasing QPs (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Fix wrong order of flow steering resources removal (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Fix wrong mask applied on EQ numbers in the wrapper (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Cleanup MAC resources on module unload or port stop (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix race when setting the device MAC address (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Fix endianness bug in set_param_l (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Turn off device-managed FS bit in dev-cap wrapper if DMFS is not enabled (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Disable mlx4_QP_ATTACH calls from guests if the host uses flow steering (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Implement memory windows allocation and deallocation (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Enable memory windows in INIT_HCA and QUERY_HCA (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Disable memory windows for virtual functions (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: fix allocation of device tx_cq (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Propagate MR deregistration failures to caller (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Rename MPT-related functions to have mpt_ prefix (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Add unicast MAC filtering (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Manage hash of MAC addresses per port (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Save previous MAC address of the port so we can replace it later (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Re-arrange ndo_set_rx_mode related code (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Move Ethernet related functionality from mlx4_core to mlx4_en (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Cleanup multiline strings (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Optimize Rx fast path filter checks (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Optimize loopback related checks in data path (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Assigning TX irq per ring (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix compilation error when CONFIG_INET isn't defined (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix error propagation for ethtool helper function (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix transmit timeout when driver restarts port (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Don't reassign port mac address on firmware that supports it (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Use firmware driven flow steering hash mode (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix ethtool rules leftovers after module unloaded (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Block insertion of ethtool steering rules while the interface is down (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix vlan mask for ethtool steering rules (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Validate VLAN IDs provided in ethtool flow steering rules (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix ip/udp steering rules multicast mac when attached via ethtool (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Set correctly allow_loopback flag (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Directly expose fields of HW flow steering rule control segment (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix a race when closing TX queue (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Return proper error code when __mlx4_add_one fails (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Use the correct netif lock on ndo_set_rx_mode (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix traffic loss under promiscuous mode (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Issue the dump eth statistics command under lock (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: remove redundant code (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Add support for destination MAC in steering rules (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Use generic etherdevice.h functions (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Set number of rx/tx channels using ethtool (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix TX moderation info loss after set_ringparam is called (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Adjusting moderation per each ring (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Remove remnants of LRO support (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Unmap UAR also in the case of error flow (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Don't use vlan tag value as an indication for vlan presence (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Perform correct resource cleanup if mlx4_QUERY_ADAPTER() fails (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_core: Remove annoying debug messages from SR-IOV flow (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: fix skb truesize underestimation (Amir Vadai) [950401 950910 950913 950915] - [netdrv] etherdevice.h: Add ether_addr_equal_64bits (Amir Vadai) [950401 950910 950913 950915] - [netdrv] ethtool: Add destination MAC address to flow steering API (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fixing TX queue stop/wake flow (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: nullify cq->vector field when closing completion queue (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Checksum counters per ring (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4: Fix vlan table overflow (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Adding 40gb speed report for ethtool (Amir Vadai) [950401 950910 950913 950915] - [netdrv] mlx4_en: Fix crash upon device initialization error (Amir Vadai) [950401 950910 950913 950915] - [net] introduce IFF_NO_UNICAST_FLT (Doug Ledford) [791284 865301 950918 983117] - [infiniband] ipoib: Add more rtnl_link_ops callbacks (Doug Ledford) [791284 865301 950918 983117] - [infiniband] ipoib: Add rtnl_link_ops support (Doug Ledford) [791284 865301 950918 983117] - [infiniband] ib_srp: Eliminate state SRP_TARGET_DEAD - minus system_long_wq (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Allow SRP disconnect through sysfs (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp_transport: Simplify attribute initialization code (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp_transport: Fix attribute registration (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp_transport: Document sysfs attributes (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: use __scsi_target_unblock (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Add Mellanox copyright (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Fix device removal flow (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Add support for iser CM REQ additional info (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Return error to upper layers on EAGAIN registration failures (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Move informational messages from error to info level (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Add module version (Doug Ledford) [791284 865301 950918 983117] - [infiniband] IPoIB: add support for TIPC protocol (Doug Ledford) [791284 865301 950918 983117] - [infiniband] IPoIB: Fix ipoib_hard_header() return value (Doug Ledford) [791284 865301 950918 983117] - [infiniband] IPoIB: Fix send lockup due to missed TX completion (Doug Ledford) [791284 865301 950918 983117] - [infiniband] rds: zero last byte for strncpy (Doug Ledford) [791284 865301 950918 983117] - [infiniband] rds: simplify a warning message (Doug Ledford) [791284 865301 950918 983117] - [infiniband] rds: limit the size allocated by rds_message_alloc() (Doug Ledford) [791284 865301 950918 983117] - [infiniband] IPoIB: Free ipoib neigh on path record failure so path rec queries are retried (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Fail I/O requests if the transport is offline (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Avoid endless SCSI error handling loop (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Avoid sending a task management function needlessly (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Track connection state properly (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Enable iser when FMRs are not supported (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Avoid error prints on EAGAIN registration failures (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Use proper define for the commands per LUN value advertised to SCSI ML (Doug Ledford) [791284 865301 950918 983117] - [infiniband] IPoIB: Don't attempt to release resources on error flow (Doug Ledford) [791284 865301 950918 983117] - [infiniband] IPoIB: Add version and firmware info to ethtool reporting (Doug Ledford) [791284 865301 950918 983117] - [infiniband] IPoIB: Fix ipoib_neigh hashing to use the correct daddr octets (Doug Ledford) [791284 865301 950918 983117] - [infiniband] IPoIB: Fix crash due to skb double destruct (Doug Ledford) [791284 865301 950918 983117] - [infiniband] rds: remove depends on CONFIG_EXPERIMENTAL (Doug Ledford) [791284 865301 950918 983117] - [infiniband] IPoIB: Call skb_dst_drop() once skb is enqueued for sending (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: send disconnect request without waiting for CM timewait exit (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: destroy and recreate QP and CQs when reconnecting (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Introduce the helper function srp_remove_target() (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Suppress superfluous error messages (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Process all error completions (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Introduce srp_handle_qp_err() (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Simplify SCSI error handling (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Keep processing commands during host removal (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Eliminate state SRP_TARGET_CONNECTING (Doug Ledford) [791284 865301 950918 983117] - [infiniband] srp: Increase block layer timeout (Doug Ledford) [791284 865301 950918 983117] - [infiniband] iser: Add more RX CQs to scale out processing of SCSI responses (Doug Ledford) [791284 865301 950918 983117] - [infiniband] core: Don't touch cmid after dropping reference (Doug Ledford) [791284 865301 950918 983117] - [infiniband] core: Verify that QP handler is valid before dispatching events (Doug Ledford) [791284 865301 950918 983117] - [infiniband] uverbs: Implement memory windows support in uverbs (Doug Ledford) [791284 865301 950918 983117] - [infiniband] core: Add "type 2" memory windows support (Doug Ledford) [791284 865301 950918 983117] - [infiniband] core: Change return value from find_gid_port() (Doug Ledford) [791284 865301 950918 983117]- [fs] autofs: remove autofs dentry mount check (Ian Kent) [947275] - [net] bridge: do not call setup_timer() multiple times (Amerigo Wang) [994430] - [mm] compaction: fixup need_compaction (Andrea Arcangeli) [953225] - [mm] compaction: add compaction to zone_reclaim_mode (Andrea Arcangeli) [953225] - [mm] zone_reclaim: after a successful zone_reclaim check the min watermark (Andrea Arcangeli) [953225] - [mm] compaction: increase the high order pages in the watermarks (Andrea Arcangeli) [953225] - [mm] compaction: don't require high order pages below min wmark (Andrea Arcangeli) [953225] - [mm] compaction: reset before initializing the scan cursors (Andrea Arcangeli) [953225] - [mm] compaction: don't depend on kswapd to invoke reset_isolation_suitable (Andrea Arcangeli) [953225] - [mm] zone_reclaim: compaction: scan all memory with /proc/sys/vm/compact_memory (Andrea Arcangeli) [953225] - [mm] zone_reclaim: remove ZONE_RECLAIM_LOCKED (Andrea Arcangeli) [953225] - [mm] page_alloc: avoid marking zones full prematurely after zone_reclaim() (Andrea Arcangeli) [953225] - [x86] trace: Add irq_enter/exit() in smp_trace_reschedule_interrupt() (Seiji Aguchi) [738712] - [x86] trace: Add config option checking to the definitions of mce handlers (Seiji Aguchi) [738712] - [x86] trace: Do not call local_irq_save() in load_current_idt() (Seiji Aguchi) [738712] - [x86] trace: Move creation of irq tracepoints from apic.c to irq.c (Seiji Aguchi) [738712] - [x86] trace: Add irq vector tracepoints (Seiji Aguchi) [738712] - [x86] trace: Introduce entering/exiting_irq() (Seiji Aguchi) [738712] - [x86] trace: Add DEFINE_EVENT_FN() macro (Seiji Aguchi) [738712] - [x86] uv3: Trim MMR register definitions after code changes for SGI UV3 (George Beshers) [988345] - [x86] uv3: Check current gru hub support for SGI UV3 (George Beshers) [988345] - [x86] uv3: Update Time Support for SGI UV3 (George Beshers) [988345] - [x86] uv3: Update x2apic Support for SGI UV3 (George Beshers) [988345] - [x86] uv3: Update Hub Info for SGI UV3 (George Beshers) [988345] - [x86] uv3: Update ACPI Check to include SGI UV3 (George Beshers) [988345] - [x86] uv3: Update MMR register definitions for SGI Ultraviolet System 3 (George Beshers) [988345] - [kernel] coredump: change wait_for_dump_helpers() to use wait_event_interruptible() (Oleg Nesterov) [773215] - [kernel] coredump: introduce dump_interrupted() (Oleg Nesterov) [773215] - [kernel] coredump: Un-inline the core-dump helper functions (Oleg Nesterov) [773215] - [kernel] coredump: sanitize the setting of signal->group_exit_code (Oleg Nesterov) [773215] - [kernel] coredump: ensure that SIGKILL always kills the dumping thread (Oleg Nesterov) [773215] - [kernel] coredump: only SIGKILL should interrupt the coredumping task (Oleg Nesterov) [773215] - [kernel] coredump: set ->group_exit_code for other CLONE_VM tasks too (Oleg Nesterov) [773215] - [fs] procfs: allow threads to rename siblings via /proc/pid/tasks/tid/comm (Jerome Marchand) [950840] - [security] selinux: make security_sb_clone_mnt_opts return an error on context mismatch (Jeff Layton) [800218] - [netdrv] bna: fix vlan_grp handling (Stefan Assmann) [886420] - [netdrv] mlx4_en: fix vlgrp handling (Stefan Assmann) [886420] - [netdrv] qlge: fix vlgrp handling (Stefan Assmann) [886420] - [netdrv] qlcnic: fix vlgrp handling (Stefan Assmann) [886420] - [fs] nfs4: end back channel session draining (Steve Dickson) [984118] - [fs] nfs4: Fix a pNFS session draining deadlock (Steve Dickson) [984118] - [fs] xfs: Fix delalloc WARN_ON() in xfs_vm_releasepage() (Aaron Tomlin) [991496] - [fs] nfs: Fix access to suid/sgid executables (Niels de Vos) [988135] - [fs] nfs4: don't put ACCESS in OPEN compound if O_EXCL (Niels de Vos) [988135] - [fs] nfs4: Add ACCESS operation to OPEN compound (Niels de Vos) [988135] - [fs] livelock avoidance in sget() (Eric Sandeen) [916811] - [fs] ext4: create a new BH_Verified flag to avoid unnecessary metadata validation (Lukas Czerner) [879163] - [fs] ext4: Fix dirtying of journalled buffers in data=journal mode (Lukas Czerner) [834919] - [fs] ext4: fix ext_remove_space for punch_hole case (Lukas Czerner) [969307] - [fs] ext4: punch_hole should wait for DIO writers (Lukas Czerner) [969307] - [fs] ext4: prevent race while walking extent tree for fiemap (Lukas Czerner) [692063] - [fs] ext4: Fix possibly very long loop in fiemap (Lukas Czerner) [692063] - [fs] ext4: make FIEMAP and delayed allocation play well together (Lukas Czerner) [692063] - [fs] ext4: handle NULL p_ext in ext4_ext_next_allocated_block() (Lukas Czerner) [692063] - [fs] ext4: drop ec_type from the ext4_ext_cache structure (Lukas Czerner) [692063] - [fs] lockd: protect nlm_blocked list (David Jeffery) [967095] - [virt] hv: Populate the guest ID with RHEL info (Jason Wang) [969230] - [virt] hv: Fix a bug in version negotiation code for util services (Jason Wang) [980554] - [netdrv] e1000e: disable ASPM L1 on 82583 (Dean Nelson) [991242] - [pci] Fix bit definitions of PCI_EXP_LNKCAP2 register (Myron Stowe) [989252] - [virt] storvsc: Increase the value of STORVSC_MAX_IO_REQUESTS (Jason Wang) [969537 969548] - [virt] storvsc: Support FC devices (Jason Wang) [969537] - [virt] storvsc: Implement multi-channel support (Jason Wang) [969537] - [virt] storvsc: Update the storage protocol to win8 level (Jason Wang) [969537] - [virt] storvsc: Increase the value of scsi timeout for storvsc devices (Jason Wang) [969548] - [virt] hv: Add the GUID fot synthetic fibre channel device (Jason Wang) [969537] - [s390] sclp: add parameter to specify number of buffer pages (Hendrik Brueckner) [990853] - [usb] fix thread-unsafe anchor utiliy routines (Stanislaw Gruszka) [993005] - [kernel] hung_task: print more info when reporting the problem (Oleg Nesterov) [976899] - [cpufreq] Convert the cpufreq_driver_lock to a rwlock (Prarit Bhargava) [887045] - [scsi] fnic: fix sleeping function called from invalid context during probe (Chris Leech) [829506] - [scsi] fnic: potential dead lock in fnic_is_abts_pending() (Chris Leech) [829506] - [scsi] fnic: Incremented driver version (Chris Leech) [829506] - [scsi] fnic: fix kernel panic due to FIP mode misconfiguration (Chris Leech) [829506] - [scsi] fnic: FIP VLAN Discovery Feature Support (Chris Leech) [829506] - [scsi] fnic: Fnic Trace Utility (Chris Leech) [829506] - [scsi] fnic: New debug flags and debug log messages (Chris Leech) [829506] - [scsi] fnic: fnic driver may hit BUG_ON on device reset (Chris Leech) [829506] - [scsi] fnic: Fix SGEs limit (Chris Leech) [829506] - [scsi] fnic: fixing issues in device and firmware reset code (Chris Leech) [829506] - [scsi] fnic: fix for trusted cos (Chris Leech) [829506] - [scsi] fnic: fix incorrect use of SLAB_CACHE_DMA flag (Chris Leech) [829506] - [x86] pmu: prepare for migration support (Paolo Bonzini) [928866] - [x86] kvm: Add code to track call origin for msr assignment (Paolo Bonzini) [928866] - [x86] kvm: add kvm_arch_vcpu_postcreate callback, move TSC initialization (Paolo Bonzini) [928866] - [netdrv] e1000e: fix I217/I218 PHY initialization flow (Dean Nelson) [981032] - [netdrv] e1000e: enable support for new device IDs (Dean Nelson) [981032] - [input] wacom: BTN_TOOL_DOUBLETAP is not a valid device_type (Aristeu Rozanski) [815589] - [input] wacom: use BTN_TOOL_FINGER to indicate touch device type (Aristeu Rozanski) [815589] - [input] wacom: remove pressure for touch devices (Aristeu Rozanski) [815589] - [input] wacom: report id 3 returns 4 bytes of data (Aristeu Rozanski) [815589] - [input] wacom: add support for Lenovo tablet ID 0xE6 (Aristeu Rozanski) [815589] - [input] wacom: support 2FGT in MT format (Aristeu Rozanski) [815589] - [input] wacom: support one finger touch the touchscreen way (Aristeu Rozanski) [815589] - [input] wacom: process pen data in its own routine (Aristeu Rozanski) [815589] - [input] wacom: share pen info with touch of the same ID (Aristeu Rozanski) [815589] - [input] wacom: fix runtime PM related deadlock (Aristeu Rozanski) [815589] - [input] wacom: add support for new LCD tablets (Aristeu Rozanski) [815589] - [input] wacom: add defines for packet lengths of various devices (Aristeu Rozanski) [815589] - [input] wacom: fix error path in wacom_probe() (Aristeu Rozanski) [815589] - [scsi] qla2xxx: Update version number to 8.05.00.03.06.5-k (Chad Dupuis) [927382] - [scsi] Revert "qla2xxx: Add setting of driver version string for vendor application." (Chad Dupuis) [927382] - [scsi] qla2xxx: Clear the MBX_INTR_WAIT flag when the mailbox time-out happens (Chad Dupuis) [927382] - [scsi] qla2xxx: Fix for locking issue between driver ISR and mailbox routines (Chad Dupuis) [927382] - [scsi] qla2xxx: Add clarifying printk to thermal access fail cases (Chad Dupuis) [927382] - [scsi] qla2xxx: Wait for IDC complete event to finish loopback operation (Chad Dupuis) [927382] - [scsi] qla2xxx: Don't process state change aen for reset owner (Chad Dupuis) [927382] - [scsi] qla2xxx: Don't process RSCNs for a vport on the same physical adapter (Chad Dupuis) [927382] - [scsi] qla2xxx: Correction of comment in MBC opcode defines (Chad Dupuis) [927382] - [scsi] qla2xxx: Correct list-iteration bug in Report-ID Acquisition codes (Chad Dupuis) [927382] - [scsi] qla2xxx: Enhancements to support ISPFx00 (Chad Dupuis) [927382] - [scsi] qla2xxx: Integrate generic card temperature with mezz card temperature (Chad Dupuis) [927382] - [scsi] qla2xxx: Add setting of driver version string for vendor application (Chad Dupuis) [927382] - [scsi] qla2xxx: Update the copyright information (Chad Dupuis) [927382] - [scsi] qla2xxx: Display the lock owner on lock acquire failure (Chad Dupuis) [927382] - [scsi] qla2xxx: Move loopback mode reset after chip reset check (Chad Dupuis) [927382] - [scsi] qla2xxx: Extra loopback error handling for ISP83xx (Chad Dupuis) [927382] - [scsi] qla2xxx: don't free pool that wasn't allocated (Chad Dupuis) [927382] - [scsi] qla2xxx: Unload hangs after issuing BSG commands to vport (Chad Dupuis) [927382] - [scsi] qla2xxx: Do MPI reset only for 81xx (Chad Dupuis) [927382] - [scsi] qla2xxx: Do link initialization on get loop id failure (Chad Dupuis) [927382] - [scsi] qla2xxx: Update the FTP site references in the driver sources (Chad Dupuis) [927382] - [scsi] qla2xxx: Reject loopback request if one is already in progress (Chad Dupuis) [927382] - [scsi] qla2xxx: Print thermal unsupported message (Chad Dupuis) [927382] - [scsi] qla2xxx: Avoid null pointer dereference in shutdown routine (Chad Dupuis) [927382] - [scsi] qla2xxx: Get VPD information from common location for CNA (Chad Dupuis) [927382] - [scsi] qla2xxx: Correct race in loop_state assignment during reset handling (Chad Dupuis) [927382] - [scsi] qla2xxx: Display that driver is operating in legacy interrupt mode (Chad Dupuis) [927382] - [scsi] qla2xxx: Free rsp_data even on error in qla2x00_process_loopback() (Chad Dupuis) [927382] - [scsi] qla2xxx: Dont clear drv active on iospace config failure (Chad Dupuis) [927382] - [scsi] qla2xxx: Fix typo in qla2xxx driver (Chad Dupuis) [927382] - [scsi] qla2xxx: Update ql2xextended_error_logging parameter description with new options (Chad Dupuis) [927382] - [scsi] qla2xxx: Parameterize the link speed of hba rather than fcport (Chad Dupuis) [927382] - [scsi] qla2xxx: Add 16Gb/s case to get port speed capability (Chad Dupuis) [927382] - [scsi] qla2xxx: Move marking fcport online ahead of setting iiDMA speed (Chad Dupuis) [927382] - [scsi] qla2xxx: Obtain loopback iteration count from bsg request (Chad Dupuis) [927382] - [scsi] qla2xxx: Add acquiring of risc semaphore before doing ISP reset (Chad Dupuis) [927382] - [scsi] qla2xxx: Properly set result field of bsg_job reply structure for success and failure (Chad Dupuis) [927382] - [scsi] qla2xxx: Fix coccinelle warnings in qla2x00_relogin (Chad Dupuis) [927382] - [scsi] qla2xxx: Ignore driver ack bit if corresponding presence bit is not set (Chad Dupuis) [927382] - [scsi] qla2xxx: Use correct Request-Q-Out register during bidirectional request processing (Chad Dupuis) [927382] - [scsi] qla2xxx: Fix typo in qla83xx_fw_dump function (Chad Dupuis) [927382] - [scsi] qla2xxx: Add Gen3 PCIe speed 8GT/s to the log message (Chad Dupuis) [927382] - [scsi] qla2xxx: Move noisy Start scsi failed messages to verbose logging level (Chad Dupuis) [927382] - [scsi] qla2xxx: Honor status value of 2 for report-id acquisition (Chad Dupuis) [927382] - [scsi] qla2xxx: Fix for warnings reported by sparse (Chad Dupuis) [927382] - [scsi] qla2xxx: No fcport FC-4 type assignment in GA_NXT response (Chad Dupuis) [927382] - [scsi] qla2xxx: Change in setting UNLOADING flag and FC vports logout sequence while unloading qla2xxx driver (Chad Dupuis) [927382] - [scsi] qla2xxx: Clear unsupported 'states' during Get-FW-State queries (Chad Dupuis) [927382] - [scsi] qla2xxx: Remove spurious taking of ha->vport_slock spinlock (Chad Dupuis) [927382] - [cciss] Silence noisy per-device cciss messages (Tomas Henzl) [972697] - [scsi] mpt3sas: Bump driver version to v02.100.00.00-rh1 (Tomas Henzl) [839470] - [scsi] mpt3sas: when async scanning is enabled then while scanning, devices are removed but their transport layer entries are not removed (Tomas Henzl) [839470] - [scsi] mpt3sas: MPI2.5 Rev F v2.5.1.1 specification (Tomas Henzl) [839470] - [scsi] mpt3sas: Infinite loops can occur if MPI2_IOCSTATUS_CONFIG_INVALID_PAGE is not returned (Tomas Henzl) [839470] - [scsi] mpt3sas: fix for kernel panic when driver loads with HBA conected to non LUN 0 configured expander (Tomas Henzl) [839470] - [scsi] mpt3sas: Updated the Hardware timing requirements (Tomas Henzl) [839470] - [scsi] mpt3sas: 2013 source code copyright (Tomas Henzl) [839470] - [scsi] mpt3sas: don't wank with fasync on ->release() (Tomas Henzl) [839470] - [scsi] mpt3sas: Fix typos in printk (Tomas Henzl) [839470] - [scsi] mpt3sas: remove unused variables (Tomas Henzl) [839470] - [scsi] mpt3sas: Remove unneeded version.h header inclusion (Tomas Henzl) [839470] - [scsi] mpt3sas: cut and paste bug storing trigger mpi (Tomas Henzl) [839470] - [scsi] mpt3sas: add new driver supporting 12GB SAS (Tomas Henzl) [839470] - [scsi] scsi_transport_sas: add 12GB definitions for mpt3sas (Tomas Henzl) [839470] - [scsi] megaraid_sas: megaraid_sas driver init fails in kdump kernel (Tomas Henzl) [833299] - [scsi] sd_dif: problem with verify of type 1 protection information (PI) (Ewan Milne) [956402] - [scsi] sd: Ensure we correctly disable devices with unknown protection type (Ewan Milne) [956402] - [scsi] sd: Avoid remapping bad reference tags (Ewan Milne) [956402] - [scsi] sd: Allow protection_type to be overridden (Ewan Milne) [956402] - [scsi] Disable DIF on Hitachi Ultrastar 15K300 (Ewan Milne) [956402] - [scsi] Fix printing of variable length commands (Ewan Milne) [956402] - [scsi] Fix race between starved list and device removal (Ewan Milne) [916994] - [scsi] Add 'eh_deadline' to limit SCSI EH runtime (Ewan Milne) [923876] - [scsi] remove check for 'resetting' (Ewan Milne) [923876] - [scsi] dc395: Move 'last_reset' into internal host structure (Ewan Milne) [923876] - [scsi] tmscsim: Move 'last_reset' into host structure (Ewan Milne) [923876] - [scsi] advansys Remove 'last_reset' references (Ewan Milne) [923876] - [scsi] dpt_i2o: return SCSI_MLQUEUE_HOST_BUSY when in reset (Ewan Milne) [923876] - [scsi] dpt_i2o: Remove DPTI_STATE_IOCTL (Ewan Milne) [923876] - [net] ipv6: prevent race between address creation and removal (Jiri Pirko) [953380] - [net] ipv6: call udp_push_pending_frames when uncorking a socket with AF_INET pending data (Jiri Benc) [987651] {CVE-2013-4162} - [net] netlabel: improve domain mapping validation (Paul Moore) [963427] - [net] netlabel: correctly list all the static label mappings (Paul Moore) [918803] - [x86] Revert "io_apic: initialize nr_ioapic_registers early in mp_register_ioapic()" (Rafael Aquini) [855057]- [x86] Revert: power: Initialize MSR_IA32_ENERGY_PERF_BIAS due to performance regression (Neil Horman) [968981] - [mm] mmu_notifier: re-fix freed page still mapped in secondary MMU (George Beshers) [910085] - [x86] Round the calculated scale factor in set_cyc2ns_scale() (Prarit Bhargava) [975507] - [x86] sched: Fix overflow in cyc2ns_offset (Prarit Bhargava) [975507] - [virt] virtio: support unlocked queue poll (Jason Wang) [989411] - [netdrv] virtio_net: fix race in RX VQ processing (Jason Wang) [989411] - [watchdog] Use pr_ and pr_ (Don Zickus) [796364] - [watchdog] cleanup spaces before tabs (Don Zickus) [796364] - [watchdog] sbc_fitpc2_wdt: fix crash on systems without DMI_BOARD_NAME (Don Zickus) [796364] - [watchdog] sbc_fitpc2_wdt: fixed "scheduling while atomic" bug (Don Zickus) [796364] - [watchdog] sbc_fitpc2_wdt: fixed I/O operations order (Don Zickus) [796364] - [watchdog] watchdog_info constify (Don Zickus) [796364] - [watchdog] sbc_fitpc2_wdt: fix I/O space access technique (Don Zickus) [796364] - [block] aoe: adjust ref of head for compound page tails (David Milburn) [976900] - [block] aoe: update internal version number to v83 (David Milburn) [976900] - [block] aoe: update copyright date (David Milburn) [976900] - [block] aoe: perform I/O completions in parallel (David Milburn) [976900] - [block] aoe: replace kmalloc and then memcpy with kmemdup (David Milburn) [976900] - [block] aoe: reserve enough headroom on skbs (David Milburn) [976900] - [block] aoe: get rid of cached bv variable in bufinit() (David Milburn) [976900] - [block] aoe: fix use after free in aoedev_by_aoeaddr() (David Milburn) [976900] - [block] aoe: update internal version number to 81 (David Milburn) [976900] - [block] aoe: identify source of runt AoE packets (David Milburn) [976900] - [block] aoe: allow comma separator in aoe_iflist value (David Milburn) [976900] - [block] aoe: allow user to disable target failure timeout (David Milburn) [976900] - [block] aoe: use dynamic number of remote ports for AoE storage target (David Milburn) [976900] - [block] aoe: avoid races between device destruction and discovery (David Milburn) [976900] - [block] aoe: improve handling of misbehaving network paths (David Milburn) [976900] - [block] aoe: return real minor number for static minors (David Milburn) [976900] - [block] aoe: initialize sysminor to avoid compiler warning (David Milburn) [976900] - [block] aoe: make error messages more specific in static minor allocation (David Milburn) [976900] - [block] aoe: remove call to request handler from I/O completion (David Milburn) [976900] - [block] aoe: cleanup: correct comment for aoetgt nout (David Milburn) [976900] - [block] aoe: increase default cap on outstanding AoE commands in the network (David Milburn) [976900] - [block] aoe: remove vestigial request queue allocation (David Milburn) [976900] - [block] aoe: copy fallback timing information on destination failover (David Milburn) [976900] - [block] aoe: update driver-internal version to 64+ (David Milburn) [976900] - [block] aoe: commands in retransmit queue use new destination on failure (David Milburn) [976900] - [block] aoe: use high-resolution RTTs with fallback to low-res (David Milburn) [976900] - [block] aoe: manipulate aoedev network stats under lock (David Milburn) [976900] - [block] aoe: err device: include MAC addresses for unexpected responses (David Milburn) [976900] - [block] aoe: improve network congestion handling (David Milburn) [976900] - [block] aoe: provide ATA identify device content to user on request (David Milburn) [976900] - [block] aoe: update driver-internal version number to 60 (David Milburn) [976900] - [block] aoe: whitespace cleanup (David Milburn) [976900] - [block] aoe: cleanup: remove unused ata_scnt function (David Milburn) [976900] - [block] aoe: "payload" sysfs file exports per-AoE-command data transfer size (David Milburn) [976900] - [block] aoe: support larger I/O requests via aoe_maxsectors module param (David Milburn) [976900] - [block] aoe: update cap on outstanding commands based on config query response (David Milburn) [976900] - [block] aoe: support the forgetting (flushing) of a user-specified AoE target (David Milburn) [976900] - [block] aoe: print warning regarding a common reason for dropped transmits (David Milburn) [976900] - [block] aoe: avoid running request handler on plugged queue (David Milburn) [976900] - [block] aoe: update aoe-internal version number to 50 (David Milburn) [976900] - [block] aoe: update documentation to better reflect aoe-plus-udev usage (David Milburn) [976900] - [block] aoe: remove unused code (David Milburn) [976900] - [block] aoe: make dynamic block minor numbers the default (David Milburn) [976900] - [block] aoe: update and specify AoE address guards and error messages (David Milburn) [976900] - [block] aoe: retain static block device numbers for backwards compatibility (David Milburn) [976900] - [block] aoe: support more AoE addresses with dynamic block device minor numbers (David Milburn) [976900] - [block] aoe: update documentation with new URL and VM settings reference (David Milburn) [976900] - [block] aoe: update copyright year in touched files (David Milburn) [976900] - [block] aoe: update internal version number to 49 (David Milburn) [976900] - [block] aoe: remove unused code and add cosmetic improvements (David Milburn) [976900] - [block] aoe: increase net_device reference count while using it (David Milburn) [976900] - [block] aoe: associate frames with the AoE storage target (David Milburn) [976900] - [block] aoe: disallow unsupported AoE minor addresses (David Milburn) [976900] - [block] aoe: do revalidation steps in order (David Milburn) [976900] - [block] aoe: failover remote interface based on aoe_deadsecs parameter (David Milburn) [976900] - [block] aoe: use packets that work with the smallest-MTU local interface (David Milburn) [976900] - [block] aoe: use a kernel thread for transmissions (David Milburn) [976900] - [block] aoe: become I/O request queue handler for increased user control (David Milburn) [976900] - [block] aoe: kernel thread handles I/O completions for simple locking (David Milburn) [976900] - [block] aoe: for performance support larger packet payloads (David Milburn) [976900] - [block] aoe: assert AoE packets marked as requiring no checksum (David Milburn) [976900] - [md] dm-raid: Remember the last sync operation that was performed (Jonathan E Brassow) [985920] - [md] dm-raid: silence compiler warning on rebuilds_per_group (Jonathan E Brassow) [985920] - [md] dm-raid: Fix raid_resume not reviving failed devices in all cases (Jonathan E Brassow) [913650] - [md] dm-raid: Break-up untidy function (Jonathan E Brassow) [913650] - [md] dm-raid: Add ability to restore transiently failed devices on resume (Jonathan E Brassow) [913650] - [md] dm-raid: Add message/status support for changing sync action (Jonathan E Brassow) [985920] - [md] dm-raid: round region_size to power of two (Jonathan E Brassow) [985920] - [block] nvme: fixup nvme_dev_open for ioctl's (David Milburn) [922973] - [block] nvme: Return the result from user admin command IOCTL even in case of failure (David Milburn) [922973] - [block] nvme: Add MSI support (David Milburn) [922973] - [block] nvme: Use dma_set_mask() correctly (David Milburn) [922973] - [block] nvme: Do not cancel command multiple times (David Milburn) [922973] - [block] nvme: fix error return code in nvme_submit_bio_queue() (David Milburn) [922973] - [block] nvme: check for integer overflow in nvme_map_user_pages() (David Milburn) [922973] - [block] nvme: update NVM EXPRESS DRIVER file list (David Milburn) [922973] - [block] nvme: Fix a signedness bug in nvme_trans_modesel_get_mp (David Milburn) [922973] - [block] nvme: Remove redundant version.h header include (David Milburn) [922973] - [block] nvme: Use user defined admin ioctl timeout (David Milburn) [922973] - [block] nvme: Simplify Firmware Activate code slightly (David Milburn) [922973] - [block] nvme: Only clear the enable bit when disabling controller (David Milburn) [922973] - [block] nvme: Wait for device to acknowledge shutdown (David Milburn) [922973] - [block] nvme: Schedule timeout for sync commands (David Milburn) [922973] - [block] nvme: Meta-data support in NVME_IOCTL_SUBMIT_IO (David Milburn) [922973] - [block] nvme: Device specific stripe size handling (David Milburn) [922973] - [block] nvme: Split non-mergeable bio requests (David Milburn) [922973] - [block] nvme: Remove dead code in nvme_dev_add (David Milburn) [922973] - [block] nvme: Check for NULL memory in nvme_dev_add (David Milburn) [922973] - [block] nvme: Fix error clean-up on nvme_alloc_queue (David Milburn) [922973] - [block] nvme: Free admin queue on request_irq error (David Milburn) [922973] - [block] nvme: Add scsi unmap to SG_IO (David Milburn) [922973] - [block] nvme: queue usage fixes in nvme-scsi (David Milburn) [922973] - [block] nvme: Set TASK_INTERRUPTIBLE before processing queues (David Milburn) [922973] - [block] nvme: Add a character device for each nvme device (David Milburn) [922973] - [block] nvme: Fix endian-related problems in user I/O submission path (David Milburn) [922973] - [block] nvme: Fix I/O cancellation status on big-endian machines (David Milburn) [922973] - [block] nvme: Fix sparse warnings in scsi emulation (David Milburn) [922973] - [block] nvme: Don't fail initialisation unnecessarily (David Milburn) [922973] - [block] nvme: Abstract out sector to block number conversion (David Milburn) [922973] - [block] nvme: Use round_jiffies_relative() for the periodic, once-per-second timer (David Milburn) [922973] - [block] nvme: Add nvme-scsi.c (David Milburn) [922973] - [block] nvme: Add definitions for format command (David Milburn) [922973] - [block] nvme: Move structures & definitions to header file (David Milburn) [922973] - [block] nvme: Rename nvme.c to nvme-core.c (David Milburn) [922973] - [block] nvme: Add discard support for capable devices (David Milburn) [922973] - [block] nvme: Add namespaces with no LBA range feature (David Milburn) [922973] - [block] nvme: Add entry for the NVMe driver (David Milburn) [922973] - [block] nvme: Initialize iod nents to 0 (David Milburn) [922973] - [block] nvme: Define SMART log (David Milburn) [922973] - [block] nvme: Add result to nvme_get_features (David Milburn) [922973] - [block] nvme: Set result from user admin command (David Milburn) [922973] - [block] nvme: End queued bio requests when freeing queue (David Milburn) [922973] - [block] nvme: Free cmdid on nvme_submit_bio error (David Milburn) [922973] - [block] nvme: Cancel outstanding IOs on queue deletion (David Milburn) [922973] - [block] nvme: Free admin queue memory on initialisation failure (David Milburn) [922973] - [block] nvme: Use ida for nvme device instance (David Milburn) [922973] - [block] nvme: Fix whitespace damage in nvme_init (David Milburn) [922973] - [block] nvme: handle allocation failure in nvme_map_user_pages() (David Milburn) [922973] - [block] nvme: Fix uninitialized iod compiler warning (David Milburn) [922973] - [block] nvme: Do not set IO queue depth beyond device max (David Milburn) [922973] - [block] nvme: Set block queue max sectors (David Milburn) [922973] - [block] nvme: use namespace id for nvme_get_features (David Milburn) [922973] - [block] nvme: replace nvme_ns with nvme_dev for user admin (David Milburn) [922973] - [block] nvme: Fix nvme module init when nvme_major is set (David Milburn) [922973] - [block] nvme: Set request queue logical block size (David Milburn) [922973] - [block] nvme: Set number of queues correctly (David Milburn) [922973] - [block] nvme: Version 0.8 (David Milburn) [922973] - [block] nvme: Set queue flags correctly (David Milburn) [922973] - [block] nvme: Simplify nvme_unmap_user_pages (David Milburn) [922973] - [block] nvme: Mark the end of the sg list (David Milburn) [922973] - [block] nvme: Fix DMA mapping for admin commands (David Milburn) [922973] - [block] nvme: Rename IO_TIMEOUT to NVME_IO_TIMEOUT (David Milburn) [922973] - [block] nvme: Merge the nvme_bio and nvme_prp data structures (David Milburn) [922973] - [block] nvme: Change nvme_completion_fn to take a dev (David Milburn) [922973] - [block] nvme: Change get_nvmeq to take a dev instead of a namespace (David Milburn) [922973] - [block] nvme: Simplify completion handling (David Milburn) [922973] - [block] nvme: Update Identify Controller data structure (David Milburn) [922973] - [block] nvme: Implement doorbell stride capability (David Milburn) [922973] - [block] nvme: Version 0.7 (David Milburn) [922973] - [block] nvme: Don't probe namespace 0 (David Milburn) [922973] - [block] nvme: Fix calculation of number of pages in a PRP List (David Milburn) [922973] - [block] nvme: Create nvme_identify and nvme_get_features functions (David Milburn) [922973] - [block] nvme: Fix memory leak in nvme_dev_add() (David Milburn) [922973] - [block] nvme: Fix calls to dma_unmap_sg (David Milburn) [922973] - [block] nvme: Correct sg list setup in nvme_map_user_pages (David Milburn) [922973] - [block] nvme: Fix bug in NVME_IOCTL_SUBMIT_IO (David Milburn) [922973] - [block] nvme: Rework ioctls (David Milburn) [922973] - [block] nvme: Add the nvme thread to the wait queue before waking it up (David Milburn) [922973] - [block] nvme: Return real error from nvme_create_queue (David Milburn) [922973] - [block] nvme: Version 0.6 (David Milburn) [922973] - [block] nvme: Add a few calling convention notes (David Milburn) [922973] - [block] nvme: Handle failures from memory allocations in nvme_setup_prps (David Milburn) [922973] - [block] nvme: Use an IDA to allocate minor numbers (David Milburn) [922973] - [block] nvme: Add include of delay.h for msleep (David Milburn) [922973] - [block] nvme: Add support for timing out I/Os (David Milburn) [922973] - [block] nvme: Rename cancel_cmdid_data to cancel_cmdid (David Milburn) [922973] - [block] nvme: Fix bug in error handling (David Milburn) [922973] - [block] nvme: Time out initialisation after a few seconds (David Milburn) [922973] - [block] nvme: Fix warning in free_irq (David Milburn) [922973] - [block] nvme: Correct the Controller Configuration settings (David Milburn) [922973] - [block] nvme: Version 0.5 (David Milburn) [922973] - [block] nvme: Change the definition of nvme_user_io (David Milburn) [922973] - [block] nvme: Correct the definitions of two ioctls (David Milburn) [922973] - [block] nvme: Add compat_ioctl (David Milburn) [922973] - [block] nvme: Simplify queue lookup (David Milburn) [922973] - [block] nvme: Remove the kthread from the wait queue (David Milburn) [922973] - [block] nvme: Fix off-by-one when filling in PRP lists (David Milburn) [922973] - [block] nvme: Fix interpretation of 'Number of Namespaces' field (David Milburn) [922973] - [block] nvme: Remove outdated comments (David Milburn) [922973] - [block] nvme: Fix comment formatting (David Milburn) [922973] - [block] nvme: Convert comments to kernel-doc notation (David Milburn) [922973] - [block] nvme: Update admin opcodes to match the 1.0RC spec (David Milburn) [922973] - [block] nvme: Version 0.4 (David Milburn) [922973] - [block] nvme: Reduce maximum queue depth by 1 (David Milburn) [922973] - [block] nvme: Fix discontiguous accesses (David Milburn) [922973] - [block] nvme: Handle bios that contain non-virtually contiguous addresses (David Milburn) [922973] - [block] nvme: Implement Flush (David Milburn) [922973] - [block] nvme: Mark CMD_CTX_CANCELLED as being unlikely (David Milburn) [922973] - [block] nvme: Correct SQ doorbell semantics (David Milburn) [922973] - [block] nvme: Let the kthread take care of devices earlier (David Milburn) [922973] - [block] nvme: Rename nr_queues to nr_io_queues (David Milburn) [922973] - [block] nvme: Remove setting of 'flags' in rw command (David Milburn) [922973] - [block] nvme: Release 0.3 (David Milburn) [922973] - [block] nvme: Add a kthread to handle the congestion list (David Milburn) [922973] - [block] nvme: Handle failures differently in nvme_submit_bio_queue() (David Milburn) [922973] - [block] nvme: Update BAR structure to match the current spec (David Milburn) [922973] - [block] nvme: Handle physical merging of bvec entries (David Milburn) [922973] - [block] nvme: Check for DMA mapping failure (David Milburn) [922973] - [block] nvme: Pass the nvme_dev to nvme_free_prps and nvme_setup_prps (David Milburn) [922973] - [block] nvme: Optimise memory usage for I/Os between 4k and 128k (David Milburn) [922973] - [block] nvme: Switch to use DMA Pool API (David Milburn) [922973] - [block] nvme: Rename nvme_req_info to nvme_bio (David Milburn) [922973] - [block] nvme: Initial PRP List support (David Milburn) [922973] - [block] nvme: Advance the sg pointer when filling in an sg list (David Milburn) [922973] - [block] nvme: Renumber the special context values (David Milburn) [922973] - [block] nvme: Handle the congestion list a little better (David Milburn) [922973] - [block] nvme: Record the timeout for each command (David Milburn) [922973] - [block] nvme: Need to lock queue during interrupt handling (David Milburn) [922973] - [block] nvme: Detect command IDs completing that are out of range (David Milburn) [922973] - [block] nvme: Detect commands that are completed twice (David Milburn) [922973] - [block] nvme: Use a symbolic name to represent cancelled commands instead of 0 (David Milburn) [922973] - [block] nvme: Add a module parameter to use a threaded interrupt (David Milburn) [922973] - [block] nvme: Call put_nvmeq() before calling nvme_submit_sync_cmd() (David Milburn) [922973] - [block] nvme: Allow fatal signals to interrupt I/O (David Milburn) [922973] - [block] nvme: Release 0.2 (David Milburn) [922973] - [block] nvme: Add download / activate firmware ioctls (David Milburn) [922973] - [block] nvme: Add remaining status codes (David Milburn) [922973] - [block] nvme: Move sysfs entries to the right place (David Milburn) [922973] - [block] nvme: Disable the device before we write the admin queues (David Milburn) [922973] - [block] nvme: Request I/O regions (David Milburn) [922973] - [block] nvme: Allow queues to be allocated above 4GB (David Milburn) [922973] - [block] nvme: Enable device DMA (David Milburn) [922973] - [block] nvme: Enable and disable the PCI device (David Milburn) [922973] - [block] nvme: Check returns from nvme_alloc_queue() (David Milburn) [922973] - [block] nvme: Remove 'node' from nvme_dev (David Milburn) [922973] - [block] nvme: Read the model, serial & firmware rev from the controller (David Milburn) [922973] - [block] nvme: Add NVME_IOCTL_SUBMIT_IO (David Milburn) [922973] - [block] nvme: Create nvme_map_user_pages() and nvme_unmap_user_pages() (David Milburn) [922973] - [block] nvme: Change NVME_IOCTL_GET_RANGE_TYPE to return all the ranges (David Milburn) [922973] - [block] nvme: Zero the command before we send it (David Milburn) [922973] - [block] nvme: Add nvme_setup_prps() (David Milburn) [922973] - [block] nvme: Make nvme_common_command more featureful (David Milburn) [922973] - [block] nvme: Use PRP2 for the nvme_identify ioctl (David Milburn) [922973] - [block] nvme: Fix admin IRQ claim on real hardware (David Milburn) [922973] - [block] nvme: Rename 'cycle' to 'phase' (David Milburn) [922973] - [block] nvme: Implement per-CPU queues (David Milburn) [922973] - [block] nvme: Reduce set_queue_count arguments by one (David Milburn) [922973] - [block] nvme: Factor out queue_request_irq() (David Milburn) [922973] - [block] nvme: New driver (David Milburn) [922973]- [alsa] fix for !CONFIG_SND_DMA_SGBUF after ALSA update from upstream (Jaroslav Kysela) [916264] - [alsa] hda: Add new GPU codec ID to snd-hda (Jaroslav Kysela) [916264] - [alsa] hda: pm_runtime backport specific fixes to get things working (Jaroslav Kysela) [916264] - [alsa] pcm: try to retain kABI compatibility / modversions (Jaroslav Kysela) [916264] - [alsa] hda: remove unused variable warning (Jaroslav Kysela) [916264] - [alsa] rawmidi: fix oops (use after free) when unloading a driver module (Jaroslav Kysela) [916264] - [alsa] rawmidi: fix the get next midi device ioctl (Jaroslav Kysela) [916264] - [alsa] rawmidi: fix opened substreams count (Jaroslav Kysela) [916264] - [alsa] core: automatically add .llseek fop (Jaroslav Kysela) [916264] - [alsa] timer: Add NULL-check for invalid slave timer (Jaroslav Kysela) [916264] - [alsa] timer: Fix Oops at closing slave timer (Jaroslav Kysela) [916264] - [alsa] take tu->qlock with irqs disabled (Jaroslav Kysela) [916264] - [alsa] jack: Add "Line In" input jack constants (Jaroslav Kysela) [916264] - [alsa] jack: fix one memory leak in sound jack (Jaroslav Kysela) [916264] - [alsa] vmaster: Fix the regression of missing vmaster hook call (Jaroslav Kysela) [916264] - [alsa] vmaster: Add snd_ctl_sync_vmaster() helper function (Jaroslav Kysela) [916264] - [alsa] vmaster: Fix slave change notification (Jaroslav Kysela) [916264] - [alsa] vmaster: fix core/vmaster.c kernel-doc warning (Jaroslav Kysela) [916264] - [alsa] vmaster: Free slave-links when freeing the master element (Jaroslav Kysela) [916264] - [alsa] control: Fix missing VOLATILE flag at creating controls (Jaroslav Kysela) [916264] - [alsa] control: Fixe a trailing white space error (Jaroslav Kysela) [916264] - [alsa] core: release the constraint check for replace ops (Jaroslav Kysela) [916264] - [alsa] core: trivial code style fix (Jaroslav Kysela) [916264] - [alsa] control: clean up snd_ctl_hole_check() (Jaroslav Kysela) [916264] - [alsa] control: fix numid conflict check for new controls (Jaroslav Kysela) [916264] - [alsa] core: Define llseek fops (Jaroslav Kysela) [916264] - [alsa] pcm: Optimize the call of snd_pcm_update_hw_ptr() in read/write loop (Jaroslav Kysela) [916264] - [alsa] pcm: fix race condition in wait_for_avail() (Jaroslav Kysela) [916264] - [alsa] pcm_lib: avoid timing jitter in snd_pcm_read/write() (Jaroslav Kysela) [916264] - [alsa] pcm: Don't check DMA time-out too shortly (Jaroslav Kysela) [916264] - [alsa] pcm_lib: fix xrun_log (Jaroslav Kysela) [916264] - [alsa] pcm_lib: xrun_log log also in_interrupt (Jaroslav Kysela) [916264] - [alsa] core: Avoid endless sleep after disconnect (Jaroslav Kysela) [916264] - [alsa] PCM: Fix some races at disconnection (Jaroslav Kysela) [916264] - [alsa] info: Small refactoring and a sanity check in snd_info_get_line() (Jaroslav Kysela) [916264] - [alsa] info: Avoid leaking kernel memory (Jaroslav Kysela) [916264] - [alsa] info: Implement common llseek for binary mode (Jaroslav Kysela) [916264] - [alsa] info: Remove BKL (Jaroslav Kysela) [916264] - [alsa] info: Check file position validity in common layer (Jaroslav Kysela) [916264] - [alsa] core: remove unused variables (Jaroslav Kysela) [916264] - [alsa] core: Don't use 'default' for default (Jaroslav Kysela) [916264] - [alsa] Fix yet another race in disconnection (Jaroslav Kysela) [916264] - [alsa] fix comment/printk typos (Jaroslav Kysela) [916264] - [alsa] core: Allow card id change to the same string (Jaroslav Kysela) [916264] - [alsa] hda: add CONFIG_SND_HDA_CODEC_CA0132_DSP define to rhel specific config (Jaroslav Kysela) [916264] - [alsa] hda: Keep halting ALC5505 DSP (Jaroslav Kysela) [916264] - [alsa] hda: Fix EAPD vmaster hook for AD1884 & co (Jaroslav Kysela) [916264] - [alsa] hda: Add Dell SSID to support Headset Mic recording (Jaroslav Kysela) [916264] - [alsa] hda: relase -> release (Jaroslav Kysela) [916264] - [alsa] hda: Fix the max length of control name in generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Guess what, it's two more Dell headset mic quirks (Jaroslav Kysela) [916264] - [alsa] hda: Yet another Dell headset mic quirk (Jaroslav Kysela) [916264] - [alsa] hda: Add support for ALC5505 DSP power-save mode (Jaroslav Kysela) [916264] - [alsa] hda: Add missing alc_inv_dmic_sync() call in alc269_resume() (Jaroslav Kysela) [916264] - [alsa] hda: Remove superfluous stac_resume() (Jaroslav Kysela) [916264] - [alsa] hda/hdmi: poll eld at resume time (Jaroslav Kysela) [916264] - [alsa] hda: clean up code to reset hda link (Jaroslav Kysela) [916264] - [alsa] hda: Add In-driver connection info (Jaroslav Kysela) [916264] - [alsa] hda: Use auto_mute_via_amp=1 for VT1708 (Jaroslav Kysela) [916264] - [alsa] hda: Add auto_mute_via_amp flag to generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Remove unused variable (Jaroslav Kysela) [916264] - [alsa] hda: reset hda link during system/runtime suspend (Jaroslav Kysela) [916264] - [alsa] hda: Make Thinkpad X220-tablet use generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Fix missing Mic Boost controls for VIA codecs (Jaroslav Kysela) [916264] - [alsa] hda: Use snd_hda_check_power_state() in patch_hdmi.c (Jaroslav Kysela) [916264] - [alsa] hda: Avoid choose same converter for unused pins (Jaroslav Kysela) [916264] - [alsa] hda: Cache the MUX selection for generic HDMI (Jaroslav Kysela) [916264] - [alsa] hda: Haswell converter power state D0 verify (Jaroslav Kysela) [916264] - [alsa] hda: Fix return value of snd_hda_check_power_state() (Jaroslav Kysela) [916264] - [alsa] hda: Don't take unresponsive D3 transition too serious (Jaroslav Kysela) [916264] - [alsa] hda: Introduce bit flags to snd_hda_codec_read/write() (Jaroslav Kysela) [916264] - [alsa] hda: Drop hard dependency on CONFIG_SND_DYNAMIC_MINORS (Jaroslav Kysela) [916264] - [alsa] hda/via: Use standard snd_hda_shutup_pins() (Jaroslav Kysela) [916264] - [alsa] hda: Add models for Dell headset jacks (Jaroslav Kysela) [916264] - [alsa] hda: Fix pin configurations for MacBook Air 4,2 (Jaroslav Kysela) [916264] - [alsa] hda: Headset mic support for three more machines (Jaroslav Kysela) [916264] - [alsa] hda: add mic fixup for ALC269VB on Ordissimo EVE2 (Jaroslav Kysela) [916264] - [alsa] hda/via: Clean up duplicated codes (Jaroslav Kysela) [916264] - [alsa] hda/via: Fix wrongly cleared pins after suspend on VT1802 (Jaroslav Kysela) [916264] - [alsa] hda: Add keep_eapd_on flag to generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Allow setting automute/automic hooks after parsing (Jaroslav Kysela) [916264] - [alsa] hda/via: Disable broken dynamic power control (Jaroslav Kysela) [916264] - [alsa] hda: Add headset quirk for two Dell machines (Jaroslav Kysela) [916264] - [alsa] hda: add dock support for Thinkpad T431s (Jaroslav Kysela) [916264] - [alsa] hda: Remove superfluous pci_set_drvdata() at remove (Jaroslav Kysela) [916264] - [alsa] hda: Enable mic-mute LED on more HP laptops (Jaroslav Kysela) [916264] - [alsa] hda: add PCI IDs for Intel BayTrail (Jaroslav Kysela) [916264] - [alsa] Revert: hda: Fix wrong power setup for HP paths of VIA codecs (Jaroslav Kysela) [916264] - [alsa] hda: Add headset mic support for another Dell machine (Jaroslav Kysela) [916264] - [alsa] hda: Check the activity of the NID to be powered down (Jaroslav Kysela) [916264] - [alsa] hda: Fix wrong power setup for HP paths of VIA codecs (Jaroslav Kysela) [916264] - [alsa] Revert: hda: Don't set up active streams twice (Jaroslav Kysela) [916264] - [alsa] hda: Apply pin-enablement workaround to all Haswell HDMI codecs (Jaroslav Kysela) [916264] - [alsa] hda: Fix Oops caused by dereference NULL pointer (Jaroslav Kysela) [916264] - [alsa] hda: Fix 3.9 regression of EAPD init on Conexant codecs (Jaroslav Kysela) [916264] - [alsa] hda: Fix system panic when DMA > 40 bits for Nvidia audio controllers (Jaroslav Kysela) [916264] - [alsa] hda: Move Thinkpad X220 to use auto parser (Jaroslav Kysela) [916264] - [alsa] hda: Add the support for ALC286 codec (Jaroslav Kysela) [916264] - [alsa] hda: Limit internal mic boost for a few Asus machines (Jaroslav Kysela) [916264] - [alsa] hda: Disable the sanity check in snd_hda_add_pincfg() (Jaroslav Kysela) [916264] - [alsa] hda: fix error return code in patch_alc662() (Jaroslav Kysela) [916264] - [alsa] hda: Don't call vmaster hook when bus->shutdown is set (Jaroslav Kysela) [916264] - [alsa] hda: fixup D3 pin and right channel mute on Haswell HDMI audio (Jaroslav Kysela) [916264] - [alsa] hda: Use the primary DAC for all aamix outputs (Jaroslav Kysela) [916264] - [alsa] hda: Fix aamix activation with loopback control on VIA codecs (Jaroslav Kysela) [916264] - [alsa] hda: Fix headset mic support for Asus X101CH (Jaroslav Kysela) [916264] - [alsa] hda: Implement headset jack functionality for some Dell hw (Jaroslav Kysela) [916264] - [alsa] hda: Handle Headphone Mic jack more generic (Jaroslav Kysela) [916264] - [alsa] hda: add some small convenience functions to auto parser (Jaroslav Kysela) [916264] - [alsa] hda: allow "Headphone Mic" parser flag (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Add a quirk for AC700 Chromebook (Jaroslav Kysela) [916264] - [alsa] hda/cirrus: Add a quirk for Stumpy ChromeBox (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Update latency based on DSP state (Jaroslav Kysela) [916264] - [alsa] hda: Introduce get_delay codec PCM ops (Jaroslav Kysela) [916264] - [alsa] hda: fix uninitialized variable (Jaroslav Kysela) [916264] - [alsa] hda: Allow power_save_controller option override DCAPS" (Jaroslav Kysela) [916264] - [alsa] hda: fix typo in proc output (Jaroslav Kysela) [916264] - [alsa] hda: Enabling Realtek ALC 671 codec (Jaroslav Kysela) [916264] - [alsa] hda: bug fix on HDMI ELD debug message (Jaroslav Kysela) [916264] - [alsa] hda: bug fix on return value when getting HDMI ELD info (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Delay HP amp turnon (Jaroslav Kysela) [916264] - [alsa] hda: VIA prefers side surrounds over HP (Jaroslav Kysela) [916264] - [alsa] hda: Lower the badness for independent HP penalty (Jaroslav Kysela) [916264] - [alsa] hda: Allow codec drivers to give own badness tables (Jaroslav Kysela) [916264] - [alsa] hda: Fix DAC assignment for independent HP (Jaroslav Kysela) [916264] - [alsa] hda: Enable "Headset Mic" name for some Dell Latitude devices (Jaroslav Kysela) [916264] - [alsa] hda: Introduce "Headset Mic" name (Jaroslav Kysela) [916264] - [alsa] hda: Fix abuse of snd_hda_lock_devices() for DSP loader (Jaroslav Kysela) [916264] - [alsa] hda: Fix typo in checking IEC958 emphasis bit (Jaroslav Kysela) [916264] - [alsa] hda: Fix yet missing GPIO/EAPD setup in cirrus driver (Jaroslav Kysela) [916264] - [alsa] hda: Add GPIO-based LED support on HP desktop machines (Jaroslav Kysela) [916264] - [alsa] hda: Make the resume of digital beep setup proper (Jaroslav Kysela) [916264] - [alsa] hda: Fix power-saving during playing beep sound (Jaroslav Kysela) [916264] - [alsa] hda: Move beep attach/detach calls in hda_generic.c (Jaroslav Kysela) [916264] - [alsa] hda/cirrus: Fix the digital beep registration (Jaroslav Kysela) [916264] - [alsa] hda: Fix missing beep detach in patch_conexant.c (Jaroslav Kysela) [916264] - [alsa] hda: Fix missing EAPD/GPIO setup for Cirrus codecs (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Remove extra setting of dsp_state (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Check download state of DSP (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Check if dspload_image succeeded (Jaroslav Kysela) [916264] - [alsa] hda: Disable IDT eapd_switch if there are no internal speakers (Jaroslav Kysela) [916264] - [alsa] hda: Don't apply EAPD power filter as default (Jaroslav Kysela) [916264] - [alsa] hda: Allow unlimited pins and converters in patch_hdmi.c (Jaroslav Kysela) [916264] - [alsa] hda: Drop explicit memset() by reallocation with __GFP_ZERO (Jaroslav Kysela) [916264] - [alsa] hda: Fix snd_hda_get_num_raw_conns() to return a correct value (Jaroslav Kysela) [916264] - [alsa] hda: Don't re-initialize shared hp/mic pinctl (Jaroslav Kysela) [916264] - [alsa] hda: Avoid automatic pin-ctl update for hp/mic when jack ctl exists (Jaroslav Kysela) [916264] - [alsa] hda: Consolidate add_in_jack_modes and add_out_jack_modes hints (Jaroslav Kysela) [916264] - [alsa] hda: Allow to change I/O direction in hp/mic jack mode ctl (Jaroslav Kysela) [916264] - [alsa] hda: Add some model name strings for ALC260 (Jaroslav Kysela) [916264] - [alsa] hda: Handle shared hp/mic jack mode (Jaroslav Kysela) [916264] - [alsa] hda: Add the generic Headphone Mic feature (Jaroslav Kysela) [916264] - [alsa] hda: Add support of new codec ALC233 (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Avoid division by zero in dspxfr_one_seg() (Jaroslav Kysela) [916264] - [alsa] hda: check NULL pointer when creating SPDIF PCM switch (Jaroslav Kysela) [916264] - [alsa] hda: check NULL pointer when creating SPDIF controls (Jaroslav Kysela) [916264] - [alsa] hda: Enable beep for ASUS EeeBox EBP1501P (Jaroslav Kysela) [916264] - [alsa] hda/hdmi: Make jacks phantom, if they're not detectable (Jaroslav Kysela) [916264] - [alsa] hda/hdmi: Notify userspace when ELD control changes (Jaroslav Kysela) [916264] - [alsa] hda/hdmi: Protect ELD buffer (Jaroslav Kysela) [916264] - [alsa] hda/hdmi: Refactor hdmi_eld into parsed_hdmi_eld (Jaroslav Kysela) [916264] - [alsa] hda/hdmi: Do not expose eld data when eld is invalid (Jaroslav Kysela) [916264] - [alsa] hda/hdmi: ELD shouldn't be valid after unplug (Jaroslav Kysela) [916264] - [alsa] hda: Fix the silent speaker output on Fujitsu S7020 laptop (Jaroslav Kysela) [916264] - [alsa] hda: add quirks for mute LED on two HP machines (Jaroslav Kysela) [916264] - [alsa] hda: Remove speaker clicks on CX20549 (Jaroslav Kysela) [916264] - [alsa] hda: Disable runtime PM for Intel 5 Series/3400 (Jaroslav Kysela) [916264] - [alsa] hda: Increase badness for missing multi-io (Jaroslav Kysela) [916264] - [alsa] hda: Fix broken workaround for HDMI/SPDIF conflicts (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Add missing n to debug prints (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Fix type of INVALID_CHIP_ADDRESS (Jaroslav Kysela) [916264] - [alsa] hda: update documentation for no-primary-hp fixup (Jaroslav Kysela) [916264] - [alsa] hda: Workaround for silent output on Sony Vaio VGC-LN51JGB with ALC889 (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Slight optimization for build with DSP (Jaroslav Kysela) [916264] - [alsa] hda: Fix memory leak and error handling in CA0132 DSP loader (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Improve the DSP transfer timeout calculations (Jaroslav Kysela) [916264] - [alsa] hda/intel: Add Device IDs for Intel Wellsburg PCH (Jaroslav Kysela) [916264] - [alsa] hda: Yet another fix for broken HSW HDMI pin connections (Jaroslav Kysela) [916264] - [alsa] hda: Add fixup for Haswell to enable all pin and convertor widgets (Jaroslav Kysela) [916264] - [alsa] hda: Support rereading widgets under the function group (Jaroslav Kysela) [916264] - [alsa] hda: Remove limit of widget connections (Jaroslav Kysela) [916264] - [alsa] hda: Set non-snoop for Creative HD-audio controllers (Jaroslav Kysela) [916264] - [alsa] hda: Fix misc compile warnings in patch_ca0132.c (Jaroslav Kysela) [916264] - [alsa] hda: Use generic array for loopback list management (Jaroslav Kysela) [916264] - [alsa] hda: Enable loopback accounts for CONFIG_PM=n, too (Jaroslav Kysela) [916264] - [alsa] hda: Apply mic-mute LED fixup for new HP laptops (Jaroslav Kysela) [916264] - [alsa] hda: detect jacks on VT1708 even when no streams are active (Jaroslav Kysela) [916264] - [alsa] hda: Fix phantom jacks on VT1708 (Jaroslav Kysela) [916264] - [alsa] hda: Add new Kconfig CONFIG_SND_HDA_CODEC_CA0132_DSP (Jaroslav Kysela) [916264] - [alsa] hda: Release assigned pin/cvt at error path of hdmi_pcm_open() (Jaroslav Kysela) [916264] - [alsa] hda: New PCI ID for Haswell ULT (Jaroslav Kysela) [916264] - [alsa] hda: add support for IDT 92HD95 HDA codec (Jaroslav Kysela) [916264] - [alsa] hda: Fix non-snoop page handling (Jaroslav Kysela) [916264] - [alsa] hda: Enable LPIB delay count for Poulsbo / Oaktrail (Jaroslav Kysela) [916264] - [alsa] hda: Fix powermap for external mics on IDT codecs (Jaroslav Kysela) [916264] - [alsa] hda: fix inverted internal mic on Acer AOA150/ZG5 (Jaroslav Kysela) [916264] - [alsa] hda: Enable power down of unused widgets for IDT codecs (Jaroslav Kysela) [916264] - [alsa] hda: Implement path-based power filter to the generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Add snd_hda_check_power_state() helper function (Jaroslav Kysela) [916264] - [alsa] hda: Synchronize the power state at the end of codec init (Jaroslav Kysela) [916264] - [alsa] hda: Add power state filtering (Jaroslav Kysela) [916264] - [alsa] hda/via: Fix wrong checks of power state bits (Jaroslav Kysela) [916264] - [alsa] hda: Fix wrong arguments for path deactivation checks (Jaroslav Kysela) [916264] - [alsa] hda: Add auto-mute support to PB desktop (Jaroslav Kysela) [916264] - [alsa] hda: Add a fixup for Packard-Bell desktop with ALC880 (Jaroslav Kysela) [916264] - [alsa] hda: Add chained_before flag to the fixup entry (Jaroslav Kysela) [916264] - [alsa] hda: Small code refactoring about path re-initialization (Jaroslav Kysela) [916264] - [alsa] hda: Fix missing path between aamix and outputs in AD codecs (Jaroslav Kysela) [916264] - [alsa] hda: Fix inconsistent pin states after resume (Jaroslav Kysela) [916264] - [alsa] hda: Fix invalid snd_BUG_ON() in alc271_hp_gate_mic_jack() (Jaroslav Kysela) [916264] - [alsa] hda: Select auto-parser as default for AD codecs (Jaroslav Kysela) [916264] - [alsa] hda: Convert some static quirks to fixup codes for AD codecs (Jaroslav Kysela) [916264] - [alsa] hda: Rearrange for dropping static quirk codes in AD codec driver (Jaroslav Kysela) [916264] - [alsa] hda: Add SPDIF mux control to AD codec auto-parser (Jaroslav Kysela) [916264] - [alsa] hda: Combine snd_hda_codec_flush_*_cache() to a single function (Jaroslav Kysela) [916264] - [alsa] hda: Fix missing call of cmd flush in capture volume put callback (Jaroslav Kysela) [916264] - [alsa] hda: Add missing exports to helper functions (Jaroslav Kysela) [916264] - [alsa] hda: Revive SPDIF mux for IDT/STAC codecs (Jaroslav Kysela) [916264] - [alsa] hda: Disable HP auto-mute during independent HP mode (Jaroslav Kysela) [916264] - [alsa] hda: Set individual name to secondary analog PCM stream (Jaroslav Kysela) [916264] - [alsa] hda: Add aamix NID to AD codecs (Jaroslav Kysela) [916264] - [alsa] hda: Add Conexant CX20755/20756/20757 codec IDs (Jaroslav Kysela) [916264] - [alsa] hda: Add aamix NID to IDT 92HD codecs (Jaroslav Kysela) [916264] - [alsa] hda: Remove superfluous header inclusions (Jaroslav Kysela) [916264] - [alsa] hda: Enable parsing the independent HP mode as default for VIA codecs (Jaroslav Kysela) [916264] - [alsa] hda: Fix conflicts between Loopback Mixing and Independent HP (Jaroslav Kysela) [916264] - [alsa] hda: Check aamix-output paths from other DACs, too (Jaroslav Kysela) [916264] - [alsa] hda: Add missing badness evaluation for unresolved paths (Jaroslav Kysela) [916264] - [alsa] hda: Set the pin targets after deciding output config (Jaroslav Kysela) [916264] - [alsa] hda: Improve debug prints for output paths (Jaroslav Kysela) [916264] - [alsa] hda: Add fixup for Acer AO725 laptop (Jaroslav Kysela) [916264] - [alsa] hda/conexant: Set mixer NID 0x19 for CX20551 codec (Jaroslav Kysela) [916264] - [alsa] hda: Correct more array rooms in hda_gen_spec (Jaroslav Kysela) [916264] - [alsa] hda: Fix the wrong adc_idx for capture source (Jaroslav Kysela) [916264] - [alsa] hda: Don't add unnecessary indices on HDMI and SPDIF (Jaroslav Kysela) [916264] - [alsa] hda: don't compare with yourself in fill_input_pin_labels (Jaroslav Kysela) [916264] - [alsa] hda: make sure there are enough input labels and paths (Jaroslav Kysela) [916264] - [alsa] hda: Fix speaker pin of FSC Lifebook S7110 laptop (Jaroslav Kysela) [916264] - [alsa] hda: Add boost to line inputs, too (Jaroslav Kysela) [916264] - [alsa] hda/sigmatel: Add bass speaker support for HP ENVY Spectre XT (Jaroslav Kysela) [916264] - [alsa] hda: Consolidate cap_sync_hook and capture_switch_hook (Jaroslav Kysela) [916264] - [alsa] hda: Fix missing call of capture_switch_hook (Jaroslav Kysela) [916264] - [alsa] hda: Look for boost controls more deeply (Jaroslav Kysela) [916264] - [alsa] hda: Fix invalid mute in path activation (Jaroslav Kysela) [916264] - [alsa] hda: Unify input label creations in generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Keep autocfg.input idx value in imux table (Jaroslav Kysela) [916264] - [alsa] hda: Fix missing unsol event handler in some codec drivers (Jaroslav Kysela) [916264] - [alsa] hda: Use generic parser for STAC/IDT codec driver (Jaroslav Kysela) [916264] - [alsa] hda: Improve naming rule for primary output (Jaroslav Kysela) [916264] - [alsa] hda: Add PCM capture hook to hda_gen_spec (Jaroslav Kysela) [916264] - [alsa] hda: Record all detected ADCs in hda_gen_spec (Jaroslav Kysela) [916264] - [alsa] hda: Move vmaster TLV parsing to snd_hda_gen_parse_auto_config() (Jaroslav Kysela) [916264] - [alsa] hda: Add input jack mode enum controls to generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Minor cleanup/fixes for patch_sigmatel.c fixup transition (Jaroslav Kysela) [916264] - [alsa] hda: Give more comments to hda_gen_spec flags (Jaroslav Kysela) [916264] - [alsa] hda: Add suppress_auto_mute flag to hda_gen_spec (Jaroslav Kysela) [916264] - [alsa] hda: Record the current speaker / LO mute status in hda_gen_spec (Jaroslav Kysela) [916264] - [alsa] hda: Properly call automute/switch hooks at init (Jaroslav Kysela) [916264] - [alsa] hda: Make sure fill_all_dac_nids is called for digital only codecs (Jaroslav Kysela) [916264] - [alsa] hda: force different capture controls if amp caps differ (Jaroslav Kysela) [916264] - [alsa] hda: do not add non-existing Mic boost controls (Jaroslav Kysela) [916264] - [alsa] hda: initialize channel counts correctly (Jaroslav Kysela) [916264] - [alsa] hda: fix wrong adc_idx in generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Check array bounds in get_input_path (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Make some symbols static (Jaroslav Kysela) [916264] - [alsa] hda: Add prefer_hp_amp flag to hda_gen_spec (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Fix a wrong comma in snd_printdd() call (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Declare firmware only when really built (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Fix possible invalid DMA channel deallocation (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Fix possible NULL dereference (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Fix another smatch warning (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Fix superfluous unsigned check (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Use snd_hda_set_pin_ctl() helper again (Jaroslav Kysela) [916264] - [alsa] Revert: hda: Add firmware caching to CA0132 codec (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Fix potential init errors and update module description (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Shuffle to group together related code (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Code shuffle to group similar functions (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Add tuning controls (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Add unsol handler for DSP and jack detection (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Add PCM enhancements (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Add DSP mixer controls and helpers (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Init chip, DSP effects and mixer settings (Jaroslav Kysela) [916264] - [alsa] hda/ca0132: Add new definitions and structs for DSP (Jaroslav Kysela) [916264] - [alsa] hda: fix OOPS in hda_mark_cmd_cache_dirty (Jaroslav Kysela) [916264] - [alsa] hda/sigmatel: Remove superfluous fields from sigmatel_spec (Jaroslav Kysela) [916264] - [alsa] hda/sigmatel: Move w/a for HP Mini 110 LED to fixup table (Jaroslav Kysela) [916264] - [alsa] hda/sigmatel: Remove PCI id check in find_mute_led_cfg() (Jaroslav Kysela) [916264] - [alsa] hda: Use standard fixup table for IDT92HD83xxx (Jaroslav Kysela) [916264] - [alsa] hda: Use standard fixup table for IDT92HD73xx (Jaroslav Kysela) [916264] - [alsa] hda: Use standard fixup table for IDT92HD71Bxx (Jaroslav Kysela) [916264] - [alsa] hda: Check pincap while parsing the configuration (Jaroslav Kysela) [916264] - [alsa] hda: Use standard fixup table for STAC927x (Jaroslav Kysela) [916264] - [alsa] hda: Use standard fixup table for STAC922x (Jaroslav Kysela) [916264] - [alsa] hda: Use standard fixup table for STAC9205 (Jaroslav Kysela) [916264] - [alsa] hda: Use standard fixup table for STAC9872 (Jaroslav Kysela) [916264] - [alsa] hda: Use standard fixup table for STAC925x (Jaroslav Kysela) [916264] - [alsa] hda: Use standard fixup table for STAC9200 (Jaroslav Kysela) [916264] - [alsa] hda: Add capture_switch_hook to generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Use generic parser for VIA codec driver (Jaroslav Kysela) [916264] - [alsa] hda: Add generic parser support to Analog Device codec driver (Jaroslav Kysela) [916264] - [alsa] hda: Rearrange for dropping static quirk codes in Coexant driver (Jaroslav Kysela) [916264] - [alsa] hda: Use generic parser in Conexant codec driver (Jaroslav Kysela) [916264] - [alsa] hda: Use generic parser for Cirrus codec driver (Jaroslav Kysela) [916264] - [alsa] hda: Use generic parser for CA0110 codec (Jaroslav Kysela) [916264] - [alsa] hda: Use generic codec parser for C-Media codecs (Jaroslav Kysela) [916264] - [alsa] hda: Allow user to give hints for codec parser behavior (Jaroslav Kysela) [916264] - [alsa] hda: Add snd_hda_get_int_hint() helper function (Jaroslav Kysela) [916264] - [alsa] hda: Protect user-defined arrays via mutex (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Generic mute LED implementation for HP laptops (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Fix the timing for some fixups (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Add a fixup for FSC S7020 laptop (Jaroslav Kysela) [916264] - [alsa] hda: Add output jack mode enum controls (Jaroslav Kysela) [916264] - [alsa] hda: Update automute / automic upon jack retasking (Jaroslav Kysela) [916264] - [alsa] hda: Add a new fixup type to override pinctl values (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Read the cached pinctl value in fixups (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Drop aliases for old fixups (Jaroslav Kysela) [916264] - [alsa] hda: Avoid auto-mute or auto-mic of retasked jacks (Jaroslav Kysela) [916264] - [alsa] hda: Manage current pinctl values in generic parser (Jaroslav Kysela) [916264] - [alsa] hda: More strict correction of invalid pinctl bits (Jaroslav Kysela) [916264] - [alsa] hda: Add helper functions to cache the current pinctl target (Jaroslav Kysela) [916264] - [alsa] hda: Clear the dropped paths properly (Jaroslav Kysela) [916264] - [alsa] hda: Allow aamix as a capture source (Jaroslav Kysela) [916264] - [alsa] hda: Fix inconsistent input_paths after ADC reduction (Jaroslav Kysela) [916264] - [alsa] hda: Return "Headphone Mic" from hda_get_autocfg_input_label() (Jaroslav Kysela) [916264] - [alsa] hda: Exclude aamix from capture paths (Jaroslav Kysela) [916264] - [alsa] hda: Add a flag to suppress mic auto-switch (Jaroslav Kysela) [916264] - [alsa] hda: Handle BOTH jack port as a fixed output (Jaroslav Kysela) [916264] - [alsa] hda: Re-define snd_hda_parse_nid_path() (Jaroslav Kysela) [916264] - [alsa] hda: Manage input paths via path indices (Jaroslav Kysela) [916264] - [alsa] hda: Fix multi-io channel mode management (Jaroslav Kysela) [916264] - [alsa] hda: Don't set up active streams twice (Jaroslav Kysela) [916264] - [alsa] hda: Remove unused dac reference in create_multi_out_ctls() (Jaroslav Kysela) [916264] - [alsa] hda: Use direct path reference in assign_out_path_ctls() (Jaroslav Kysela) [916264] - [alsa] hda: Clear path indices properly at each re-evaluation (Jaroslav Kysela) [916264] - [alsa] hda: Add brief comments to exported snd_hda_gen_*_() functions (Jaroslav Kysela) [916264] - [alsa] hda: Remove dead HDA_CTL_BIND_VOL and HDA_CTL_BIND_SW codes (Jaroslav Kysela) [916264] - [alsa] hda: Add snd_hda_gen_free() and snd_hda_gen_check_power_status() (Jaroslav Kysela) [916264] - [alsa] hda: Allow jack detection when polling is enabled (Jaroslav Kysela) [916264] - [alsa] hda: Add pcm_playback_hook to hda_gen_spec (Jaroslav Kysela) [916264] - [alsa] hda: Drop bind-volume workaround (Jaroslav Kysela) [916264] - [alsa] hda: Drop unneeded pin argument from set_output_and_unmute() (Jaroslav Kysela) [916264] - [alsa] hda: Add missing slave names for Speaker Surround, etc (Jaroslav Kysela) [916264] - [alsa] hda: Prefer binding the primary CLFE output (Jaroslav Kysela) [916264] - [alsa] hda: Fix truncated control names (Jaroslav Kysela) [916264] - [alsa] hda: Add Loopback Mixing control (Jaroslav Kysela) [916264] - [alsa] hda: Correct aamix output paths (Jaroslav Kysela) [916264] - [alsa] hda: Initialize digital-input path properly (Jaroslav Kysela) [916264] - [alsa] hda: Manage using output/loopback path indices (Jaroslav Kysela) [916264] - [alsa] hda: Fix multi-io pin assignment in create_multi_out_ctls() (Jaroslav Kysela) [916264] - [alsa] hda: Simplify the multi-io assignment with multi speakers (Jaroslav Kysela) [916264] - [alsa] hda: Check the existing path in snd_hda_add_new_path() (Jaroslav Kysela) [916264] - [alsa] hda: Avoid duplicated path creations (Jaroslav Kysela) [916264] - [alsa] hda: Initialize output paths with current active states (Jaroslav Kysela) [916264] - [alsa] hda: Don't skip amp init for activated paths (Jaroslav Kysela) [916264] - [alsa] hda: Add hooks for HP/line/mic auto switching (Jaroslav Kysela) [916264] - [alsa] hda: Revive snd_hda_get_conn_list() (Jaroslav Kysela) [916264] - [alsa] hda: Add codec->inv_jack_detect flag (Jaroslav Kysela) [916264] - [alsa] hda: Add inv_eapd flag to struct hda_codec (Jaroslav Kysela) [916264] - [alsa] hda: Implement independent HP control (Jaroslav Kysela) [916264] - [alsa] hda: Allow aamix in the primary output path (Jaroslav Kysela) [916264] - [alsa] hda: Define HDA_PARSE_* for snd_hda_parse_nid_path() argument (Jaroslav Kysela) [916264] - [alsa] hda: Fix typos in debug_show_configs() (Jaroslav Kysela) [916264] - [alsa] hda: Add more debug prints about new paths (Jaroslav Kysela) [916264] - [alsa] hda: Drop spec->channel_mode field from hda_gen_spec (Jaroslav Kysela) [916264] - [alsa] hda: Fix PCM name string for generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Use cached version for changing pins in hda_generic.c (Jaroslav Kysela) [916264] - [alsa] hda: Dynamically turn on/off EAPD in generic codec driver (Jaroslav Kysela) [916264] - [alsa] hda: Fix initialization of primary outputs in hda_generic.c (Jaroslav Kysela) [916264] - [alsa] hda: Refactor init_extra_out() in hda_generic.c (Jaroslav Kysela) [916264] - [alsa] hda: Clear unsol enable bits on unused pins in generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Add spec->vmaster_mute_enum flag to generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Begin HDA_GEN_* event tag from 1 (Jaroslav Kysela) [916264] - [alsa] hda: Increase the max depth of widget connections (Jaroslav Kysela) [916264] - [alsa] hda: Avoid access of amp cache element outside mutex (Jaroslav Kysela) [916264] - [alsa] hda: Fix wrong dirty check in snd_hda_codec_resume_amp() (Jaroslav Kysela) [916264] - [alsa] hda: Do sequential writes in snd_hda_gen_init() (Jaroslav Kysela) [916264] - [alsa] hda: Add / fix comments about capture vol/sw controls in hda_generic.c (Jaroslav Kysela) [916264] - [alsa] hda: Add missing amp cache flush for bound capture vol/sw ctls (Jaroslav Kysela) [916264] - [alsa] hda: Add snd_hda_codec_flush_*_cache() aliases (Jaroslav Kysela) [916264] - [alsa] hda: Flush dirty amp caches before writing inv_dmic fix (Jaroslav Kysela) [916264] - [alsa] hda: Check CORB overflow (Jaroslav Kysela) [916264] - [alsa] hda: Clear cached_write flag in snd_hda_codec_resume_*() (Jaroslav Kysela) [916264] - [alsa] hda: Clear dirty flag upon cache write (Jaroslav Kysela) [916264] - [alsa] hda: Allow one chance for zero NID in connection list (Jaroslav Kysela) [916264] - [alsa] hda: Use "Capture Source" for single sources (Jaroslav Kysela) [916264] - [alsa] hda: Use generic parser codes for Realtek driver (Jaroslav Kysela) [916264] - [alsa] hda: Export standard jack event handlers for generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Fix NULL dereference in snd_hda_gen_build_controls() (Jaroslav Kysela) [916264] - [alsa] hda: Move the call of snd_hda_parse_pin_defcfg() from snd_hda_gen_parse_auto_config() (Jaroslav Kysela) [916264] - [alsa] hda: Export snd_hda_gen_add_kctl() (Jaroslav Kysela) [916264] - [alsa] hda: Add EAPD control to generic parser (Jaroslav Kysela) [916264] - [alsa] hda: Merge Realtek parser code to generic parser (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Remove redundant argument from alc_mux_select() (Jaroslav Kysela) [916264] - [alsa] hda: More generic auto-mic switching for Realtek codecs (Jaroslav Kysela) [916264] - [alsa] hda: Rearrange INPUT_PIN_ATTR_* (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Fix split stereo dmic code (Jaroslav Kysela) [916264] - [alsa] hda: Move fixup code into struct hda_codec (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Add conexant-style inverted dmic handling (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Allow multiple individual capture volume/switch controls (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Allow passing name=NULL to alc_kcontrol_new() (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Merge a few split functions (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Assign Master mixer when possible (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Handle vmaster hook in the parser side (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Remove unused fields and macro definitions (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Drop auto_mic_valid_imux flag (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Allow different pins for shared hp/mic vref check (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Parse digital input path (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Rename add_new_out_path() with add_new_nid_path() (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Remove superfluous input amp init (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Clean up some spec fields (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Make input path parser more generic (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Don't change connection at path deactivation (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Initialize loopback paths properly (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Add boost volumes to path list (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Add missing initialization of multi-io routes (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Fix the initialization of pin amp-in (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Rename get_out_path() to get_nid_path() (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Use path-based parser for digital outputs (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Consolidate to a single path list (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Consolidate is_reachable_path() (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Add path active flag (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Remove non-standard automute mode (Jaroslav Kysela) [916264] - [alsa] hda: Introduce snd_hda_codec_amp_init*() (Jaroslav Kysela) [916264] - [alsa] hda: Introduce cache & flush cmd / amp writes (Jaroslav Kysela) [916264] - [alsa] hda: Remove snd_hda_codec_amp_update() call from patch_*.c (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Fix initialization of input amps in output paths (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Check amp capabilities of aa-mixer widget (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Parse analog loopback paths more generically (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Parse input paths (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Make path->idx and path->multi consistent (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Simplify the output volume initialization (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Reduce vol/mute ctl lookups at parsing codec (Jaroslav Kysela) [916264] - [alsa] hda: Fix mono amp values in proc output (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Manage mixer controls in out_path list (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Add output path parser (Jaroslav Kysela) [916264] - [alsa] hda/realtek: List up all available DACs (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Simplify alc_auto_is_dac_reachable() (Jaroslav Kysela) [916264] - [alsa] hda: Add support of new codec ALC284 (Jaroslav Kysela) [916264] - [alsa] hda: Allow power_save_controller option override DCAPS (Jaroslav Kysela) [916264] - [alsa] Revert: hda: Shut up pins at power-saving mode with Conexant codecs (Jaroslav Kysela) [916264] - [alsa] hda: Disable runtime D3 for Intel CPT & co (Jaroslav Kysela) [916264] - [alsa] hda: print power state for AFG node in proc file (Jaroslav Kysela) [916264] - [alsa] hda: add mute LED for HP Pavilion 17 (Realtek codec) (Jaroslav Kysela) [916264] - [alsa] hda: Switch "On" and "Off" for "Mute-LED Mode" kcontrol (Jaroslav Kysela) [916264] - [alsa] hda: Fix sound resume hang (Jaroslav Kysela) [916264] - [alsa] hda: bug fix for invalid connection list of Haswell HDMI codec pins (Jaroslav Kysela) [916264] - [alsa] hda: Fix the wrong pincaps set in ALC861VD dallas/hp fixup (Jaroslav Kysela) [916264] - [alsa] hda: Set codec->single_adc_amp flag for Realtek codecs (Jaroslav Kysela) [916264] - [alsa] hda: Remove superfluous zero-clear memset in patch_ca0132.c (Jaroslav Kysela) [916264] - [alsa] hda: Fix NULL dereference in error path of patch_ca0132.c (Jaroslav Kysela) [916264] - [alsa] hda: Remove unnecessary struct hda_stream_format from CA0132 (Jaroslav Kysela) [916264] - [alsa] hda: Update chipio functions and DSP write wait timeout (Jaroslav Kysela) [916264] - [alsa] hda: Change return value for load_dsp_prepare() to -ENOSYS (Jaroslav Kysela) [916264] - [alsa] hda: Add comments and descriptions to CA0132 functions (Jaroslav Kysela) [916264] - [alsa] hda: Add firmware caching to CA0132 codec (Jaroslav Kysela) [916264] - [alsa] hda: Update CA0132 codec to load DSP firmware binary (Jaroslav Kysela) [916264] - [alsa] hda: Add DSP firmware enums and defs to CA0132 codec (Jaroslav Kysela) [916264] - [alsa] hda: Add CA0132 register definitions file (Jaroslav Kysela) [916264] - [alsa] hda: Add new DSP loader callback routines (Jaroslav Kysela) [916264] - [alsa] Revert: hda: bug fix for invalid connection list of Haswell HDMI codec pin (Jaroslav Kysela) [916264] - [alsa] hda: bug fix for invalid connection list of Haswell HDMI codec pin (Jaroslav Kysela) [916264] - [alsa] hda: Always turn on pins for HDMI/DP (Jaroslav Kysela) [916264] - [alsa] hda: Fix pin configuration of HP Pavilion dv7 (Jaroslav Kysela) [916264] - [alsa] hda: Move runtime PM check to runtime_idle callback (Jaroslav Kysela) [916264] - [alsa] hda: Add stereo-dmic fixup for Acer Aspire One 522 (Jaroslav Kysela) [916264] - [alsa] hda: Avoid doubly suspend after vga switcheroo (Jaroslav Kysela) [916264] - [alsa] hda: Check validity of CORB/RIRB WP reads (Jaroslav Kysela) [916264] - [alsa] hda: use usleep_range in link reset and change timeout check (Jaroslav Kysela) [916264] - [alsa] hda/via: Add support for codec VT1808 (Jaroslav Kysela) [916264] - [alsa] hda/via: Add support for codec VT1705CF (Jaroslav Kysela) [916264] - [alsa] hda: Remove the rest of __devinit* in comments (Jaroslav Kysela) [916264] - [alsa] hda: Remove superfluous DELAYED_INIT*_MARK (Jaroslav Kysela) [916264] - [alsa] hda: remove __dev* attributes (Jaroslav Kysela) [916264] - [alsa] hda: Add PCI device prefix for clarity (Jaroslav Kysela) [916264] - [alsa] hda: Fix yet another race of vga_switcheroo registration (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Keep the channel count for multiple speakers (Jaroslav Kysela) [916264] - [alsa] hda: Add a helper function for simple enum kcontrols (Jaroslav Kysela) [916264] - [alsa] hda: Pass errors properly in alc_auto_check_switches() (Jaroslav Kysela) [916264] - [alsa] hda: Refactor alc_kcontrol_new() usages (Jaroslav Kysela) [916264] - [alsa] hda: Use standard sort function in hda_auto_parser.c (Jaroslav Kysela) [916264] - [alsa] hda: Call snd_array_init() early and only once (Jaroslav Kysela) [916264] - [alsa] hda: Fix build without CONFIG_PM (Jaroslav Kysela) [916264] - [alsa] hda: Add a fixup for internal mic on MacBook Pro 8,1 (Jaroslav Kysela) [916264] - [alsa] hda: Add missing verb applications in patch_cirrus.c (Jaroslav Kysela) [916264] - [alsa] hda: Move static ADC setup for CS4206 to init verbs (Jaroslav Kysela) [916264] - [alsa] hda: Don't release firmware when CONFIG_PM is set (Jaroslav Kysela) [916264] - [alsa] hda: Don't overwrite the pin default configs (Jaroslav Kysela) [916264] - [alsa] hda: Remove shutup calls in free callbacks (Jaroslav Kysela) [916264] - [alsa] hda: Use standard helper functions in patch_hdmi.c (Jaroslav Kysela) [916264] - [alsa] hda/cirrus: Correctly clear line_out_pins when moving to speaker (Jaroslav Kysela) [916264] - [alsa] hda: Add support for Realtek ALC292 (Jaroslav Kysela) [916264] - [alsa] hda: Limit runtime PM support only to known Intel chips (Jaroslav Kysela) [916264] - [alsa] hda: Fix Acer Aspire models with analog mics (Jaroslav Kysela) [916264] - [alsa] hda: Allow jack state to depend on another jack (Jaroslav Kysela) [916264] - [alsa] hda: Fix recursive suspend/resume call (Jaroslav Kysela) [916264] - [alsa] hda: Add a missing quirk entry for iMac 9,1 (Jaroslav Kysela) [916264] - [alsa] hda: Removed unused non-standard name "C/LFE" (Jaroslav Kysela) [916264] - [alsa] hda: Give standard "Bass Speaker" mixer for 2.1 speakers (Jaroslav Kysela) [916264] - [alsa] hda: Add new codec ALC668 and ALC900 (default name ALC1150) (Jaroslav Kysela) [916264] - [alsa] hda: Improve HP depop when system enter to S3 (Jaroslav Kysela) [916264] - [alsa] hda: Add pin fixups for ASUS G75 (Jaroslav Kysela) [916264] - [alsa] hda: Fix invalid connections in VT1802 codec (Jaroslav Kysela) [916264] - [alsa] hda: Fix empty DAC filling in patch_via.c (Jaroslav Kysela) [916264] - [alsa] hda: Keep power link on for PantherPoint HDMI (Jaroslav Kysela) [916264] - [alsa] hda: Force to reset IEC958 status bits for AD codecs (Jaroslav Kysela) [916264] - [alsa] hda: Mark CS260x immutable structures const (Jaroslav Kysela) [916264] - [alsa] hda: Fix digital microphone on CS420x (Jaroslav Kysela) [916264] - [alsa] hda: Cirrus: Fix coefficient index for beep configuration (Jaroslav Kysela) [916264] - [alsa] hda: stop setup_dig_out_stream() causing clicks (Jaroslav Kysela) [916264] - [alsa] hda: Add tracepoints to HD-audio controller driver (Jaroslav Kysela) [916264] - [alsa] hda: remove unused variable in azx_position_ok() (Jaroslav Kysela) [916264] - [alsa] hda: Don't enable unsol for jacks we're polling (Jaroslav Kysela) [916264] - [alsa] hda: Add workaround for conflicting IEC958 controls (Jaroslav Kysela) [916264] - [alsa] hda: Print PCI device name at "spurious message" warnings (Jaroslav Kysela) [916264] - [alsa] hda: Implement a poll loop for jacks as a module parameter (Jaroslav Kysela) [916264] - [alsa] hda: Make hda sound card usable for Loongson (Jaroslav Kysela) [916264] - [alsa] hda: Fix mute-LED setup for HP dv5 laptop (Jaroslav Kysela) [916264] - [alsa] hda: Fix silent headphone output from Toshiba P200 (Jaroslav Kysela) [916264] - [alsa] hda: add dock support for Thinkpad T430 (Jaroslav Kysela) [916264] - [alsa] hda: Always check array bounds in alc_get_line_out_pfx (Jaroslav Kysela) [916264] - [alsa] hda: Stop LPIB delay counting on broken hardware (Jaroslav Kysela) [916264] - [alsa] hda: Fix registration race of VGA switcheroo (Jaroslav Kysela) [916264] - [alsa] hda: Clean up superfluous position_fix list entries (Jaroslav Kysela) [916264] - [alsa] hda: do not detect jack on internal speakers for Realtek (Jaroslav Kysela) [916264] - [alsa] hda: Fix missing beep on ASUS X43U notebook (Jaroslav Kysela) [916264] - [alsa] hda: Remove AZX_DCAPS_POSFIX_COMBO (Jaroslav Kysela) [916264] - [alsa] hda: Warn an allocation for an uninitialized array (Jaroslav Kysela) [916264] - [alsa] hda/cirrus: Add missing init/free of hda_gen_spec (Jaroslav Kysela) [916264] - [alsa] hda: Fix memory leaks at error path in patch_cirrus.c (Jaroslav Kysela) [916264] - [alsa] hda: Add missing hda_gen_spec to struct via_spec (Jaroslav Kysela) [916264] - [alsa] hda: remove "Mic Jack Mode" for headset jacks (Latitude Exx30) (Jaroslav Kysela) [916264] - [alsa] hda: make Cirrus codec use generic unsol event handler (Jaroslav Kysela) [916264] - [alsa] hda: make VIA codec use generic unsol event handler (Jaroslav Kysela) [916264] - [alsa] hda: Remove dead GPIO code for VIA codec (Jaroslav Kysela) [916264] - [alsa] hda: Add new codec ALC283 ALC290 support (Jaroslav Kysela) [916264] - [alsa] hda: avoid unneccesary indices on "Headphone Jack" controls (Jaroslav Kysela) [916264] - [alsa] hda: fix indices on boost volume on Conexant (Jaroslav Kysela) [916264] - [alsa] hda: Fix hang caused by race during suspend (Jaroslav Kysela) [916264] - [alsa] hda: Clean up redundant FG checks (Jaroslav Kysela) [916264] - [alsa] hda/realtek: Fix detection of ALC271X codec (Jaroslav Kysela) [916264] - [alsa] hda: Add inverted internal mic quirk for Lenovo IdeaPad U310 (Jaroslav Kysela) [916264] - [alsa] hda: make Realtek/Sigmatel/Conexant use the generic unsol event (Jaroslav Kysela) [916264] - [alsa] hda: make a generic unsol event handler (Jaroslav Kysela) [916264] - [alsa] hda: add PCI identifier for Intel 5 Series/3400 (Jaroslav Kysela) [916264] - [alsa] hda: use LPIB for delay estimation (Jaroslav Kysela) [916264] - [alsa] hda: force use of SSYNC bits (Jaroslav Kysela) [916264] - [alsa] hda/via: don't report presence on HPs with no presence support (Jaroslav Kysela) [916264] - [alsa] hda: Add external mic quirk for Asus Zenbook UX31A (Jaroslav Kysela) [916264] - [alsa] hda: Yet another fix for D3 stop-clock refcounting (Jaroslav Kysela) [916264] - [alsa] hda: Optimize bitfield usage in struct hda_codec (Jaroslav Kysela) [916264] - [alsa] hda: Fix D3 clock stop check for codecs with own set_power_state op (Jaroslav Kysela) [916264] - [alsa] hda: Clean up CONFIG_SND_HDA_POWER_SAVE (Jaroslav Kysela) [916264] - [alsa] hda: Fix runtime PM leftover refcounts (Jaroslav Kysela) [916264] - [alsa] hda: bug fix on references without checking CONFIG_SND_HDA_POWER_SAVE (Jaroslav Kysela) [916264] - [alsa] hda: add runtime PM support (Jaroslav Kysela) [916264] - [alsa] hda: Fix possible compile warnings regarding CONFIG_PM (Jaroslav Kysela) [916264] - [alsa] hda: Convert to new pm_ops for PCI drivers (Jaroslav Kysela) [916264] - [alsa] Revert: hda_intel: Add Device IDs for Intel Wellsburg PCH (Jarod Wilson) [916264]- [virt] kvm: validate userspace_addr of memslot (Petr Matousek) [950498] {CVE-2013-1943} - [x86] edac: Apply patch to support ECC error decoding for Fam16h (Kim Naru) [922941] - [fs] fuse: readdirplus sanity checks (Niels de Vos) [981741] - [fs] fuse: readdirplus cleanup (Niels de Vos) [981741] - [fs] fuse: readdirplus change attributes once (Niels de Vos) [981741] - [fs] fuse: readdirplus fix instantiate (Niels de Vos) [981741] - [fs] fuse: fix readdirplus dentry leak (Niels de Vos) [981741] - [fs] fuse: hold i_mutex in fuse_file_fallocate() (Brian Foster) [979433] - [fs] cifs: on send failure, readjust server sequence number downward (Sachin Prabhu) [877010] - [fs] cifs: don't try to unlock pagecache page after releasing it (Sachin Prabhu) [877010] - [fs] cifs: bugfix for unreclaimed writeback pages in cifs_writev_requeue() (Sachin Prabhu) [877010] - [fs] cifs: move check for NULL socket into smb_send_rqst (Sachin Prabhu) [877010] - [fs] cifs: fix writeback race with file that is growing (Sachin Prabhu) [877010] - [fs] cifs: adjust sequence number downward after signing NT_CANCEL request (Sachin Prabhu) [877010] - [fs] cifs: remove kmap lock (Sachin Prabhu) [877010] - [fs] cifs: replace kvec array in readdata with a single kvec (Sachin Prabhu) [877010] - [fs] cifs: convert async read code to use pages array without kmapping (Sachin Prabhu) [877010] - [fs] cifs: turn the pages list in cifs_readdata into an array (Sachin Prabhu) [877010] - [fs] cifs: allocate kvec array for cifs_readdata as a separate allocation (Sachin Prabhu) [877010] - [fs] cifs: remove the kmap size limit from wsize (Sachin Prabhu) [877010] - [fs] cifs: convert async write code to pass in data via rq_pages array (Sachin Prabhu) [877010] - [fs] cifs: change cifs_call_async to use smb_rqst structs (Sachin Prabhu) [877010] - [fs] cifs: teach signing routines how to deal with arrays of pages in a smb_rqst (Sachin Prabhu) [877010] - [fs] cifs: teach smb_send_rqst how to handle arrays of pages (Sachin Prabhu) [877010] - [fs] cifs: cork the socket before a send and uncork it afterward (Sachin Prabhu) [877010] - [fs] cifs: convert send code to use smb_rqst structs (Sachin Prabhu) [877010] - [fs] cifs: change signing routines to deal with smb_rqst structs (Sachin Prabhu) [877010] - [fs] cifs: print error code if smb signature verification fails (Sachin Prabhu) [877010] - [fs] cifs: rename cifs_sign_smb2 to cifs_sign_smbv (Sachin Prabhu) [877010] - [fs] cifs: remove bogus reset of smb_buf_length in smb_send routines (Sachin Prabhu) [877010] - [fs] cifs: convert cifs_iovec_write to use async writes (Sachin Prabhu) [877010] - [fs] cifs: call cifs_update_eof with i_lock held (Sachin Prabhu) [877010] - [fs] cifs: fix up get_numpages (Sachin Prabhu) [877010] - [fs] cifs: fix allocation in cifs_write_allocate_pages (Sachin Prabhu) [877010] - [fs] cifs: allow caller to specify completion op when allocating writedata (Sachin Prabhu) [877010] - [fs] cifs: add pid field to cifs_writedata (Sachin Prabhu) [877010] - [fs] cifs: fix issue mounting of DFS ROOT when redirecting from one domain controller to the next (Sachin Prabhu) [976535] - [fs] gfs2: go back to try locks if reservation does not fit our needs (Robert S Peterson) [989669] - [fs] xfs: remove xfs_get_buftarg_list (Eric Sandeen) [973769] - [fs] xfs: check for stale inode before acquiring iflock on push (Brian Foster) [971441] - [fs] xfs: fix sgid inheritance for subdirectories inheriting default acls (Carlos Maiolino) [876528] - [fs] xfs: use XFS_BMAP_BMDR_SPACE vs. XFS_BROOT_SIZE_ADJ (Eric Sandeen) [886566] - [fs] xfs: check on-disk, not incore, btree root size in dfrag.c (Eric Sandeen) [886566] - [fs] writeback: avoid extra sync work at enqueue time (Eric Sandeen) [915546] - [fs] writeback: the kupdate expire timestamp should be a moving target (Eric Sandeen) [915546] - [fs] fix typo on bio_get_nr_vecs (Carlos Maiolino) [982344] - [fs] gfs2: Reserve journal space for quota change in do_grow (Robert S Peterson) [976823] - [fs] nfsd: permit read opens of executable-only files (Niels de Vos) [988120] - [fs] nfsd: when dentry_open returns an error do not propagate as struct file (Harshula Jayasuriya) [987142] - [fs] nfs: Make nfs_readdir revalidate less often (Scott Mayhew) [976879] - [fs] nfs: Make nfs_attribute_cache_expired() non-static (Scott Mayhew) [976879] - [fs] nfs: set verifier on existing dentries in nfs_prime_dcache (Scott Mayhew) [976879] - [fs] nfs: fix open() O_RDONLY|O_TRUNC in NFS4.0 (Jeff Layton) [982688] - [fs] vfs: remove unused __d_splice_alias argument (J. Bruce Fields) [820446] - [fs] vfs: stop d_splice_alias creating directory aliases (J. Bruce Fields) [820446] - [fs] nfs: Allow nfs_updatepage to extend a write under additional circumstances (Scott Mayhew) [983288] - [fs] nfs: add filehandle crc for debug display (Dave Wysochanski) [918580] - [fs] nfs: add fh_crc to debug output (Dave Wysochanski) [918580] - [fs] nfs: Add a client-side function to display NFS file handles (Dave Wysochanski) [918580] - [fs] nfs: include filelayout DS rpc stats in mountstats (Steve Dickson) [963096] - [fs] nfs: fix a leak at nfs_lookup_revalidate() (Dave Wysochanski) [975211] - [fs] NFS returns EIO for EDQUOT and others (Scott Mayhew) [888944] - [fs] nfs: Ensure that NFS file unlock waits for readahead to complete (Dave Wysochanski) [976915] - [fs] nfs: Add functionality to allow waiting on all outstanding reads to complete (Dave Wysochanski) [976915] - [fs] nfs: Convert nfs_get_lock_context to return an ERR_PTR on failure (Dave Wysochanski) [976915] - [netdrv] lseek() does not go to eof - n (Ivan Vecera) [928987] - [netdrv] bna: Driver and Firmware Updated (Ivan Vecera) [928987] - [netdrv] bna: Enahncement to Identify Default IOC Function (Ivan Vecera) [928987] - [netdrv] bna: Fix Ucast Failure Handling (Ivan Vecera) [928987] - [netdrv] bna: Clear Driver Config Flags When HW Resets (Ivan Vecera) [928987] - [netdrv] bna: add missing iounmap() on error in bnad_init() (Ivan Vecera) [928987] - [netdrv] bna: dma_alloc_coherent: use __GFP_ZERO instead of memset() (Ivan Vecera) [928987] - [netdrv] bna: fix declaration mismatch (Ivan Vecera) [928987] - [netdrv] bna: Driver Version Updated to 3.1.2.1 (Ivan Vecera) [928987] - [netdrv] bna: Firmware update (Ivan Vecera) [928987] - [netdrv] bna: Add RX State (Ivan Vecera) [928987] - [netdrv] bna: Rx Page Based Allocation (Ivan Vecera) [928987] - [netdrv] bna: TX Intr Coalescing Fix (Ivan Vecera) [928987] - [netdrv] bna: Tx and Rx Optimizations (Ivan Vecera) [928987] - [netdrv] bna: use device model DMA API (Ivan Vecera) [928987] - [netdrv] bna: Code Cleanup and Enhancements (Ivan Vecera) [928987] - [netdrv] bna: remove useless calls to memset() (Ivan Vecera) [928987] - [netdrv] bna: Fix warning false positive (Ivan Vecera) [928987] - [scsi] bfa: Update the driver version to 3.2.21.1 (Vijay Guvva) [928983] - [scsi] bfa: dis-associate bfa path_tov with dev_loss_tmo (Vijay Guvva) [928983] - [scsi] bfa: Support for chinook-quad port card (Vijay Guvva) [928983] - [scsi] bfa: fix endianess issue for firmware stats (Vijay Guvva) [928983] - [scsi] bfa: Fix bug_on condition in RPSC rsp handling (Vijay Guvva) [928983] - [scsi] bfa: Allow rsp queue process during ioc disable (Vijay Guvva) [928983] - [scsi] bfa: firmware statistics update (Vijay Guvva) [928983] - [scsi] bfa: fru vpd date update changes (Vijay Guvva) [928983] - [scsi] bfa: driver compatibility with 32bit libs (Vijay Guvva) [928983] - [scsi] bfa: kdump fix on 815 and 825 adapters (Vijay Guvva) [928983] - [scsi] bfa: Fix FDISC timeout handling (Vijay Guvva) [928983] - [scsi] bfa: Fix 1860 port initialize when ATC is enabled (Vijay Guvva) [928983] - [scsi] bfa: FDMI enhancements (Vijay Guvva) [928983] - [scsi] bfa: Fix WARN_ON condition check (Vijay Guvva) [928983] - [scsi] bfa: Add dynamic diagnostic port support (Vijay Guvva) [928983] - [scsi] bfa: Forward Error Correction status (Vijay Guvva) [928983] - [scsi] bfa: Support for FC BB credit recovery (Vijay Guvva) [928983] - [scsi] bfa: fix for FC Direct Attach LUN discovery failure (Vijay Guvva) [928983] - [scsi] bfa: fix faulty handling of events in lps sm (Vijay Guvva) [928983] - [scsi] bfa: fix strncpy() limiter in bfad_start_ops() (Vijay Guvva) [928983] - [scsi] bfa: Add support to read/update the FRU data (Vijay Guvva) [928983] - [scsi] bfa: Support Power on Hours display and diag temp sensor fixes (Vijay Guvva) [928983] - [scsi] bfa: Add support to configure min/max bandwidth for a pcifn (Vijay Guvva) [928983] - [scsi] bfa: Add support for IO throttling at port level (Vijay Guvva) [928983] - [scsi] bfa: Add support for user to configure bandwidth on QoS priorities (Vijay Guvva) [928983] - [scsi] bfa: Fabric Assigned Address implementation fix (Vijay Guvva) [928983] - [scsi] bfa: Add diagnostic port support (Vijay Guvva) [928983] - [scsi] bfa: Fix to handle firmware tskim abort request response (Vijay Guvva) [928983] - [scsi] bfa: Fix few attributes in the RHBA CT passthru command (Vijay Guvva) [928983] - [scsi] bfa: Add support to have mfg date as part of adapter attributes (Vijay Guvva) [928983] - [scsi] bfa: Flash Controller PLL initialization fixes (Vijay Guvva) [928983] - [scsi] bfa: IOCFC state machine enhancements (Vijay Guvva) [928983] - [scsi] bfa: Add support for FC Arbitrated Loop topology (Vijay Guvva) [928983] - [scsi] bfa: Add support for max target ports discovery (Vijay Guvva) [928983] - [scsi] bfa: Add support to register node symbolic name with name server (Vijay Guvva) [928983] - [scsi] bfa: Fix to process mbox interrupts only if interrupts are enabled in INTx mode (Vijay Guvva) [928983] - [scsi] bfa: Add PowerPC support and enable PCIE AER handling (Vijay Guvva) [928983] - [scsi] bfa: Add new hardware model info to sysfs model description routine (Vijay Guvva) [928983] - [scsi] bfa: Make changes to FCXP resource management (Vijay Guvva) [928983] - [scsi] bfa: FCS remote port enhancements (Vijay Guvva) [928983] - [scsi] bfa: Support vport symbolic name change from sysfs (Vijay Guvva) [928983] - [scsi] bfa: Fix to set correct return error codes and misc cleanup (Vijay Guvva) [928983] - [scsi] bfa: Fix to defer vport delete handler invocation till firmware logo response (Vijay Guvva) [928983] - [scsi] fix race in scsi_target_reap (Tomas Henzl) [910203] - [scsi] iscsi class, qla4xxx: fix sess/conn refcounting when find fns are used (Chad Dupuis) [917577] - [scsi] qla4xxx: 5.03.00.00.06.05-k1 (Chad Dupuis) [917585] - [scsi] qla4xxx: Exporting new attrs for iscsi session and connection in sysfs (Chad Dupuis) [917585] - [scsi] qla4xxx: 5.03.00.00.06.05-k0 (Chad Dupuis) [917585] - [scsi] qla4xxx: Add missing spaces to error messages (Chad Dupuis) [917585] - [scsi] qla4xxx: Fix iocb_cnt calculation in qla4xxx_send_mbox_iocb() (Chad Dupuis) [917585] - [scsi] qla4xxx: Assign values using correct datatype (Chad Dupuis) [917585] - [scsi] qla4xxx: Fix smatch warnings (Chad Dupuis) [917585] - [scsi] qla4xxx: Fix sparse warning for qla4xxx_sysfs_ddb_tgt_create (Chad Dupuis) [917585] - [scsi] qla4xxx: Silence gcc warning (Chad Dupuis) [917585] - [scsi] qla4xxx: Added print statements to display AENs (Chad Dupuis) [917585] - [scsi] qla4xxx: Use correct value for max flash node entries (Chad Dupuis) [917585] - [scsi] qla4xxx: Restrict logout from boot target session using session id (Chad Dupuis) [917585] - [scsi] qla4xxx: Use correct flash ddb offset for ISP40XX (Chad Dupuis) [917585] - [scsi] qla4xxx: Replace dev type macros with generic portal type macros (Chad Dupuis) [917585] - [scsi] qla4xxx: Add flash node mgmt support (Chad Dupuis) [917585] - [scsi] qla4xxx: Skip retry of initialize_adapter for ISP80XX (Chad Dupuis) [917585] - [scsi] qla4xxx: Assign correct CHAP table address to FLT (Chad Dupuis) [917585] - [scsi] qla4xxx: Added missing check for ISP83XX in CHAP related functions (Chad Dupuis) [917585] - [scsi] qla4xxx: Fixed request queue count manipulation on response path (Chad Dupuis) [917585] - [scsi] qla4xxx: Fix debug level to avoid floods of same message (Chad Dupuis) [917585] - [scsi] qla4xxx: Pass correct LUN address to firmware in case of lun_reset (Chad Dupuis) [917585] - [scsi] qla4xxx: Fix double reset in case of firmware hung for ISP83XX (Chad Dupuis) [917585] - [scsi] qla4xxx: Set graceful reset bit for ISP83XX (Chad Dupuis) [917585] - [scsi] qla4xxx: Boot from SAN fix for ISP83XX (Chad Dupuis) [917585] - [scsi] qla4xxx: Take E-port out of reset before disabling pause frames (Chad Dupuis) [917585] - [scsi] qla4xxx: remove __dev* attributes (Chad Dupuis) [917585] - [scsi] qla4xxx: don't free NULL dma pool (Chad Dupuis) [917585] - [scsi] qla4xxx: Fix return code for qla4xxx_session_get_param (Chad Dupuis) [917585] - [scsi] qla4xxx: wait for boot target login response during probe (Chad Dupuis) [917585] - [scsi] qla4xxx: Added support for force firmware dump (Chad Dupuis) [917585] - [scsi] qla4xxx: Re-register IRQ handler while retrying initialize of adapter (Chad Dupuis) [917585] - [scsi] qla4xxx: Throttle active IOCBs to firmware limits (Chad Dupuis) [917585] - [scsi] qla4xxx: Remove unnecessary code from qla4xxx_init_local_data (Chad Dupuis) [917585] - [scsi] qla4xxx: Quiesce driver activities while loopback (Chad Dupuis) [917585] - [scsi] qla4xxx: Rename MBOX_ASTS_IDC_NOTIFY to MBOX_ASTS_IDC_REQUEST_NOTIFICATION (Chad Dupuis) [917585] - [scsi] qla4xxx: Add spurious interrupt messages under debug level 2 (Chad Dupuis) [917585] - [scsi] qla4xxx: Fix memory corruption issue in qla4xxx_get_ep_fwdb (Chad Dupuis) [917585] - [scsi] qla4xxx: Allow reset in link down case (Chad Dupuis) [917585] - [scsi] qla4xxx: Fix MBOX intr switching from polling to intr mode for ISP83XX (Chad Dupuis) [917585] - [scsi] scsi_transport_iscsi: Exporting new attrs for iscsi session and connection in sysfs (Chad Dupuis) [917577] - [scsi] libiscsi: Exporting new attrs for iscsi session and connection in sysfs (Chad Dupuis) [917577] - [scsi] scsi_transport_iscsi: Declare portal type string macros for generic use (Chad Dupuis) [917572] - [scsi] libiscsi: export function iscsi_switch_str_param (Chad Dupuis) [917572] - [scsi] scsi_transport_iscsi: Add flash node mgmt support (Chad Dupuis) [917572] - [scsi] scsi_transport_iscsi: export iscsi class session's target_id in sysfs (Chad Dupuis) [917577] - [md] dm-flakey: correct ctr alloc failure mesg (Mike Snitzer) [987566] - [md] dm-mpath: fix ioctl deadlock when no paths (Mike Snitzer) [987566] - [md] dm: use __GFP_HIGHMEM in __vmalloc (Mike Snitzer) [987566] - [md] dm-ioctl: set noio flag to avoid __vmalloc deadlock (Mike Snitzer) [987566] - [md] dm-bufio: avoid a possible __vmalloc deadlock (Mike Snitzer) [987566] - [md] dm-thin: open dev read only when possible (Mike Snitzer) [987566] - [md] dm-persistent-data: fix error message typos (Mike Snitzer) [987566] - [md] dm-snapshot: fix error return code in snapshot_ctr (Mike Snitzer) [987566]- [x86] mce: Add quirk for instruction recovery on Sandy Bridge processors (Rui Wang) [832367] - [x86] mce: Avoid reading every machine check bank register twice (Rui Wang) [832367] - [x86] mce: Fix siginfo_t->si_addr value for non-recoverable memory faults (Rui Wang) [832367] - [x86] mce: Only restart instruction after machine check recovery if it is safe (Rui Wang) [832367] - [x86] mce: Add instruction recovery signatures to mce-severity table (Rui Wang) [832367] - [x86] thermal: Disable power limit notification interrupt (Shyam Iyer) [908990] - [x86] thermal: Delete power-limit-notification console messages (Shyam Iyer) [908990] - [virtio] console: prevent use-after-free of port name in port unplug (Amit Shah) [827300] - [virtio] console: fix locking around send_sigio_to_port() (Amit Shah) [986960] - [virtio] console: add locking in port unplug path (Amit Shah) [795678 956637] - [virtio] console: add locks around buffer removal in port unplug path (Amit Shah) [827300] - [virtio] console: fix raising SIGIO after port unplug (Amit Shah) [986960] - [virtio] console: return -ENODEV on all read operations after unplug (Amit Shah) [975661] - [virtio] console: clean up port data immediately at time of unplug (Amit Shah) [795678 796048 827300 947024 956637] - [virtio] console: fix race in port_fops_open() and port unplug (Amit Shah) [827300] - [virtio] console: fix race with port unplug and open/close (Amit Shah) [795678 796048 827300 947024 956637] - [virtio] console: Add pipe_lock/unlock for splice_write (Amit Shah) [987004] - [virtio] console: Quit from splice_write if pipe->nrbufs is 0 (Amit Shah) [987004] - [virtio] console: replace EMFILE with EBUSY for already-open port (Amit Shah) [986986] - [virtio] console: fix error handling in init() function (Amit Shah) [986990] - [ftrace] syscalls: Fix typo in SYSCALL_DEFINE0 (Jiri Olsa) [989503] - [ftrace] syscalls: Set event_enter_##sname->data to its metadata (Jiri Olsa) [989503] - [ftrace] syscalls: Remove unused event_syscall_enter and event_syscall_exit (Jiri Olsa) [989503] - [x86] efi: Fix dummy variable buffer allocation (Seiji Aguchi) [985577] - [x86] Modify UEFI anti-bricking code (Seiji Aguchi) [985577] - [x86] efi: Implement efi_no_storage_paranoia parameter (Seiji Aguchi) [985577] - [x86] efi: Distinguish between "remaining space" and actually used space (Seiji Aguchi) [985577] - [x86] efi: Check max_size only if it is non-zero (Seiji Aguchi) [985577] - [x86] efi: Export efi_query_variable_store() for efivars.ko (Seiji Aguchi) [985577] - [x86] efivars: firmware bug workarounds should be in platform code (Seiji Aguchi) [985577] - [x86] efi: be more paranoid about available space when creating variables (Seiji Aguchi) [985577] - [x86] efivars: Handle duplicate names from get_next_variable() (Seiji Aguchi) [985577] - [x86] efivars: explicitly calculate length of VariableName (Seiji Aguchi) [985577] - [x86] efi_pstore: Introducing workqueue updating sysfs (Seiji Aguchi) [985551] - [x86] efivars: Disable external interrupt while holding efivars->lock (Seiji Aguchi) [985551] - [x86] efi_pstore: Add a format check for an existing variable name at reading time (Seiji Aguchi) [826190] - [x86] efi_pstore: Add a format check for an existing variable name at erasing time (Seiji Aguchi) [826190] - [x86] efi_pstore: Add a sequence counter to a variable name (Seiji Aguchi) [826190] - [x86] efi_pstore: Add ctime to argument of erase callback (Seiji Aguchi) [826190] - [x86] efi_pstore: Remove a logic erasing entries from a write callback to hold multiple logs (Seiji Aguchi) [826190] - [x86] efi_pstore: Add a logic erasing entries to an erase callback (Seiji Aguchi) [826190] - [x86] efi_pstore: Check remaining space with QueryVariableInfo() before writing data (Seiji Aguchi) [826190] - [powerpc] perf: Power8 PMU support (Steve Best) [976911] - [powerpc] perf: Add support for SIER (Steve Best) [976911] - [powerpc] perf: Add regs_no_sipr() (Steve Best) [976911] - [powerpc] perf: Add an accessor for regs->result (Steve Best) [976911] - [powerpc] perf: Convert mmcra_sipr/sihv() to regs_sipr/sihv() (Steve Best) [976911] - [powerpc] perf: Add an explict flag indicating presence of SLOT field (Steve Best) [976911] - [scsi] ipr: IOA Status Code IOASC update (Steve Best) [983765] - [scsi] ipr: qc_fill_rtf() method should not store alternate status register (Steve Best) [983765] - [scsi] ipr: possible irq lock inversion dependency detected (Steve Best) [983765] - [cpufreq] intel_pstate: Set timer timeout correctly (Lenny Szubowicz) [956824] - [cpufreq] intel-pstate: Use #defines instead of hard-coded values (Lenny Szubowicz) [956824] - [cpufreq] intel_pstate: Fix calculation of current frequency (Lenny Szubowicz) [956824] - [cpufreq] intel_pstate: Add function to check that all MSRs are valid (Lenny Szubowicz) [956824] - [cpufreq] intel_pstate: Do not load on VM that does not report max P state (Lenny Szubowicz) [956824] - [cpufreq] intel_pstate: Fix intel_pstate_init() error path (Lenny Szubowicz) [956824] - [cpufreq] intel_pstate: Add kernel command line option disable intel_pstate (Lenny Szubowicz) [956824] - [cpufreq] intel_pstate: Fix 32 bit build (Lenny Szubowicz) [956824] - [cpufreq] intel_pstate: Fix kobject usage (Lenny Szubowicz) [956824] - [cpufreq] intel_pstate: Add P-state driver for sandy bridge (Lenny Szubowicz) [956824] - [cpufreq] Do not track governor name for scaling drivers with internal governors (Lenny Szubowicz) [956824] - [x86] cpu: Add driver auto probing for x86 features (Lenny Szubowicz) [956824] - [cpufreq] Unify sysfs attribute definition macros (Lenny Szubowicz) [956824] - [acpi] efivars: If pstore_register fails, free unneeded pstore buffer (Lenny Szubowicz) [867689] - [acpi] Eliminate console msg if pstore.backend excludes ERST (Lenny Szubowicz) [867689] - [acpi] Return unique error if backend registration excluded by kernel param (Lenny Szubowicz) [867689] - [x86] io_apic: initialize nr_ioapic_registers early in mp_register_ioapic() (Tony Camuso) [855057] - [mm] tmpfs: distribute interleave better across nodes (George Beshers) [988063] - [kernel] sched: Bail out of yield_to when source and target runqueue has one task (Rik van Riel) [864233] - [kvm] Add config to support ple or cpu relax optimzation (Rik van Riel) [864233] - [kvm] Iterate over only vcpus that are preempted (Rik van Riel) [864233] - [kvm] Record the preemption status of vcpus using preempt notifiers (Rik van Riel) [864233] - [kvm] Handle yield_to failure return code for potential undercommit case (Rik van Riel) [864233] - [kvm] Choose better candidate for directed yield (Rik van Riel) [864233] - [kvm] s390: Implement the directed yield (diag 9c) hypervisor call for KVM (Rik van Riel) [864233] - [kvm] Note down when cpu relax intercepted or pause loop exited (Rik van Riel) [864233] - [netdrv] sfc: Enable RX scatter for flows steered by RFS (Nikolay Aleksandrov) [987200] - [netdrv] sfc: Fix aRFS UDP flow steering problem (Nikolay Aleksandrov) [984933] - [md] dm-thin: remove cells from stack (Mike Snitzer) [922212] - [md] dm-bio-prison: pass cell memory in (Mike Snitzer) [922212] - [md] persistent-data: add btree_walk (Mike Snitzer) [922212] - [md] persistent-data: set some btree fn parms const (Mike Snitzer) [922212] - [md] persistent-data: remove CONFIG_EXPERIMENTAL (Mike Snitzer) [922212] - [md] dm-bufio: use WRITE_FLUSH instead of REQ_FLUSH (Mike Snitzer) [922212] - [md] persistent-data: dm-transaction-manager.c: rename HASH_SIZE (Mike Snitzer) [922212] - [md] dm-thin: fix non power-of-two discard granularity calculation (Mike Snitzer) [922212] - [md] dm-kcopyd: introduce configurable throttling (Mike Snitzer) [922212] - [md] dm-ioctl: allow message to return data (Mike Snitzer) [922212] - [md] dm-ioctl: optimize functions without variable params (Mike Snitzer) [922212] - [md] dm-ioctl: introduce ioctl_flags (Mike Snitzer) [922212] - [md] dm-table: remove superfluous variable reset (Mike Snitzer) [922212] - [md] dm: fix truncated status strings (Mike Snitzer) [922212] - [usb] host: Fix lockdep warning in AMD PLL quirk (Don Zickus) [854353] - [usb] ehci: fix obscure race in ehci_endpoint_disable (Don Zickus) [877123] - [usb] don't read past config->interface if usb_control_msg() fails in usb_reset_configuration() (Don Zickus) [877123] - [char] tpm: fix regression caused by section type conflict of tpm_dev_release() in ppc builds (Tony Camuso) [732942] - [char] tpm: fix regression causesd by ppi (Tony Camuso) [732942] - [char] tpm: declare internal symbols as static (Tony Camuso) [732942] - [char] tpm: add PPI support in tpm driver (Tony Camuso) [732942] - [char] tpm: Add securityfs support for event log (Tony Camuso) [732942] - [char] tpm: Export wait_for_stat for other vendor specific drivers (Tony Camuso) [732942] - [char] tpm: modularize event log collection (Tony Camuso) [732942] - [Documentation] ABI: sysfs for Physical Presence Interface (Tony Camuso) [732942] - [char] tpm: fix memleak when register hardware fails (Tony Camuso) [732942] - [lib] raid6: cleanup gen_syndrome function selection (Jes Sorensen) [915995] - [lib] raid6: update test program for recovery functions (Jes Sorensen) [915995] - [lib] raid6: fix test program build (Jes Sorensen) [915995] - [x86] add AVX optimized RAID5 checksumming (Jes Sorensen) [915995] - [crypto] disable preemption while benchmarking RAID5 xor checksumming (Jes Sorensen) [915995] - [crypto] wait for a full jiffy in do_xor_speed (Jes Sorensen) [915995] - [x86] Add cpu_has_ssse3 and cpu_has_avx definitions (Jes Sorensen) [915995] - [md] raid10: fix bug which causes all RAID10 reshapes to move no data (Jes Sorensen) [837097 869622] - [md] raid5: allow 5-device RAID6 to be reshaped to 4-device (Jes Sorensen) [837097 869622] - [md] raid10: fix two bugs affecting RAID10 reshape (Jes Sorensen) [837097 869622] - [md] Remember the last sync operation that was performed (Jes Sorensen) [837097 869622] - [md] fix buglet in RAID5 -> RAID0 conversion (Jes Sorensen) [837097 869622] - [md] raid10: check In_sync flag in 'enough()' (Jes Sorensen) [837097 869622] - [md] raid10: locking changes for 'enough()' (Jes Sorensen) [837097 869622] - [md] replace strict_strto*() with kstrto*() (Jes Sorensen) [837097 869622] - [md] Wait for md_check_recovery before attempting device removal (Jes Sorensen) [837097 869622] - [md] raid1,raid10: use freeze_array in place of raise_barrier in various places (Jes Sorensen) [837097 869622] - [md] raid1: consider WRITE as successful only if at least one non-Faulty and non-rebuilding drive completed it (Jes Sorensen) [837097 869622] - [md] md_stop_writes() should always freeze recovery (Jes Sorensen) [837097 869622] - [md] bad block list should default to disabled (Jes Sorensen) [837097 869622 882413] - [md] raid1/raid10 md devices leak memory when stopping (Jes Sorensen) [837097 869622 956769] - [md] Export 'md_reap_sync_thread' function (Jes Sorensen) [837097 869622] - [md] don't update metadata when stopping a read-only array (Jes Sorensen) [837097 869622] - [md] Allow devices to be re-added to a read-only array (Jes Sorensen) [837097 869622] - [md] raid10: Allow skipping recovery when clean arrays are assembled (Jes Sorensen) [837097 869622] - [md] Fix typos in MD documentation (Jes Sorensen) [837097 869622] - [md] raid5: avoid an extra write when writing to a known-bad-block (Jes Sorensen) [837097 869622] - [md] raid5: Change or of some order to improve efficiency (Jes Sorensen) [837097 869622] - [md] use set_bit_le and clear_bit_le (Jes Sorensen) [837097 869622] - [md] HOT_DISK_REMOVE shouldn't make a read-auto device active (Jes Sorensen) [837097 869622] - [md] use common code for all calls to ->hot_remove_disk() (Jes Sorensen) [837097 869622] - [md] never update metadata when array is read-only (Jes Sorensen) [837097 869622] - [md] block: Add submit_bio_wait(), remove from md (Jes Sorensen) [837097 869622] - [md] block: Use bio_sectors() more consistently (Jes Sorensen) [837097 869622] - [md] remove CONFIG_MULTICORE_RAID456 entirely (Jes Sorensen) [837097 869622] - [md] raid5: ensure sync and DISCARD don't happen at the same time (Jes Sorensen) [837097 869622] - [md] Prevent sysfs operations on uninitialized kobjects (Jes Sorensen) [837097 869622] - [md] raid5: Avoid accessing gendisk or queue structs when not available (Jes Sorensen) [837097 869622] - [md] raid5: schedule_construction should abort if nothing to do (Jes Sorensen) [837097 869622 882413] - [md] expedite metadata update when switching read-auto -> active (Jes Sorensen) [837097 869622] - [md] remove CONFIG_MULTICORE_RAID456 (Jes Sorensen) [837097 869622] - [md] raid0: improve error message when converting RAID4-with-spares to RAID0 (Jes Sorensen) [837097 869622] - [md] raid0: fix error return from create_stripe_zones (Jes Sorensen) [837097 869622] - [md] fix two bugs when attempting to resize RAID0 array (Jes Sorensen) [837097 869622] - [md] raid10: Improve redundancy for 'far' and 'offset' algorithms II (Jes Sorensen) [837097 869622] - [md] raid10: Improve redundancy for 'far' and 'offset' algorithms I (Jes Sorensen) [837097 869622] - [md] raid10: Minor non-functional code changes (Jes Sorensen) [837097 869622] - [md] protect against crash upon fsync on ro array (Jes Sorensen) [837097 869622] - [crypto] async_tx: fix checking of dma_wait_for_async_tx() return value (Jes Sorensen) [837097 869622] - [crypto] async_tx: fix build for async_memset (Jes Sorensen) [837097 869622] - [crypto] async_tx: add missing DMA unmap to async_memcpy() (Jes Sorensen) [837097 869622] - [md] raid5: add blktrace calls (Jes Sorensen) [837097 869622] - [md] raid5: use async_tx_quiesce() instead of open-coding it (Jes Sorensen) [837097 869622] - [md] Use ->curr_resync as last completed request when cleanly aborting resync (Jes Sorensen) [837097 869622] - [md] Update checkpoint of resync/recovery based on time (Jes Sorensen) [837097 869622] - [md] Add place to update ->recovery_cp (Jes Sorensen) [837097 869622] - [md] re-indent various 'switch' statements (Jes Sorensen) [837097 869622] - [md] close race between removing and adding a device (Jes Sorensen) [837097 869622] - [md] removed unused variable in calc_sb_1_csm (Jes Sorensen) [837097 869622] - [md] raid10: decrement correct pending counter when writing to replacement (Jes Sorensen) [837097 869622] - [md] raid10: close race that lose writes lost when replacement completes (Jes Sorensen) [837097 869622] - [md] raid5: Make sure we clear R5_Discard when discard is finished (Jes Sorensen) [837097 869622] - [md] raid5: move resolving of reconstruct_state earlier in stripe_handle (Jes Sorensen) [837097 869622] - [md] raid5: round discard alignment up to power of 2 (Jes Sorensen) [837097 869622] - [md] make sure everything is freed when dm-raid stops an array (Jes Sorensen) [837097 869622] - [md] Avoid write invalid address if read_seqretry returned true (Jes Sorensen) [837097 869622] - [md] Reassigned the parameters if read_seqretry returned true in func md_is_badblock (Jes Sorensen) [837097 869622] - [md] raid10: Fix oops when creating RAID10 arrays via dm-raid.c (Jes Sorensen) [837097 869622] - [md] raid1: Fix assembling of arrays containing Replacements (Jes Sorensen) [837097 869622] - [md] Fix typo in drivers/md (Jes Sorensen) [837097 869622] - [md] refine reporting of resync/reshape delays (Jes Sorensen) [837097 869622] - [md] raid5: be careful not to resize_stripes too big (Jes Sorensen) [837097 869622] - [md] make sure manual changes to recovery checkpoint are saved (Jes Sorensen) [837097 869622] - [md] raid10: use correct limit variable (Jes Sorensen) [837097 869622] - [md] writing to sync_action should clear the read-auto state (Jes Sorensen) [837097 869622] - [md] change resync_mismatches to atomic64_t to avoid races (Jes Sorensen) [837097 869622] - [md] raid5: make sure to_read and to_write never go negative (Jes Sorensen) [837097 869622] - [md] When RAID5 is dirty, force reconstruct-write instead of read-modify-write (Jes Sorensen) [837097 869622] - [md] raid5: protect debug message against NULL derefernce (Jes Sorensen) [837097 869622] - [md] raid5: add some missing locking in handle_failed_stripe (Jes Sorensen) [837097 869622] - [md] raid5: avoid unnecessary zero page for trim (Jes Sorensen) [837097 869622] - [md] raid5 trim support (Jes Sorensen) [837097 869622] - [md] bitmap: Don't use IS_ERR to judge alloc_page() (Jes Sorensen) [837097 869622] - [md] avoid taking the mutex on some ioctls (Jes Sorensen) [837097 869622] - [md] change the parameter of md thread (Jes Sorensen) [837097 869622] - [md] raid 10 supports TRIM (Jes Sorensen) [837097 869622] - [md] raid 1 supports TRIM (Jes Sorensen) [837097 869622] - [md] raid 0 supports TRIM (Jes Sorensen) [837097 869622] - [md] linear supports TRIM (Jes Sorensen) [837097 869622] - [md] linear: rcu_dereference outside read-lock section (Jes Sorensen) [837097 869622] - [md] raid10: fix "enough" function for detecting if array is failed (Jes Sorensen) [837097 869622] - [block] makes bio_split support bio without data (Jes Sorensen) [837097 869622] - [md] raid5: add missing spin_lock_init (Jes Sorensen) [837097 869622] - [md] make sure metadata is updated when spares are activated or removed (Jes Sorensen) [837097 869622] - [md] raid5: fix calculate of 'degraded' when a replacement becomes active (Jes Sorensen) [837097 869622] - [md] raid10: fix problem with on-stack allocation of r10bio structure (Jes Sorensen) [837097 869622 982360] - [md] raid5: raid5d handle stripe in batch way (Jes Sorensen) [837097 869622] - [md] raid1: Add missing case for attempting to repair known bad blocks (Jes Sorensen) [837097 869622] - [md] remove duplicated test on ->openers when calling do_md_stop() (Jes Sorensen) [837097 869622] - [md] raid5: Add R5_ReadNoMerge flag which prevent bio from merging at block layer (Jes Sorensen) [837097 869622] - [md] raid1: prevent merging too large request (Jes Sorensen) [837097 869622] - [md] md/raid1: read balance chooses idlest disk for SSD (Jes Sorensen) [837097 869622] - [md] md/raid1: make sequential read detection per disk based (Jes Sorensen) [837097 869622] - [md] raid5: add a per-stripe lock (Jes Sorensen) [837097 869622] - [md] raid5: remove unnecessary bitmap write optimization (Jes Sorensen) [837097 869622] - [md] raid5: lockless access raid5 overrided bi_phys_segments (Jes Sorensen) [837097 869622] - [md] raid5: reduce chance release_stripe() taking device_lock (Jes Sorensen) [837097 869622] - [md] raid1: Fix handling of SYNC requests and bio->bi_rw (Jes Sorensen) [837097 869622] - [md] raid10: Fix handling of SYNC requests and bio->bi_rw (Jes Sorensen) [837097 869622] - [md] Add missing blank line to avoid conflict in follow-on cherry-pick (Jes Sorensen) [837097 869622] - [md] Add set_bit_le/clear_bit_le to RHEL6 compat macros (Jes Sorensen) [837097 869622] - [md] dm-raid: Set recovery flags on resume - include upstream missing bits (Jes Sorensen) [837097 869622]- [netdrv] eth: Make is_link_local() consistent with other address tests (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Do not forward LLDP type frames (Andy Gospodarek) [923902] - [netdrv] bridge: Use is_link_local() in store_group_addr() (Andy Gospodarek) [923902] - [netdrv] ixgbevf: handle link local multicast addresses in SR-IOV mode (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Adjust to handle unassigned MAC address from PF (Andy Gospodarek) [923902] - [netdrv] ixgbevf: don't release the soft entries (Andy Gospodarek) [923902] - [netdrv] ixbgevf: Remove dma_alloc_coherent OOM messages (Andy Gospodarek) [923902] - [netdrv] ixgbevf: use PCI_DEVICE_TABLE macro (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Make next_to_watch a pointer and adjust memory barriers to avoid races (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Make sure link status and speed are fetched (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Fix link speed message to support 100Mbps (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Fix statistics corruption (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Fix link up messages (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Synch out of tree and in tree mailbox interrupt handlers (Andy Gospodarek) [923902] - [netdrv] ixgbevf: fix up function prototypes after __dev* removals (Andy Gospodarek) [923902] - [netdrv] ixgbevf: remove __dev* attributes (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Remove unneeded and obsolete comment (Andy Gospodarek) [923902] - [netdrv] ixgbevf: White space and comments clean up (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Remove mailbox spinlock from the reset function (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Remove checking for mac.ops function pointers (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Remove the ring adapter pointer value (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Fix unnecessary dereference where local var is available (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Streamline the rx buffer allocation (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Reduce size of maximum rx buffer (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Add flag to indicate when rx is in net poll (Andy Gospodarek) [923902] - [netdrv] ixgbevf: fix possible use of uninitialized variable (Andy Gospodarek) [923902] - [netdrv] ixgbevf: make sure probe fails on MSI-X enable error (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Update version string (Andy Gospodarek) [923902] - [netdrv] ixgbevf: fix softirq-safe to unsafe splat on internal mbx_lock (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Check for error on dma_map_single call (Andy Gospodarek) [923902] - [netdrv] ixgbevf: make netif_napi_add and netif_napi_del symmetric (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Add VF DCB + SR-IOV support (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Limit maximum jumbo frame size to 9.5K to avoid Tx hangs (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Set the netdev number of Tx queues (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Add fix to VF to handle multi-descriptor buffers (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Fix AIM (Adaptive Interrupt Moderation) (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Remove unused parameter in ixgbevf_receive_skb (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Fix code for handling timeout (Andy Gospodarek) [923902] - [netdrv] ixgbevf: scheduling while atomic in reset hw path (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Add support for VF API negotiation (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Cleanup handling of configuration for jumbo frames (Andy Gospodarek) [923902] - [netdrv] ixgbevf: Add suspend and resume support to the VF (Andy Gospodarek) [923902] - [netdrv] ixgbe: Set the SW prio_tc values at initialization to the HW setting (Andy Gospodarek) [923901] - [netdrv] ixgbe: add mac type to the version in ethtool_regs (Andy Gospodarek) [923901] - [netdrv] ixgbe: add support for disabling link at boot time on 82599 (Andy Gospodarek) [923901] - [netdrv] ixgbe: cache AUTOC reads (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix register access during ethtool loopback test (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix EICR write in ixgbe_msix_other (Andy Gospodarek) [923901] - [netdrv] ixgbe: add WOL support for new subdevice ID (Andy Gospodarek) [923901] - [netdrv] ixgbe: add SFP+ LX module support (Andy Gospodarek) [923901] - [netdrv] ixgbe: rename wol_supported to more fitting wol_enabled (Andy Gospodarek) [923901] - [netdrv] ixgbe: add driver support for x520 OCP adapter (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix possible divide by zero in ixgbe_update_itr (Andy Gospodarek) [923901] - [netdrv] ixgbe: Remove unnecessary #ifdef CONFIG_DEBUG_FS tests (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add support for WoL on 82599 SFP+ LOM (Andy Gospodarek) [923901] - [netdrv] ixgbe: in shutdown, do netif_running() under rtnl_lock (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix a bug in setting VF VLAN via PF (Andy Gospodarek) [923901] - [netdrv] ixgbe: bump version number (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix 1G link WoL (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix MNG FW support when adapter not up (Andy Gospodarek) [923901] - [netdrv] ixgbe: enable devices with internal switch to read pci parent (Andy Gospodarek) [923901] - [netdrv] ixgbe: create conversion functions from link_status to bus/speed (Andy Gospodarek) [923901] - [netdrv] ixgbe: Enable support for recognizing PCI-e Gen3 link speed (Andy Gospodarek) [923901] - [netdrv] ixgbe: Drop check for PAGE_SIZE from ixgbe_xmit_frame_ring (Andy Gospodarek) [923901] - [netdrv] ixgbe: don't do arithmetic operations on bitmasks (Andy Gospodarek) [923901] - [netdrv] ixgbe: Mask off check of frag_off as we only want fragment offset (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix registration order of driver and DCA nofitication (Andy Gospodarek) [923901] - [netdrv] ixgbe: Update DESC_NEEDED define to adjust for changes to MAX_SKB_FRAGS (Andy Gospodarek) [923901] - [netdrv] ixgbe: implement SFF diagnostic monitoring via ethtool (Andy Gospodarek) [923901] - [netdrv] ixgbe: cleanup error checking in ixgbe_identify_sfp_module_generic() (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix possible data corruption in read_i2c_byte (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add support for set_channels ethtool operation (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add support for displaying the number of Tx/Rx channels (Andy Gospodarek) [923901] - [netdrv] ixgbe: Make ixgbe_setup_tc usable even when DCB is not enabled (Andy Gospodarek) [923901] - [netdrv] ixgbe: Define FCoE and Flow director limits much sooner to allow for changes (Andy Gospodarek) [923901] - [netdrv] ixgbe: refactor initialization of feature flags (Andy Gospodarek) [923901] - [netdrv] ixgbe: Remove remaining alloc/OOM messages (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix SR-IOV MTU warning (Andy Gospodarek) [923901] - [netdrv] ixgbe: Replace rmb in Tx cleanup with read_barrier_depends (Andy Gospodarek) [923901] - [netdrv] ixgbe: update date to 2013 (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix return values and memcpy parameters to eliminate Smatch warnings (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix potential null dereference (Andy Gospodarek) [923901] - [netdrv] ixgbe: allow reading of SFF-8472 data over i2c (Andy Gospodarek) [923901] - [netdrv] ixgbe: autoneg variable refactoring (Andy Gospodarek) [923901] - [netdrv] ixgbe: removed unused variable from setup_link_speed (Andy Gospodarek) [923901] - [netdrv] ixgbe: rename autoneg variables (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix device ref count bug (Andy Gospodarek) [923901] - [netdrv] ixgbe: Reset the NIC if up2tc has changed (Andy Gospodarek) [923901] - [netdrv] ixgbe: Limit number of reported VFs to device specific value (Andy Gospodarek) [923901] - [netdrv] ixgbe: Implement PCI SR-IOV sysfs callback operation (Andy Gospodarek) [923901] - [netdrv] ixgbe: Modularize SR-IOV enablement code (Andy Gospodarek) [923901] - [netdrv] ixgbe: Make mailbox ops initialization unconditional (Andy Gospodarek) [923901] - [netdrv] ixgbe: Inline Rx PTP descriptor handling (Andy Gospodarek) [923901] - [netdrv] ixgbe: add warning when scheduling reset (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add ptp work item to poll for the Tx timestamp (Andy Gospodarek) [923901] - [netdrv] ixgbe: Use watchdog check in favor of BPF for detecting latched timestamp (Andy Gospodarek) [923901] - [netdrv] ixgbe: Update ptp_overflow check comment and jiffies (Andy Gospodarek) [923901] - [netdrv] ixgbe: add missing supported filters to get_ts_info (Andy Gospodarek) [923901] - [netdrv] ixgbe: ethtool ixgbe_diag_test cleanup (Andy Gospodarek) [923901] - [netdrv] ixgbe: Improve performance and reduce size of ixgbe_tx_map (Andy Gospodarek) [923901] - [netdrv] ixgbe: Update ixgbe Tx flags to improve code efficiency (Andy Gospodarek) [923901] - [netdrv] ixgbe: Always use context 0, even for FCoE and TSO (Andy Gospodarek) [923901] - [netdrv] ixgbe: Make TSO check for CHECKSUM_PARTIAL to avoid skb_is_gso check (Andy Gospodarek) [923901] - [netdrv] ixgbe: SR-IOV: dynamic IEEE DCBx default priority changes (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix overwriting of rx_mtrl in ixgbe_ptp_hwtstamp_ioctl (Andy Gospodarek) [923901] - [netdrv] ixgbe: only compile ixgbe_debugfs.o when enabled (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix up function prototypes after __dev* removals (Andy Gospodarek) [923901] - [netdrv] ixgbe: check whether thermal sensor is enabled (Andy Gospodarek) [923901] - [netdrv] ixgbe: Use is_valid_ether_addr (Andy Gospodarek) [923901] - [netdrv] ixgbe: remove __dev* attributes (Andy Gospodarek) [923901] - [netdrv] ixgbe: Do not parse past IP header on fragments beyond the first (Andy Gospodarek) [923901] - [netdrv] ixgbe: bump version number (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix incorrect disabling of Tx hang check in case of PFC (Andy Gospodarek) [923901] - [netdrv] ixgbe: Drop RLPML configuration from x540 RXDCTL register configuration (Andy Gospodarek) [923901] - [netdrv] ixgbe: ethtool correctly identify autoneg setting (Andy Gospodarek) [923901] - [netdrv] ixgbe: remove needless queuing for L4 ptp packets (Andy Gospodarek) [923901] - [netdrv] ixgbe: use ETQF filter name instead of magic number (Andy Gospodarek) [923901] - [netdrv] ixgbe: convert to use simple_open() (Andy Gospodarek) [923901] - [netdrv] ixgbe: Reformat output of ixgbe_dump (Andy Gospodarek) [923901] - [netdrv] ixgbe: Do not use DCA to prefetch the entire packet into the cache (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix default setting of TXDCTL.WTHRESH (Andy Gospodarek) [923901] - [netdrv] ixgbe: add/update descriptor maps in comments (Andy Gospodarek) [923901] - [netdrv] ixgbe: Do not decrement budget in ixgbe_clean_rx_irq (Andy Gospodarek) [923901] - [netdrv] ixgbe: Return success or failure on VF MAC filter set (Andy Gospodarek) [923901] - [netdrv] ixgbe: clean up the condition for turning on/off the laser (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix return value from macvlan filter function (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add support for pipeline reset (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix possible memory leak in ixgbe_set_ringparam (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add function ixgbe_reset_pipeline_82599 (Andy Gospodarek) [923901] - [netdrv] ixgbe: Drop unnecessary addition from ixgbe_set_rx_buffer_len (Andy Gospodarek) [923901] - [netdrv] ixgbe: Correcting small packet padding (Andy Gospodarek) [923901] - [netdrv] ixgbe: using is_zero_ether_addr() to simplify the code (Andy Gospodarek) [923901] - [netdrv] ixgbe: (PTP) refactor init, cyclecounter and reset (Andy Gospodarek) [923901] - [netdrv] ixgbe: add WOL support for new subdevice id (Andy Gospodarek) [923901] - [netdrv] ixgbe: Enable support for VF API version 1.1 in the PF (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add support for GET_QUEUES message to get DCB configuration (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add support for tracking the default user priority to SR-IOV (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add support for IPv6 and UDP to ixgbe_get_headlen (Andy Gospodarek) [923901] - [netdrv] ixgbe: Add mailbox API version negotiation support to ixgbe PF (Andy Gospodarek) [923901] - [netdrv] ixgbe: Move message handling routines into their own functions (Andy Gospodarek) [923901] - [netdrv] ixgbe: Enable jumbo frames support w/ SR-IOV (Andy Gospodarek) [923901] - [netdrv] ixgbe: Initialize q_vector cpu and affinity masks correctly (Andy Gospodarek) [923901] - [netdrv] ixgbe: Limit maximum jumbo frame size to 9.5K to avoid Tx hangs (Andy Gospodarek) [923901] - [netdrv] ixgbe: add support for X540-AT1 (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix poll loop for FDIRCTRL.INIT_DONE bit (Andy Gospodarek) [923901] - [netdrv] ixgbe: fix PTP ethtool timestamping function (Andy Gospodarek) [923901] - [netdrv] ixgbe: Do not read the spoofed packets counter when not in IOV mode (Andy Gospodarek) [923901] - [netdrv] ixgbe: Improve statistics accuracy for DDP traffic (Andy Gospodarek) [923901] - [netdrv] ixgbe: added reg_ops file to debugfs (Andy Gospodarek) [923901] - [netdrv] ixgbe: added netdev_ops file to debugfs (Andy Gospodarek) [923901] - [netdrv] ixgbe: add debugfs support (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix VF rate limiting to correctly account for more queues per VF (Andy Gospodarek) [923901] - [netdrv] ixgbe: Fix ordering of things so that PF correctly configures its VLANs (Andy Gospodarek) [923901] - [netdrv] ixgbe: remove old init remnant (Andy Gospodarek) [923901] - [netdrv] ixgbe: Roll RSC code into non-EOP code (Andy Gospodarek) [923901] - [netdrv] ixgbe: Make allocating skb and placing data in it a separate function (Andy Gospodarek) [923901] - [netdrv] ixgbe: Copybreak sooner to avoid get_page/put_page and offset change overhead (Andy Gospodarek) [923901] - [netdrv] ixgbe: Make pull tail function separate from rest of cleanup_headers (Andy Gospodarek) [923901] - [netdrv] ixgbe: Have the CPU take ownership of the buffers sooner (Andy Gospodarek) [923901] - [netdrv] ixgbe: Only use double buffering if page size is less than 8K (Andy Gospodarek) [923901] - [netdrv] ixgbe: combine ixgbe_add_rx_frag and ixgbe_can_reuse_page (Andy Gospodarek) [923901] - [netdrv] ixgbe: Remove code that was initializing Rx page offset (Andy Gospodarek) [923901] - [net] veth: add vlan features (Flavio Leitner) [959817] - [net] sctp: verify length provided in heartbeat information parameter (Daniel Borkmann) [855383] - [net] openvswitch: Add Kconfig dependency on GRE-DEMUX (Amerigo Wang) [976810] - [net] openvswitch: Add gre tunnel support (Amerigo Wang) [976810] - [net] openvswitch: Optimize flow key match for non tunnel flows (Amerigo Wang) [976810] - [net] openvswitch: Expand action buffer size (Amerigo Wang) [976810] - [net] openvswitch: Add tunneling interface (Amerigo Wang) [976810] - [net] openvswitch: Copy individual actions (Amerigo Wang) [976810] - [net] openvswitch: Simplify interface ovs_flow_metadata_from_nlattrs() (Amerigo Wang) [976810] - [net] openvswitch: make skb->csum consistent with rest of networking stack (Amerigo Wang) [976810] - [net] openvswitch: Fix misspellings in comments and docs (Amerigo Wang) [976810] - [net] openvswitch: fix variable names in comment (Amerigo Wang) [976810] - [net] openvswitch: Unify vport error stats handling (Amerigo Wang) [976810] - [net] openvswitch: Remove unused get_config vport op (Amerigo Wang) [976810] - [net] openvswitch: Immediately exit on error in ovs_vport_cmd_set() (Amerigo Wang) [976810] - [net] openvswitch: Remove unneeded ovs_netdev_get_ifindex() (Amerigo Wang) [976810] - [net] openvswitch: Simplify datapath locking (Amerigo Wang) [976810] - [net] openvswitch: Use ETH_ALEN to define ethernet addresses (Amerigo Wang) [976810] - [net] openvswitch: datapath.h: Fix a stale comment (Amerigo Wang) [976810] - [net] openvswitch: Don't insert empty OVS_VPORT_ATTR_OPTIONS attribute (Amerigo Wang) [976810] - [net] openvswitch: Move common genl notify code into ovs_notify() (Amerigo Wang) [976810] - [net] openvswitch: Refine Netlink message size calculation and kill FLOW_BUFSIZE (Amerigo Wang) [976810] - [net] openvswitch: Use nla_memcpy() to memcpy() data from attributes (Amerigo Wang) [976810] - [net] openvswitch: Specify the minimal length of OVS_PACKET_ATTR_PACKET in the policy (Amerigo Wang) [976810] - [net] openvswitch: correct an invalid BUG_ON (Amerigo Wang) [976810] - [net] openvswitch: Preallocate reply skb in ovs_vport_cmd_set() (Amerigo Wang) [976810] - [net] ip_gre: fix a soft lockup in ipgre_fini() (Amerigo Wang) [976810] - [net] gre: Fix MTU sizing check for gretap tunnels (Amerigo Wang) [976810] - [net] ip_tunnel: Use skb-len to PMTU check (Amerigo Wang) [976810] - [net] gre: fix a regression in ioctl (Amerigo Wang) [976810] - [net] ip_tunnel: Add dont fragment flag (Amerigo Wang) [976810] - [net] ip_tunnel: push generic protocol handling to ip_tunnel module (Amerigo Wang) [976810] - [net] ip_tunnel: extend iptunnel_xmit() (Amerigo Wang) [976810] - [net] gre: export gre_handle_offloads() function (Amerigo Wang) [976810] - [net] gre: export gre_build_header() function (Amerigo Wang) [976810] - [net] gre: Allow multiple protocol listener for gre protocol (Amerigo Wang) [976810] - [net] gre: Simplify gre protocol registration locking (Amerigo Wang) [976810] - [net] ip_tunnel: remove __net_init/exit from exported functions (Amerigo Wang) [976810] - [net] ip_tunnel: specify protocol outside IP header (Amerigo Wang) [976810] - [net] ip_tunnel: fix kernel panic with icmp_dest_unreach (Amerigo Wang) [976810] - [net] ip_gre: fix a possible crash in ipgre_err() (Amerigo Wang) [976810] - [net] ipv4: typo issue, remove erroneous semicolon (Amerigo Wang) [976810] - [net] ip_gre: fix a possible crash in parse_gre_header() (Amerigo Wang) [976810] - [net] ip_gre: don't overwrite iflink during net_dev init (Amerigo Wang) [976810] - [net] ip_tunnel: Fix off-by-one error in forming dev name (Amerigo Wang) [976810] - [net] gre: Refactor GRE tunneling code (Amerigo Wang) [976810] - [net] ip: convert __IPTUNNEL_XMIT() to an inline function (Amerigo Wang) [976810] - [net] br: fix schedule while atomic issue in br_features_recompute() (Jiri Pirko) [980876] - [net] ipvs: reduce sync rate with time thresholds (Jesper Brouer) [854454] - [net] ipvs: Add sysctl_sync_threshold() sysctl_sync_period() (Jesper Brouer) [854454] - [net] ipvs: wakeup master thread (Jesper Brouer) [854454] - [net] export sysctl symbols needed by ip_vs_sync (Jesper Brouer) [854454] - [net] ipvs: always update some of the flags bits in backup (Jesper Brouer) [854454] - [net] ipvs: fix ip_vs_try_bind_dest to rebind app and transmitter (Jesper Brouer) [854454] - [net] ipvs: remove check for IP_VS_CONN_F_SYNC from ip_vs_bind_dest (Jesper Brouer) [854454] - [net] ipvs: ignore IP_VS_CONN_F_NOOUTPUT in backup server (Jesper Brouer) [854454] - [net] ipvs: try also real server with port 0 in backup server (Jesper Brouer) [854454] - [net] ipvs: Backup, adding version 0 sending capabilities (Jesper Brouer) [854454] - [net] ipvs: Backup, Change sending to Version 1 format (Jesper Brouer) [854454] - [net] ipvs: Backup, Adding Version 1 receive capability (Jesper Brouer) [854454] - [net] ipvs: Backup, Adding structs for new sync format (Jesper Brouer) [854454] - [net] ipvs: use pkts for SCTP too (Jesper Brouer) [854454] - [net] ipvs: skb defrag in L7 helpers (Jesper Brouer) [854454] - [net] ipvs: Split ports array into src_port and dst_port (Jesper Brouer) [854454] - [net] ipvs: Backup, Prepare for transferring firewall marks to the backup daemon (Jesper Brouer) [854454] - [net] ipvs: add static and read_mostly attributes (Jesper Brouer) [854454] - [net] ipvs: buffer argument to ip_vs_process_message() should not be const (Jesper Brouer) [854454] - [net] ipvs: Remove useless blocks from ip_vs_process_message() (Jesper Brouer) [854454] - [net] ipvs: Make the cp argument to ip_vs_sync_conn() static (Jesper Brouer) [854454] - [net] ipvs: Only match pe_data created by the same pe (Jesper Brouer) [854454] - [net] ipvs: Add persistence engine to connection entry (Jesper Brouer) [854454] - [net] ipvs: inherit forwarding method in backup (Jesper Brouer) [854454] - [net] ipvs: ip_vs_dbg_callid() is only needed for debugging (Jesper Brouer) [854454] - [net] ipvs: sip persistence engine (Jesper Brouer) [854454] - [net] ipvs: Fallback if persistence engine fails (Jesper Brouer) [854454] - [net] ipvs: Allow configuration of persistence engines (Jesper Brouer) [854454] - [net] ipvs: management of persistence engine modules (Jesper Brouer) [854454] - [net] ipvs: Add persistence engine data to /proc/net/ip_vs_conn (Jesper Brouer) [854454] - [net] ipvs: Add struct ip_vs_pe (Jesper Brouer) [854454] - [net] ipvs: Allow boot time change of hash size (Jesper Brouer) [854454] - [net] ipvs: ip_vs_bind_scheduler and ip_vs_unbind_scheduler NULL arguments (Jesper Brouer) [854454] - [net] ipvs: Allow null argument to ip_vs_scheduler_put() (Jesper Brouer) [854454] - [net] ipvs: fix matching of fwmark templates during scheduling (Jesper Brouer) [854454] - [net] ipvs: Add struct ip_vs_conn_param (Jesper Brouer) [854454] - [net] ipvs: compact ip_vs_sched_persist() (Jesper Brouer) [854454] - [net] ipvs: extend connection flags to 32 bits (Jesper Brouer) [854454] - [net] nf_conntrack_sip: Add callid parser (Jesper Brouer) [854454] - [net] nf_conntrack_sip: Allow ct_sip_get_header() to be called with a null ct argument (Jesper Brouer) [854454] - [net] ipvs: fix synchronization on connection close (Jesper Brouer) [854454] - [net] ipvs: one-packet scheduling (Jesper Brouer) [854454]- [char] tty: Fix BUG() on hangup (Aaron Tomlin) [985429] - [trace] Fix hang in write to sysprof_sample_period (Josh Poimboeuf) [959063] - [scsi] virtio-scsi: fix LUNs greater than 255 (Laszlo Ersek) [978202] - [scsi] isci: Fix a race condition in the SSP task management path (David Milburn) [978609] - [idle] intel_idle: initial C8, C9 and C10 support (Jane Lv) [970729] - [x86] Fix up numa_node information for AMD CPU family 15h model 0-0fh northbridge functions (Prarit Bhargava) [787034] - [x86] tsc: add option to output TSC initial value at boot (Prarit Bhargava) [986353] - [fs] fscache: The retrieval remaining-pages counter needs to be atomic_t (David Howells) [965759] - [fs] cachefiles: remove unused macro list_to_page() (David Howells) [921178] - [fs] fscache: Simplify cookie retention for fscache_objects, fixing access problems (David Howells) [928746] - [fs] fscache: Fix object state machine to have separate work and wait states (David Howells) [921178] - [kernel] wait: Add wait_on_atomic_t() and wake_up_atomic_t() (David Howells) [921178] - [fs] fscache: Wrap checks on object state (David Howells) [921178] - [fs] fscache: Uninline fscache_object_init() (David Howells) [921178] - [fs] fscache: Don't sleep in page release if __GFP_FS is not set (David Howells) [921178] - [fs] cachefiles: name i_mutex lock class explicitly (David Howells) [921178] - [fs] fscache: remove spin_lock() from the condition in while() (David Howells) [921178] - [fs] fscache: Clear remaining page count on retrieval cancellation (David Howells) [921178] - [fs] fscache: Mark cancellation of in-progress operation (David Howells) [921178] - [fs] fscache: Remove unneeded null checks (David Howells) [921178] - [fs] fscache: One of the write operation paths doesn't set the object state (David Howells) [921178] - [fs] fscache: Fix signal handling during waits (David Howells) [921178] - [fs] fscache: Add transition to handle invalidate immediately after lookup (David Howells) [921178 928746] - [fs] fscache: Exclusive op submission can BUG if there's been an I/O error (David Howells) [921178] - [fs] fsache: Limit the number of I/O error reports for a cache (David Howells) [921178] - [fs] fscache: Don't mask off the object event mask when printing it (David Howells) [921178] - [fs] fscache: Initialise the object event mask with the calculated mask (David Howells) [921178] - [fs] cachefiles: Add missing retrieval completions (David Howells) [921178] - [fs] cachefiles: add support for large files in filesystem caching (David Howells) [921178] - [netdrv] igbvf: Make next_to_watch a pointer and adjust memory barriers to avoid races (Stefan Assmann) [923900] - [netdrv] igbvf: update version number (Stefan Assmann) [923900] - [netdrv] igbvf: Check for error on dma_map_single call (Stefan Assmann) [923900] - [netdrv] enic: release rtnl_lock on error-path (Stefan Assmann) [922984] - [netdrv] enic: change sprintf() to snprintf() (Stefan Assmann) [922984] - [netdrv] enic: be less verbose about non-critical firmware errors (Stefan Assmann) [922984] - [netdrv] enic: fix up function prototypes after __dev* removals (Stefan Assmann) [922984] - [pci] Remove the obsolete no_pci_devices() check (Myron Stowe) [966887] - [pci] Use pci_device_id on stack for pci_get_subsys/class() to avoid kmalloc (Myron Stowe) [966887] - [netdrv] bonding: properly unset current_arp_slave on slave link up (Veaceslav Falico) [988460] - [firmware] add bnx2x FW 7.8.2, 7.8.17 (Michal Schmidt) [825729 828818 915420 915422 919510] - [netdrv] bnx2x: ignore unknown ethtool flags (Michal Schmidt) [915517 928435] - [netdrv] bnx2x: advertise transmit time stamping (Michal Schmidt) [825729 828818 914797 915420 915422 915517 919510] - [netdrv] bnx2x: add transmit timestamping support (Michal Schmidt) [825729 828818 914797 915420 915422 915517 919510] - [netdrv] bnx2x: Remove sparse and coccinelle warnings (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix 20G KR2 support claims (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: improve VF timings (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: VF ndo sanity (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix compilation with no IOV support (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Improve PF behaviour toward VF (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: remove redundant D0 power state set (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: replace mechanism to check for next available packet (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix a power state test (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: semi-Semantic changes (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Revise prints (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Semantic removal and beautification (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Revise comments and alignment (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Semantic change of empty lines (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: use XPS if possible for bnx2x_select_queue instead of pure hash (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Change to D3hot only on removal (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Implement PCI shutdown (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Count number of possible FCoE interfaces (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Ack unknown VF messages (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add and correct PCI link speed prints (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Zero VFs starting MACs (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Enable `set_phys_id' for all functions (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Wait for MCP validity during AER (Michal Schmidt) [825729 828818 915420 915422 915517 919510 921799] - [netdrv] bnx2x: Link-flap avoidance in switch dependent mode (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add Private Flags Support (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix bridged GSO for 57710/57711 chips (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix TCP offload for tunneling ipv4 over ipv6 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix GSO for 57710/57711 chips (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Prevent memory leak when cnic is absent (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: correct reading of speed capabilities (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Prevent NULL pointer dereference in kdump (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Use per port max exchange resources (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Allow recovery from second slot reset (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix memory leak (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Enhance MAC configuration for VFs (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Allow RX/TX pause control in autoneg (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: prevent GRO false checksum claims (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: update version to 1.78.17-0 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: add additional regions for CRC memory test (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: remove non-necessary assignment (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix byte-by-byte nvram write for BE machines (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: refactor nvram read procedure (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Cosmetic changes (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support reading I2C EEPROM SFF8472 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix compilation without CONFIG_BNX2X_SRIOV (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Prevent VF race (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix VF outer vlan removal (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix VF statistics (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: missing ARI should not be lethal (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix AER semaphore release (Michal Schmidt) [825729 828818 915420 915422 915517 919510 921799] - [netdrv] bnx2x: AER revised (Michal Schmidt) [825729 828818 915420 915422 915517 919510 921799] - [netdrv] bnx2x: add RSS capability for GRE traffic (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: dma_alloc_coherent: use __GFP_ZERO instead of memset() (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: use list_move instead of list_del/list_add (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Restore FCoE 4-port devices support (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: use FW 7.8.17 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Avoid using zero MAC (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Control SFP+ tap values via nvm config (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add EEE support for BCM84834 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add RJ45 SFP module detection (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Get gso_segs from FW (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Control number of vfs dynamically (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add iproute2 support for vfs (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Prevent "Unknown MF" print in SF mode (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Take chip version from MFW (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Set ethtool ops for vfs (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix vlan-mac memory leak (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: use the default NAPI weight (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix typo in printk and comments (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix status blocks configuration (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Prevent UNDI FW illegal host access (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Prevent null pointer dereference in AFEX mode (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix KR2 rapid link flap (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix assignment of signed expression to unsigned variable (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix occasional statistics off-by-4GB error (Michal Schmidt) [825729 828818 871164 915420 915422 915517 919510] - [netdrv] bnx2x: add missing napi deletion in error path (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix SFP+ misconfiguration in iSCSI boot scenario (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix intermittent long KR2 link up time (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix KR2 work-around condition (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix KR2 link (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix port identification for the 84834 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix UDP checksum for 57710/57711 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: remove dead code and make local funcs static (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Replace incomming with incoming in all comments and strings (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] cnic: Remove unnecessary alloc/OOM messages, alloc cleanups (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Force link UP when the interface is in LOOPBACK mode (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: SR-IOV version compatibility bugfix (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix compilation with stop-on-error (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add CNIC_DRV_STATE_HANDLES_IRQ to ethdev->drv_state (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: correct memory release scheme (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Remove many sparse warnings (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Modify unload conditions (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Correct memory preparation and release (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add missing VFs reference in macros (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add additional debug information (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: correct usleep_range usage (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: reorganization and beautification (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Semantic renovation (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix GRO parameters (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Introduce 2013 and advance version to 1.78.02 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Added FW GRO bridging support (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] Revert "bnx2x: set gso_type" (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Clean previous IGU status before ack (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: improve stop-on-error (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: add `ethtool -w' support (Michal Schmidt) [825729 828818 915420 915422 915517 919510 921560] - [netdrv] bnx2x: Added nvram personalities support (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix rare self-test failures (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: use SAN Mac for FCoE (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add an additional fatal hw assertion - BRB_HW_INTERRUPT (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Clear dirty status when booting after UNDI (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Allow management traffic after boot from SAN (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix fastpath structures when memory allocation fails (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: move debugging code before the return (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: align define usage to satisfy static checkers (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: NULL dereference on error in debug code (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Segregate SR-IOV code (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add VF device ids and enable feature (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support PF <-> VF Bulletin Board (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support VF FLR (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support of PF driver of a VF release request (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support of PF driver of a VF close request (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support of PF driver of a VF q_teardown request (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support of PF driver of a VF q_filters request (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support of PF driver of a VF setup_q request (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support statistics collection for VFs by the PF (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support of PF driver of a VF init request (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support of PF driver of a VF acquire request (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Infrastructure for VF <-> PF request on PF side (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Prepare device and initialize VF database (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Allocate VF database in PF when VFs are present (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: VF fastpath (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support ndo_set_rxmode in VF driver (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add teardown_q and close to VF <-> PF channel (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add init, setup_q, set_mac to VF <-> PF channel (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Separate VF and PF logic (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add to VF <-> PF channel the release request (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: VF <-> PF channel 'acquire' at vf probe (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support probing and removing of VF device (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: use ARRAY_SIZE where possible (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: use prandom_bytes() (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix typo of "suport" (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: almost 'use netdev_alloc_frag()' (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix up function prototypes after __dev* removals (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Simplify cnic probing (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: add fw defs for use in cnic (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] cnic, bnx2x, bnx2: Simplify cnic probing (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] cnic: Include bnx2x.h (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2: Add BNX2 prefix to CHIP ID and name macros (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2: Add BNX2 prefix to descriptor structures and macros (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] cnic: Fix rare race condition during iSCSI disconnect (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] cnic: Reset iSCSI EQ during shutdown (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: remove __dev* attributes (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] cnic: remove __dev* attributes (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: recognize fan failure (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Correct PFC disablement (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix 'Ethtool -A' when autoneg (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: prevent DCB if disabled in nvram (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Handle a rarely missed interrupt (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: mask CPL_OF interrupt (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: IGU parse error cause probe failure (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Ext config accessed only on non-E1x (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: nvram enables dropless flow control (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Correct advertised speed/duplex (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Filter packets on FCoE rings (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Management can control PFC/ETS (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: parity recovery flow enhancement (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: revised and corrected SPIO access (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Change duplex setting in EEE function (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add warning message in case of non-10G SFP module (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Cosmetic changes (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Always take PHY lock (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add support for BCM84834 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix SFP+ current leakage (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add support for 20G-KR2 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Remove duplicate inclusion of bnx2x_hsi.h (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Add static declaration to several functions (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Fix typo in bnx2x driver (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix HW initialization using fw 7.8.x (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Support loading cnic resources at run-time (Michal Schmidt) [825729 828818 915420 915422 915517 919510 920624] - [netdrv] bnx2x: HSI change for 'update' ramrod (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: update version to 1.78.00-0 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x,cnic: use FW 7.8.2 (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: Improve code around bnx2x_tests_str_arr (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [netdrv] bnx2x: fix comment/printk/variable typos (Michal Schmidt) [825729 828818 915420 915422 915517 919510] - [net] In unregister_netdevice_notifier unregister the netdevices (Michal Schmidt) [987451] - [net] introduce NAPI_POLL_WEIGHT (Michal Schmidt) [987451] - [net] Export __netdev_pick_tx so that it can be used in modules (Michal Schmidt) [987451] - [net] Split core bits of netdev_pick_tx into __netdev_pick_tx (Michal Schmidt) [987451] - [net] netpoll: call ->ndo_select_queue() in tx path (Michal Schmidt) [987451] - [lib] introduce prandom_bytes() and prandom_bytes_state() (Michal Schmidt) [987451]- [pci] pcie: Reset link for devices below Root Port or Downstream Port (Myron Stowe) [966755] - [acpi] apei: Force fatal AER severity when component has been reset (Myron Stowe) [966755] - [pci] Remove "extern" from function declarations (Myron Stowe) [966755] - [pci] pcie: Move AER severity defines to aer.h (Myron Stowe) [966755] - [pci] pcie: Set dev->__aer_firmware_first only for matching devices (Myron Stowe) [966755] - [pci] pcie: Factor out HEST device type matching (Myron Stowe) [966755] - [pci] pcie: Don't parse HEST table for non-PCIe devices (Myron Stowe) [966755] - [acpi] Move cper_print_aer() call out of interrupt context (Myron Stowe) [967981] - [pci] pcie: Remove local PCI_BUS() define and use PCI_BUS_NUM() from PCI (Myron Stowe) [967981] - [pci] Add PCI_BUS_NUM() and PCI_DEVID() interfaces (Myron Stowe) [967981] - [pci] pcie: pci_get_domain_bus_and_slot() call missing required pci_dev_put() (Myron Stowe) [911740] - [pci] pcie: Report success only when every device has AER-aware driver (Myron Stowe) [911740] - [pci] Fix deadlock when unbinding device if parent in D3cold (Myron Stowe) [911740] - [pci] Make pci_error_handlers const (Myron Stowe) [911740] - [pci] pcie: Remove the port driver module exit routine (Myron Stowe) [911740] - [acpi] apei: Add missed ACPI5 support for error trigger table (Myron Stowe) [893388] - [acpi] apei: fix error status check condition for CPER (Myron Stowe) [825641] - [edac] add support for error type "Info" (Myron Stowe) [825641] - [pci] pcie: Cleanup log output for AER (Myron Stowe) [825641] - [acpi] apei: Enhanced AER logging (Myron Stowe) [825641] - [trace] Trace Event for PCI Express Advanced Error Reporting (Myron Stowe) [825641] - [acpi] edac.h: Add generic layers for describing a memory location (Myron Stowe) [825641] - [acpi] CPER failed to handle generic error records with multiple sections (Myron Stowe) [816520] - [acpi] APEI build fix (Myron Stowe) [816520] - [acpi] apei: Fix crash in apei_hest_parse() for acpi=off (Myron Stowe) [816515] - [acpi] apei: Fixup incorrect 64-bit access width firmware bug (Myron Stowe) [816515] - [acpi] apei: Fix ERST header length check (Myron Stowe) [816515] - [acpi] apei: Remove table not found message (Myron Stowe) [816515] - [pci] Print completion message at KERN_INFO to match starting message (Myron Stowe) [736984] - [acpi] Add PCIe AER recovery support (Myron Stowe) [736984] - [pci] pcie: add aer_recover_queue (Myron Stowe) [736984] - [netdrv] be2net: fix VLAN traffic if no VLAN group is registered (Stefan Assmann) [980772] - [wireless] brcmsmac: Reduce log spam in heavy tx, make err print in debug (John Green) [960977] - [watchdog] hpwdt: Increase version string (Linda Knippers) [985144] - [watchdog] hpwdt: Add check for UEFI bits (Linda Knippers) [985144] - [netdrv] be2net: Fix to avoid hardware workaround when not needed (Ivan Vecera) [947543] - [netdrv] be2net: use pci_vfs_assigned()/pci_num_vf() instead of be_find_vfs() (Ivan Vecera) [947543] - [netdrv] be2net: Fix 32-bit DMA Mask handling (Ivan Vecera) [947543] - [netdrv] be2net: Implement initiate FW dump feature for Lancer (Ivan Vecera) [947543] - [netdrv] be2net: Fix crash on 2nd invocation of PCI AER/EEH error_detected hook (Ivan Vecera) [947543] - [netdrv] be2net: Mark checksum fail for IP fragmented packets (Ivan Vecera) [947543] - [netdrv] be2net: Trim padded packets for Lancer (Ivan Vecera) [947543] - [netdrv] be2net: Pad skb to meet min Tx pkt size in lancer (Ivan Vecera) [947543] - [netdrv] be2net: cleanup be_get_drvinfo() (Ivan Vecera) [947543] - [netdrv] be2net: refactor HW workarounds in be_xmit() (Ivan Vecera) [947543] - [netdrv] be2net: bug fix on returning an invalid nic descriptor (Ivan Vecera) [947543] - [netdrv] be2net: Avoid double insertion of vlan tags (Ivan Vecera) [947543] - [netdrv] be2net: disable TX in be_close() (Ivan Vecera) [947543] - [netdrv] be2net: fix EQ from getting full while cleaning RX CQ (Ivan Vecera) [947543] - [netdrv] be2net: fix payload_len value for GET_MAC_LIST cmd req (Ivan Vecera) [947543] - [netdrv] be2net: provision VF resources before enabling SR-IOV (Ivan Vecera) [947543] - [netdrv] be2net: Fix to fail probe if MSI-X enable fails for a VF (Ivan Vecera) [947543] - [netdrv] be2net: avoid napi_disable() when it has not been enabled (Ivan Vecera) [947543] - [netdrv] be2net: Fix firmware download for Lancer (Ivan Vecera) [947543] - [netdrv] be2net: Fix to receive Multicast Packets when Promiscuous mode is enabled on certain devices (Ivan Vecera) [947543] - [netdrv] be2net: Fix to show tx priority pause counter in ethtool -S (Ivan Vecera) [947543] - [netdrv] be2net: Fix to use 32-bit stats to report rx_drops_no_fragment (Ivan Vecera) [947543] - [netdrv] be2net: Fix to use version 2 of cq_create for SkyHawk-R devices (Ivan Vecera) [947543] - [netdrv] be2net: FLR must be first cmd issued to Lancer FW (Ivan Vecera) [947543] - [netdrv] be2net: Use GET_FUNCTION_CONFIG V1 cmd (Ivan Vecera) [947543] - [netdrv] be2net: Fix to show wol disabled/enabled state correctly (Ivan Vecera) [947543] - [netdrv] be2net: Fixed memory leak (Ivan Vecera) [947543] - [netdrv] be2net: Avoid diagnostic test in certain versions of firmware to avoid NIC freeze (Ivan Vecera) [947543] - [netdrv] be2net: Renamed rx_address_mismatch_errors to rx_address_filtered (Ivan Vecera) [947543] - [netdrv] be2net: Add support for setting and getting rx flow hash options (Ivan Vecera) [947543] - [netdrv] be2net: Fix PVID tag offload for packets with inline VLAN tag (Ivan Vecera) [947543] - [netdrv] be2net: fix a Tx stall bug caused by a specific ipv6 packet (Ivan Vecera) [947543] - [netdrv] be2net: Remove an incorrect pvid check in Tx (Ivan Vecera) [947543] - [netdrv] be2net: enable IOMMU pass through for be2net (Ivan Vecera) [819453 947543] - [netdrv] be2net: Use GET_PROFILE_CONFIG V1 cmd for BE3-R (Ivan Vecera) [947543] - [netdrv] be2net: Avoid flashing BE3 UFI on BE3-R chip (Ivan Vecera) [947543] - [netdrv] be2net: Don't log "Out of MCCQ wrbs" error (Ivan Vecera) [947543] - [netdrv] be2net: Use TXQ_CREATE_V2 cmd (Ivan Vecera) [947543] - [netdrv] be2net: take care of __vlan_put_tag return value (Ivan Vecera) [947543] - [netdrv] be2net: remove unused variable 'sge' (Ivan Vecera) [947543] - [netdrv] be2net: dma_alloc_coherent: use __GFP_ZERO instead of memset() (Ivan Vecera) [947543] - [netdrv] be2net: Remove dma_alloc_coherent OOM messages (Ivan Vecera) [947543] - [netdrv] be2net: Use new F/W mailbox cmd to manipulate interrupts (Ivan Vecera) [947543] - [netdrv] be2net: enable interrupts in be_probe() (RoCE and other ULPs need them) (Ivan Vecera) [947543] - [netdrv] be2net: Update copyright year (Ivan Vecera) [947543] - [netdrv] be2net: use CSR-BAR SEMAPHORE reg for BE2/BE3 (Ivan Vecera) [947543] - [netdrv] benet: Wait f/w POST until timeout (Ivan Vecera) [947543] - [netdrv] be2net: update driver version to 4.6.x (Ivan Vecera) [947543] - [netdrv] be2net: fix re-loaded PF driver to re-gain control of its VFs (Ivan Vecera) [947543] - [netdrv] be2net: Updating Module Author string and log message string to "Emulex Corporation" (Ivan Vecera) [947543] - [netdrv] be2net: fix drvinfo strings set in drivers (Ivan Vecera) [947543] - [netdrv] be2net: Remove bogus dependencies on INET (Ivan Vecera) [947543] - [netdrv] be2net: remove adapter->eq_next_idx (Ivan Vecera) [947543] - [netdrv] be2net: remove roce on lancer (Ivan Vecera) [947543] - [netdrv] be2net: fix access to SEMAPHORE reg (Ivan Vecera) [947543] - [netdrv] be2net: re-factor bar mapping code (Ivan Vecera) [947543] - [netdrv] be2net: do not use sli_family to identify skyhawk-R chip (Ivan Vecera) [947543] - [netdrv] be2net: fix wrong usage of adapter->generation (Ivan Vecera) [947543] - [netdrv] be2net: remove LANCER A0 workaround (Ivan Vecera) [947543] - [netdrv] be2net: Fix smatch warnings in be_main.c (Ivan Vecera) [947543] - [netdrv] be2net: fix wrong frag_idx reported by RX CQ (Ivan Vecera) [947543] - [netdrv] benet: convert to set_phys_id (Ivan Vecera) [947543] - [virt] hv: allocate synic structures before hv_synic_init() (Jason Wang) [927359] - [virt] hv: check interrupt mask before read_index (Jason Wang) [927359] - [virt] hv: switch to use mb() instead of smp_mb() (Jason Wang) [927359] - [virt] hv: vmbus: Implement multi-channel support (Jason Wang) [927359] - [virt] hv: Fix a bug in get_vp_index() (Jason Wang) [927359] - [virt] hyperv_fb: Backport to RHEL 6.5 (Jason Wang) [927424] - [virt] add Hyper-V Synthetic Video Frame Buffer Driver (Jason Wang) [927424] - [virt] hv: Add a new driver to support host initiated backup (Jason Wang) [927409] - [netdrv] hyperv: Fix a compiler warning in netvsc_send() (Jason Wang) [927435] - [netdrv] hyperv: Fix RNDIS send_completion code path (Jason Wang) [927435] - [netdrv] hyperv: Fix a kernel warning from netvsc_linkstatus_callback() (Jason Wang) [927435] - [netdrv] hyperv: fix wrong length of mac address (Jason Wang) [927435] - [netdrv] hyperv: Add an error message to rndis_filter_set_device_mac() (Jason Wang) [927435] - [netdrv] hyperv: Remove unnecessary comments in rndis_filter_receive_data() (Jason Wang) [927435] - [netdrv] hyperv: Add buffer for extended info after the RNDIS response message (Jason Wang) [927435] - [netdrv] hyperv: Report actual status in receive completion packet (Jason Wang) [927435] - [netdrv] hyperv: Remove extra allocated space for recv_pkt_list elements (Jason Wang) [927435] - [netdrv] hyperv: Fix page buffer handling in rndis_filter_send_request() (Jason Wang) [927435] - [netdrv] hyperv: Fix the missing return value in rndis_filter_set_packet_filter() (Jason Wang) [927435] - [netdrv] hyperv: Fix the max_xfer_size in RNDIS initialization (Jason Wang) [927435] - [virt] hyperv/hv_balloon: remove old RHEL6 specific code (Jason Wang) [927417] - [virt] hyperv/balloon: Notify the host of permanent hot-add failures (Jason Wang) [927417] - [virt] hyperv/balloon: Support 2M page allocations for ballooning (Jason Wang) [927417] - [mm] page_alloc: export split_page() (Jason Wang) [927417] - [virt] hyperv/balloon: Permit Linux to specify hot-add alignment requirements (Jason Wang) [927417] - [virt] hyperv/balloon: make local functions static (Jason Wang) [927417] - [virt] hyperv/balloon: Implement hot-add functionality (Jason Wang) [927417] - [mm] memory_hotplug: extend memory hotplug API to allow memory hotplug in virtual machines (Jason Wang) [927417] - [virt] hyperv/balloon: Make the balloon driver not unloadable (Jason Wang) [927417] - [virt] hyperv/balloon: Execute hot-add code in a separate context (Jason Wang) [927417] - [virt] hyperv/balloon: Execute balloon inflation in a separate context (Jason Wang) [927417] - [virt] hyperv/balloon: Do not request completion notification (Jason Wang) [927417] - [fcoe] libfc: extend ex_lock to protect all of fc_seq_send (Neil Horman) [829784] - [fcoe] libfc: Correct check for initiator role (Neil Horman) [829784] - [fcoe] libfcoe: Fix fcoe_sysfs VN2VN mode (Neil Horman) [829784] - [fcoe] Split fc_disc_init into fc_disc_init and fc_disc_config (Neil Horman) [829784] - [fcoe] Always use fcoe_disc_init for discovery layer initialization (Neil Horman) [829784] - [fcoe] Fix deadlock between create and destroy paths (Neil Horman) [829784] - [fcoe] libfcoe: Fix Conflicting FCFs issue in the fabric (Neil Horman) [829784] - [fcoe] Revert "fcoe: fix fcoe enable on link toggle while it is still disabled" (Neil Horman) [829784] - [fcoe] libfcoe: Check for unusable FCFs before looking for conflicting FCFs (Neil Horman) [829784] - [fcoe] libfcoe: Handle CVL while waiting to select an FCF (Neil Horman) [829784] - [fcoe] Fix deadlock while deleting FCoE interface with NPIV ports (Neil Horman) [829784] - [fcoe] close race on link speed detection in fcoe code (Neil Horman) [829784] - [fcoe] debris left by "libfcoe: Remove mutex_trylock/restart_syscall checks" (Neil Horman) [829784] - [fcoe] consolidate the fcoe_ctlr_get_lesb/fcoe_get_lesb (Neil Horman) [829784] - [fcoe] move fcoe_link_speed_update() to libfcoe and export it (Neil Horman) [829784] - [fcoe] add support to the get_netdev() for fcoe_interface (Neil Horman) [829784] - [fcoe] prep work to start consolidate the usage of fcoe_netdev (Neil Horman) [829784] - [fcoe] Convert debug_logging macros to pr_info (Neil Horman) [829784] - [fcoe] Use the fcoe_sysfs control interface (Neil Horman) [829784] - [fcoe] libfcoe: Add new fcoe control interface (Neil Horman) [829784] - [fcoe] libfcoe: Save some memory and optimize name lookups (Neil Horman) [829784] - [fcoe] libfcoe: Add fcoe_sysfs debug logging level (Neil Horman) [829784] - [fcoe] Cleanup locking on fcoe_percpu_receive_thread (Neil Horman) [829784] - [fcoe] libfcoe: Fix section mismatch (Neil Horman) [829784] - [fcoe] bnx2fc: cleanup fcoe_dev_stats (Neil Horman) [829784] - [fcoe] libfcoe: SW FCoE and bnx2fc use FCoE Syfs (Neil Horman) [829784] - [fcoe] libfcoe: Add fcoe_sysfs (Neil Horman) [829784] - [powerpc] iommu: Fix multiple issues with IOMMU pools code (Steve Best) [929290] - [powerpc] iommu: Fix iommu pool initialization (Steve Best) [929290] - [powerpc] iommu: Implement IOMMU pools to improve multiqueue adapter performance (Steve Best) [929290] - [powerpc] iommu: Push spinlock into iommu_range_alloc and __iommu_free (Steve Best) [929290] - [powerpc] iommu: Reduce spinlock coverage in iommu_free (Steve Best) [929290] - [powerpc] iommu: Reduce spinlock coverage in iommu_alloc and iommu_free (Steve Best) [929290] - [powerpc] pseries: Disable interrupts around IOMMU percpu data accesses (Steve Best) [929290] - [block] rsxx: Adding in debugfs entries (Steve Best) [929277] - [block] rsxx: Fixes incorrect stats calculation (Steve Best) [929277] - [block] rsxx: Adding EEH check inside cregs timeout (Steve Best) [929277] - [block] rsxx: Adapter address space sanity check (Steve Best) [929277] - [block] rsxx: Fixes DLPAR add kernel panic if partition still mounted (Steve Best) [929277] - [block] rsxx: Changing the adapter name to the official name (Steve Best) [929277] - [block] rsxx: Adding in sync_start module paramenter (Steve Best) [929277] - [block] rsxx: Allow block size to be determined by configuration (Steve Best) [929277] - [block] rsxx: Fixes soft-lockup issues during DMAs (Steve Best) [929277] - [block] rsxx: Restructured DMA cancel scheme (Steve Best) [929277] - [block] rsxx: Individual workqueues for interruptible events (Steve Best) [929277] - [block] rsxx: remove unused variable (Steve Best) [929277] - [block] rsxx: enable error return of rsxx_eeh_save_issued_dmas() (Steve Best) [929277] - [block] rsxx: removes dynamic allocation on stack (Steve Best) [929277] - [block] rsxx: fix missing unlock on error return in rsxx_eeh_remap_dmas() (Steve Best) [929277] - [block] rsxx: Adding in EEH support to the IBM FlashSystem 70/80 device driver (Steve Best) [929277] - [block] rsxx: IBM RamSan 70/80 error message bug fix (Steve Best) [929277] - [block] rsxx: IBM RamSan 70/80 branding changes (Steve Best) [929277] - [block] rsxx: IBM RamSan 70/80 fixes inconsistent locking (Steve Best) [929277] - [block] rsxx: IBM RamSan 70/80 trivial changes (Steve Best) [929277] - [block] rsxx: IBM RamSan 70/80 driver fixes (Steve Best) [929277] - [block] rsxx: add slab.h include to dma.c (Steve Best) [929277] - [block] rsxx: IBM RamSan 70/80 device driver (Steve Best) [929277] - [target] target/file: Fix off-by-one READ_CAPACITY bug for !S_ISBLK export (Andy Grover) [982777] - [target] Re-instate sess_wait_list for target_wait_for_sess_cmds (Andy Grover) [982777] - [target] close target_put_sess_cmd() vs. core_tmr_abort_task() race (Andy Grover) [982777] - [target] iblock: Fix WCE=1 + DPOFUA=1 backend WRITE regression (Andy Grover) [982777] - [target] Use FD_MAX_SECTORS/FD_BLOCKSIZE for blockdevs using fileio (Andy Grover) [982777] - [target] tcm_fc: Check for aborted sequence (Andy Grover) [982777] - [target] Change default sense key of NOT_READY (Andy Grover) [982777]- [netdrv] qlcnic: Bump up the version to 5.1.38 (Chad Dupuis) [694104] - [netdrv] qlcnic: Clear link status when interface is down (Chad Dupuis) [694104] - [netdrv] qlcnic: change mdelay to msleep (Chad Dupuis) [694104] - [netdrv] qlcnic: Log warning message for 83xx adapter in MSI mode (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix configure mailbox interrupt command for 83xx adapter (Chad Dupuis) [694104] - [netdrv] qlcnic: Bump up the version to 5.1.37 (Chad Dupuis) [694104] - [netdrv] qlcnic: Implement flash sysfs callback for 83xx adapter (Chad Dupuis) [694104] - [netdrv] qlcnic: remove duplicated include from qlcnic_sysfs.c (Chad Dupuis) [694104] - [netdrv] qlcnic: Bump up the version to 5.1.36 (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix ethtool statistics collection (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix ethtool statistics for 82xx adapter (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix endian issues in 83xx driver (Chad Dupuis) [694104] - [netdrv] qlcnic: Bump up the version to 5.1.35 (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix configure interrupts for 83xx adapter types (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix internal loopback test for 82xx adapter (Chad Dupuis) [694104] - [netdrv] qlcnic: Bump up the version to 5.1.34 (Chad Dupuis) [694104] - [netdrv] qlcnic: fix ping resumption to a VM after a live migration (Chad Dupuis) [694104] - [netdrv] qlcnic: fix estimation of receive MSS in case of LRO for 83xx adapter (Chad Dupuis) [694104] - [netdrv] qlcnic: refactor Legacy interrupt handling for 83xx (Chad Dupuis) [694104] - [netdrv] qlcnic: fix mailbox interrupt (Chad Dupuis) [694104] - [netdrv] qlcnic: fix unsupported CDRP command error message (Chad Dupuis) [694104] - [netdrv] qlcnic: fix mailbox response handling (Chad Dupuis) [694104] - [netdrv] qlcnic: enhance MSIX allocation failure log message (Chad Dupuis) [694104] - [netdrv] qlcnic: fix async event handling during diagnostic loopback test (Chad Dupuis) [694104] - [netdrv] qlcnic: refactor 83xx diagnostic IRQ test (Chad Dupuis) [694104] - [netdrv] qlcnic: refactor 83xx diagnostic loopback test (Chad Dupuis) [694104] - [netdrv] qlcnic: helper routine to handle async events (Chad Dupuis) [694104] - [netdrv] qlcnic: fix firmware based IDC participation (Chad Dupuis) [694104] - [netdrv] qlcnic: fix initialize NIC mailbox command (Chad Dupuis) [694104] - [netdrv] qlcnic: Updating copyright information (Chad Dupuis) [694104] - [netdrv] qlcnic: silence false positive overflow warning (Chad Dupuis) [694104] - [netdrv] qlcnic: Bump up the version to 5.1.33 (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix minidump in NPAR mode (Chad Dupuis) [694104] - [netdrv] qlcnic: driver LRO bug fix (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix bug in reading HW reset template (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix sparse check endian warnings (Chad Dupuis) [694104] - [netdrv] qlcnic: Bump up the version to 5.1.32 (Chad Dupuis) [694104] - [netdrv] qlcnic: sleeping function called from invalid context (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix LED/Beaconing tests to work on all ports of an adapter (Chad Dupuis) [694104] - [netdrv] qlcnic: avoid mixed mode interrupts for some adapter types (Chad Dupuis) [694104] - [netdrv] qlcnic: enable RSS for TCP over IPv6 (Chad Dupuis) [694104] - [netdrv] qlcnic: enable LRO on IPv6 without dest ip check (Chad Dupuis) [694104] - [netdrv] qlcnic: set driver version in firmware (Chad Dupuis) [694104] - [netdrv] qlcnic: guard __vlan_find_dev_deep() by rcu_read_lock (Chad Dupuis) [694104] - [netdrv] qlcnic: fix build error (Chad Dupuis) [694104] - [netdrv] qlcnic: do not duplicate infrastructure functions (Chad Dupuis) [694104] - [netdrv] qlcnic: update driver version (Chad Dupuis) [694104] - [netdrv] qlcnic: remove unused definitions from header file (Chad Dupuis) [694104] - [netdrv] qlcnic: 83xx ethtool interface routines (Chad Dupuis) [694104] - [netdrv] qlcnic: 83xx register dump routines (Chad Dupuis) [694104] - [netdrv] qlcnic: enable 83xx virtual NIC mode (Chad Dupuis) [694104] - [netdrv] qlcnic: flash template based firmware reset recovery (Chad Dupuis) [694104] - [netdrv] qlcnic: 83xx CNA inter driver communication mechanism (Chad Dupuis) [694104] - [netdrv] qlcnic: 83xx adpater flash interface routines (Chad Dupuis) [694104] - [netdrv] qlcnic: 83xx sysfs routines (Chad Dupuis) [694104] - [netdrv] qlcnic: 83xx base driver (Chad Dupuis) [694104] - [netdrv] qlcnic: 83xx data path routines (Chad Dupuis) [694104] - [netdrv] qlcnic: 83xx memory map and HW access routines (Chad Dupuis) [694104] - [netdrv] qlcnic: macros for common register access (Chad Dupuis) [694104] - [netdrv] qlcnic: change driver hardware interface mechanism (Chad Dupuis) [694104] - [netdrv] qlcnic: update driver version (Chad Dupuis) [694104] - [netdrv] qlcnic: fix unused variable warnings (Chad Dupuis) [694104] - [netdrv] qlcnic: rename module params with module_param_named (Chad Dupuis) [694104] - [netdrv] qlcnic: fix bug in LRO descriptor access macro (Chad Dupuis) [694104] - [netdrv] qlcnic: update NIC partition interface routines (Chad Dupuis) [694104] - [netdrv] qlcnic: get board name API (Chad Dupuis) [694104] - [netdrv] qlcnic: modify PCI and register access routines (Chad Dupuis) [694104] - [netdrv] qlcnic: move HW specific data to seperate structure (Chad Dupuis) [694104] - [netdrv] qlcnic: add 82xx adapter specific checks (Chad Dupuis) [694104] - [netdrv] qlcnic: remove __dev* attributes (Chad Dupuis) [694104] - [netdrv] qlcnic: remove duplicated include from qlcnic_sysfs.c (Chad Dupuis) [694104] - [netdrv] qlcnic: fix coding style issues in qlcnic_minidump.c (Chad Dupuis) [694104] - [netdrv] qlcnic: create file qlcnic_minidump.c for dump utility (Chad Dupuis) [694104] - [netdrv] qlcnic: fix style issues in qlcnic_sysfs.c file (Chad Dupuis) [694104] - [netdrv] qlcnic: create file qlcnic_sysfs.c for sysfs routines (Chad Dupuis) [694104] - [netdrv] qlcnic: fix coding style issues in qlcnic_io.c (Chad Dupuis) [694104] - [netdrv] qlcnic: create file qlcnic_io.c for datapath routines (Chad Dupuis) [694104] - [netdrv] qlcnic: fix sparse check endian warnings (Chad Dupuis) [694104] - [netdrv] qlcnic: fix sparse warnings (Chad Dupuis) [694104] - [netdrv] qlcnic: fix compiler warnings (Chad Dupuis) [694104] - [netdrv] qlcnic: fix error return code (Chad Dupuis) [694104] - [netdrv] qlcnic: Fix scheduling while atomic bug (Chad Dupuis) [694104] - [virt] kvm: Fix iommu map/unmap to handle memory slot moves (Alex Williamson) [978472] - [virt] kvm: perform an invalid memslot step for gpa base change (Alex Williamson) [978472] - [video] vgacon: add cond reschedule points in vgacon_do_font_op (Marcelo Tosatti) [971311] - [kernel] tracing: Format non-nanosec times from tsc clock without a decimal point (Marcelo Tosatti) [911564] - [kernel] tracing: Add a TSC trace_clock (Marcelo Tosatti) [911564] - [perf] kvm: Initialize file_name var to fix segfault (Jiri Olsa) [977969] - [perf] kvm: Add braces around multi-line statements (Jiri Olsa) [977969] - [perf] kvm: Total count is a u64, print as so (Jiri Olsa) [977969] - [perf] kvm: Remove typecast in init_kvm_event_record (Jiri Olsa) [977969] - [perf] kvm: Only process events for vcpus of interest (Jiri Olsa) [977969] - [perf] kvm: Fix building perf kvm on non x86 arches (Jiri Olsa) [977969] - [perf] kvm: Rename perf_kvm to perf_kvm_stat (Jiri Olsa) [977969] - [perf] kvm: Move global variables into a perf_kvm struct (Jiri Olsa) [977969] - [perf] kvm: Use perf_evsel__intval (Jiri Olsa) [977969] - [perf] kvm: Events analysis tool (Jiri Olsa) [977969] - [perf] Check proper prev_state size for sched_switch tp (Jiri Olsa) [984006] - [perf] Revert "perf sched: Handle PERF_RECORD_EXIT events" (Jiri Olsa) [984006] - [perf] Fix breakage introduced by the test_attr infrastructure (Jiri Olsa) [984006] - [block] mtip32xx: Fix compile warning (David Milburn) [927436] - [block] mtip32xx: Workaround for unaligned writes (David Milburn) [927436] - [block] mtip32xx: Disable TRIM support (David Milburn) [927436] - [block] mtip32xx: fix a smatch warning (David Milburn) [927436] - [block] mtip32xx: fix two smatch warnings (David Milburn) [927436] - [block] mtip32xx: Add debugfs entry device_status (David Milburn) [927436] - [block] mtip32xx: return 0 from pci probe in case of rebuild (David Milburn) [927436] - [block] mtip32xx: recovery from command timeout (David Milburn) [927436] - [block] mtip32xx: fix error return code in mtip_pci_probe() (David Milburn) [927436] - [block] mtip32xx: add missing GENERIC_HARDIRQS dependency (David Milburn) [927436] - [block] mtip32xx: fix sparse warning, symbol 'mtip_send_trim' was not declared (David Milburn) [927436] - [block] mtip32xx: add trim support (David Milburn) [927436] - [block] mtip32xx: fix for crash when the device surprise removed during rebuild (David Milburn) [927436] - [block] mtip32xx: fix for driver hang after a command timeout (David Milburn) [927436] - [block] mtip32xx: Fix padding issue (David Milburn) [927436] - [block] mtip32xx: fix potential NULL pointer dereference in mtip_timeout_function() (David Milburn) [927436] - [block] mtip32xx: fix shift larger than type warning (David Milburn) [927436] - [block] mtip32xx: Fix incorrect mask used for erase mode (David Milburn) [927436] - [block] mtip32xx: Fix to make lba address correct in big-endian systems (David Milburn) [927436] - [block] mtip32xx: fix potential crash on SEC_ERASE_UNIT (David Milburn) [927436] - [block] mtip32xx: Added appropriate timeout value for secure erase (David Milburn) [927436] - [block] mtip32xx: Remove dead code (David Milburn) [927436] - [block] mtip32xx: Change printk to pr_xxxx (David Milburn) [927436] - [block] mtip32xx: Proper reporting of write protect status on big-endian (David Milburn) [927436] - [block] mtip32xx: Increase timeout for standby command (David Milburn) [927436] - [block] mtip32xx: Handle NCQ commands during the security locked state (David Milburn) [927436] - [block] mtip32xx: Add support for new devices (David Milburn) [927436] - [block] mtip32xx: Create debugfs entries for troubleshooting (David Milburn) [927436] - [block] mtip32xx: Remove version.h header file inclusion (David Milburn) [927436] - [scsi] ipr: Avoid target_destroy accessing memory after it was freed (Steve Best) [929279] - [scsi] Handle MLQUEUE busy response in scsi_send_eh_cmnd (Steve Best) [929279] - [scsi] ipr: SATA DVD probing failed with 64bit adapter (Steve Best) [929279] - [scsi] ipr: Need to reset adapter after the 6th EEH error (Steve Best) [929279] - [scsi] ipr: Need to reset adapter after the 6th EEH error (Steve Best) [929279] - [scsi] ipr: fix addition of abort command to HRRQ free queue (Steve Best) [929279] - [scsi] ipr: ipr_test_msi() fails when running with msi-x enabled adapter (Steve Best) [929279] - [scsi] ipr: Fix oops while resetting an ipr adapter (Steve Best) [929279] - [scsi] ipr: Fix sparse error in ipr driver (Steve Best) [929279] - [scsi] ipr: Driver version 2.6.0 (Steve Best) [929279] - [scsi] ipr: Implement block iopoll (Steve Best) [929279] - [scsi] ipr: Reduce lock contention (Steve Best) [929279] - [scsi] ipr: Add support for MSI-X and distributed completion (Steve Best) [929279] - [scsi] ipr: Resource path error logging cleanup (Steve Best) [929279] - [scsi] ipr: Handler ID memory allocation failure at module load time (Steve Best) [929279] - [scsi] ipr: Add several new CCIN definitions for new adapters support (Steve Best) [929279] - [scsi] storvsc: avoid usage of WRITE_SAME (Jason Wang) [969541] - [scsi] storvsc: Handle dynamic resizing of the device (Jason Wang) [927414] - [scsi] storvsc: Restructure error handling code on command completion (Jason Wang) [927414] - [scsi] storvsc: Initialize the sglist (Jason Wang) [969545] - [input] alps: add "Dolphin V1" touchpad support (Aristeu Rozanski) [837091] - [input] alps: remove unused argument to alps_enter_command_mode() (Aristeu Rozanski) [837091] - [input] alps: enable trackstick on Rushmore touchpads (Aristeu Rozanski) [837091] - [input] alps: add support for "Rushmore" touchpads (Aristeu Rozanski) [837091] - [input] alps: make the V3 packet field decoder "pluggable" (Aristeu Rozanski) [837091] - [input] alps: move pixel and bitmap info into alps_data struct (Aristeu Rozanski) [837091] - [input] alps: fix command mode check (Aristeu Rozanski) [837091] - [input] alps: rework detection of Pinnacle AGx touchpads (Aristeu Rozanski) [837091] - [input] alps: move addr_command, nibble_command settings into alps_set_defaults() (Aristeu Rozanski) [837091] - [input] alps: use function pointers for different protocol handlers (Aristeu Rozanski) [837091] - [input] alps: rework detection sequence (Aristeu Rozanski) [837091] - [input] alps: introduce helper function for repeated commands (Aristeu Rozanski) [837091] - [input] alps: move alps_get_model() down below hw_init code (Aristeu Rozanski) [837091] - [input] alps: copy "model" info into alps_data struct (Aristeu Rozanski) [837091] - [input] alps: fix touchpad detection when buttons are pressed (Aristeu Rozanski) [837091] - [virt] hyperv: Handle Xen emulation of Hyper-V more gracefully (Jason Wang) [927359] - [virt] hyperv/vmbus: Handle channel rescind message correctly (Jason Wang) [927359] - [virt] hyperv/vmbus: Fix a bug in hv_need_to_signal() (Jason Wang) [927359] - [virt] hyperv: remove cast for kmalloc return value (Jason Wang) [927359] - [virt] hyperv/vmbus: Use the new infrastructure for delivering VMBUS interrupts (Jason Wang) [927359] - [virt] hyperv: Handle Hyper-V vmbus interrupts as special hypervisor interrupts (Jason Wang) [927359] - [virt] hyperv/hv_balloon: Prevent the host from ballooning the guest too low (Jason Wang) [927359] - [virt] hyperv/hv_balloon: Add a parameter to delay pressure reporting (Jason Wang) [927359] - [virt] hyperv: Execute shutdown in a thread context (Jason Wang) [927359] - [virt] hyperv/hid-hyperv: Use consolidated GUID definitions (Jason Wang) [927359] - [virt] hyperv/storvsc: Use the consolidated GUID definition (Jason Wang) [927359] - [virt] hyperv/netvsc: Use the consolidated GUID definition (Jason Wang) [927359] - [virt] hyperv: Use consolidated GUID definitions (Jason Wang) [927359] - [virt] hyperv/vmbus: Consolidate all offer GUID definitions in hyperv.h (Jason Wang) [927359] - [virt] hyperv: Bind all vmbbus interrupts to the boot CPU (Jason Wang) [927359] - [virt] hyperv: vmbus_flow_handler() can be static (Jason Wang) [927359] - [virt] hyperv/hv_balloon: Fix a bug in the definition of struct dm_info_msg (Jason Wang) [927359] - [virt] hyperv: remove unused variable in vmbus_recvpacket_raw() (Jason Wang) [927359] - [virt] hyperv: Cleanup and consolidate reporting of build/version info (Jason Wang) [927359] - [virt] hyperv: Capture the host build information (Jason Wang) [927359] - [virt] hyperv: Implement flow management on the send side (Jason Wang) [927359] - [virt] hyperv: Enable protocol negotiation with win8 hosts (Jason Wang) [927359] - [virt] hyperv: Add a check to deal with spurious interrupts (Jason Wang) [927359] - [virt] hyperv: Handle vmbus interrupts concurrently on all cpus (Jason Wang) [927359] - [virt] hyperv: Manage event tasklets on per-cpu basis (Jason Wang) [927359] - [virt] hyperv: Get rid of unnecessary request for offers (Jason Wang) [927359] - [virt] hyperv: Get rid of the unused global signaling state (Jason Wang) [927359] - [virt] hyperv: Add code to distribute channel interrupt load (Jason Wang) [927359] - [virt] hyperv: Modify the interrupt handling code to support win8 and beyond (Jason Wang) [927359] - [virt] hyperv: Add state to manage incoming channel interrupt load (Jason Wang) [927359] - [virt] hyperv: Setup a mapping for Hyper-V's notion cpu ID (Jason Wang) [927359] - [virt] hyperv: Cleanup vmbus_set_event() to support win7 and beyond (Jason Wang) [927359] - [virt] hyperv: Manage signaling state on a per-connection basis (Jason Wang) [927359] - [virt] hyperv: Move vmbus version definitions to hyperv.h (Jason Wang) [927359] - [virt] hyperv: Change the signature of vmbus_set_event() (Jason Wang) [927359] - [virt] hyperv: Change the signature for hv_signal_event() (Jason Wang) [927359] - [virt] hyperv: Save and export negotiated vmbus version (Jason Wang) [927359] - [virt] hyperv: Extend/modify vmbus_channel_offer_channel for win7 and beyond (Jason Wang) [927359] - [virt] hyperv: Update the ring buffer structure to match win8 functionality (Jason Wang) [927359] - [virt] hyperv: Support handling multiple VMBUS versions (Jason Wang) [927359] - [virt] hyperv: Get rid of hv_get_ringbuffer_interrupt_mask() (Jason Wang) [927359] - [virt] hyperv: Optimize the signaling on the write path (Jason Wang) [927359] - [virt] hyperv: Optimize signaling in the read path (Jason Wang) [927359] - [virt] hyperv: Turn off batched reading for util drivers (Jason Wang) [927359] - [virt] hyperv: Add state to manage batched reading (Jason Wang) [927359] - [virt] hyperv: Implement routines for read side signaling optimization (Jason Wang) [927359] - [virt] hyperv/hv_balloon: remove duplicated include from hv_balloon.c (Jason Wang) [927359] - [virt] hyperv/hv_balloon: mark a function static (Jason Wang) [927359] - [virt] hyperv: remove unused variable from channel_mgmt.c (Jason Wang) [927359] - [usb] make the usbfs memory limit configurable (Gopal) [970457] - [powerpc] PERF_EVENT_IOC_ENABLE does not reenable event (Steve Best) [986077] - [trace] sched: Add tracepoint for accounting blocked time (Michal Schmidt) [596098] - [kernel] kexec: export PG_hwpoison flag into vmcoreinfo (Vivek Goyal) [975267] - [base] core: Don't remove kobjects in device_shutdown (Mateusz Guzik) [972831] - [s390] kernel: add support for physical memory > 4TB (Hendrik Brueckner) [913220] - [kernel] time: enable clocksource watchdog for tsc and kvm guest (Marcelo Tosatti) [873659] - [acpi] Rework acpi_get_child() to be more efficient (Tony Camuso) [907241] - [netdrv] pch_gbe: fix ip_summed checksum reporting on rx (Veaceslav Falico) [877556]- [wireless] iwlwifi: bump required firmware API version for 3160/7260 (Stanislaw Gruszka) [842846 916050] - [wireless] iwlwifi: adjust firmware D3 configuration API (Stanislaw Gruszka) [842846 916050] - [wireless] iwlwifi: support BSS only (Stanislaw Gruszka) [842846 916050] - [wireless] leds: merge net/mac80211/leds-compat.* to drivers/leds (Stanislaw Gruszka) [882300] - [wireless] Update rndis_wlan driver to compile with new wireless stack (Stanislaw Gruszka) [882300] - [wireless] Update at76c50x driver to compile with new wireless stack (Stanislaw Gruszka) [882300] - [wireless] Update adm8211 driver to compile with new wireless stack (Stanislaw Gruszka) [882300] - [wireless] Update zd1211rw driver to compile with new wireless stack (Stanislaw Gruszka) [882300] - [wireless] Update brcmsmac driver to compile with new wireless stack (Stanislaw Gruszka) [882300] - [wireless] Backport ti drivers from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport mwl8k driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport mac80211_hwsim driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport libertas_tf driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport orinoco driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport hostap driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport rtl818x driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport b43legacy driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport b43 driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport p54 driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport rt2x00 driver from linux 3.10 (Stanislaw Gruszka) [882300] - [firwmare] add htc_7010.fw and htc_9271.fw (Stanislaw Gruszka) [955782] - [firmware] add carl9170fw (Stanislaw Gruszka) [882300] - [wireless] Backport carl9170 driver from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport ath5k/ath9k drivers from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Remove iwmc3200wifi driver (Stanislaw Gruszka) [882300] - [wireless] Backport iwlegacy driver from linux 3.10 (Stanislaw Gruszka) [882300] - [firmware] iwlwifi: add firmware for 7260 / 3160 devices (Stanislaw Gruszka) [842847 916051] - [wireless] Backport iwlwifi driver from linux 3.10 (Stanislaw Gruszka) [842846 882300 916050 954239] - [net] Backport mac80211 from linux 3.10 (Stanislaw Gruszka) [882300] - [wireless] Backport wireless core from linux 3.10 (Stanislaw Gruszka) [882300] - [net] export unregister_netdevice_many symbol (Stanislaw Gruszka) [882300] - [kernel] driver core: add module_platform_driver (Stanislaw Gruszka) [882300] - [pcmcia] introduce helper for pcmcia_driver module boilerplate (Stanislaw Gruszka) [882300] - [net] add GENLMSG_DEFAULT_SIZE to RHEL6 (Stanislaw Gruszka) [882300] - [fs] procfs: add PDE_DATA (Stanislaw Gruszka) [882300] - [netdrv] add netdev_continue_rcu (Stanislaw Gruszka) [882300] - [kernel] driver core: create lock/unlock functions for struct device (Stanislaw Gruszka) [882300] - [input] add KEY_WPS_BUTTON definition (Stanislaw Gruszka) [882300] - [pci] add PCI_EXP_LNKCTL_ASPM_L1 and PCI_EXP_LNKCTL_ASPM_L0S (Stanislaw Gruszka) [882300] - [net] add mac_pton() (Stanislaw Gruszka) [882300] - [net] etherdevice.h: Add is_unicast_ether_addr function (Stanislaw Gruszka) [882300] - [net] etherdevice: introduce eth_broadcast_addr (Stanislaw Gruszka) [882300] - [net] add netdev_features_t (Stanislaw Gruszka) [882300] - [kconfig] Introduce IS_ENABLED(), IS_BUILTIN() and IS_MODULE() (Stanislaw Gruszka) [882300] - [net] netlink: advertise incomplete dumps (Stanislaw Gruszka) [882300] - [net] netlink: add signed types (Stanislaw Gruszka) [882300] - [net] add ETH_P_802_3_MIN (Stanislaw Gruszka) [882300] - [kernel] workqueue: add work_busy() (Stanislaw Gruszka) [882300] - [firmware] Update Broadcom wifi 4313 smac firware to version 610.812 (John Green) [965253] - [wireless] brcmsmac: request firmware in .start() callback (John Green) [757944] - [wireless] Revert: brcmsmac: support 4313iPA (John Green) [757944] - [bcma] init spin lock (John Green) [757944] - [wireless] brcmsmac: Remove unnecessary memset casts (John Green) [757944] - [wireless] brcmsmac: Downgrade d11hdrs_mac80211 error messages to warnings (John Green) [757944] - [wireless] brcmsmac: fix brcms_c_country_valid() (John Green) [757944] - [wireless] brcmsmac: avoid 512 byte stack variable (John Green) [757944] - [wireless] brcmsmac: fix u16 overflow warning (John Green) [757944] - [wireless] brcmsmac: rework of mac80211 .flush() callback operation (John Green) [757944] - [bcma] unregister gpios before unloading bcma (John Green) [757944] - [mtd] bcm47xxsflash: add own struct for abstracting bus type (John Green) [757944] - [bcma] cc: fix (and rename) define of NAND flash type (John Green) [757944] - [bcma] Xflash: reorder includes to make pr_fmt work (John Green) [757944] - [bcma] register platform device for parallel flash (John Green) [757944] - [bcma] fix NAND flash validation (John Green) [757944] - [wireless] brcmsmac: fix tx status processing (John Green) [757944] - [bcma] use consistent case for 'hex' constants (John Green) [757944] - [bcma] add support for 1 and 2 byte extended config space access (John Green) [757944] - [bcma] don't map/unmap a subset of the PCI config space (John Green) [757944] - [bcma] jump to 'out' label for invalid 'func' value (John Green) [757944] - [bcma] update pci configuration for bcm4706/bcm4716 (John Green) [757944] - [bcma] mips: rename oldirqflag to irqinitmask (John Green) [757944] - [bcma] mips: remove assigned_irqs from structure (John Green) [757944] - [bcma] mips: show also disabled IRQs (John Green) [757944] - [bcma] mips: make some info messages debug messages (John Green) [757944] - [bcma] mips: explicit assign IRQ numbers (John Green) [757944] - [bcma] make bcma_find_core_unit() accessible (John Green) [757944] - [wireless] brcmsmac: remove dead code (John Green) [757944] - [wireless] brcmsmac: allow user-space setting of interface address (John Green) [757944] - [wireless] brcmsmac: use perimeter lock in add_interface() callback (John Green) [757944] - [wireless] brcmsmac: increase timer reference count for new timers only (John Green) [757944] - [wireless] brcmsmac: initialize morepending in brcms_b_recv() (John Green) [757944] - [bcma] remove __dev* attributes (John Green) [757944] - [wireless] brcmsmac: add copyright information for Canonical (John Green) [757944] - [bcma] correct M25P32 serial flash ID (John Green) [757944] - [bcma] BCMA_DRIVER_GPIO should depend on GPIOLIB instead of selecting it (John Green) [757944] - [bcma] mips: fix clearing device IRQ (John Green) [757944] - [wireless] brcmsmac: add support for BCM43224 with PCI id of 14e4:a8d8 (John Green) [757944] - [wireless] brcmsmac: do a read after the write of the objmem on broken PCIe controllers (John Green) [757944] - [bcma] unify naming schema for clock functions (John Green) [757944] - [wireless] brcmsmac: add support for cores with revision 17 (John Green) [757944] - [wireless] brcmsmac: fix uninitialized variable warning on arm architecture (John Green) [757944] - [wireless] brcm80211: remove __dev* attributes (John Green) [757944] - [bcma] add methods for watchdog driver (John Green) [757944] - [bcma] set the pmu watchdog if available (John Green) [757944] - [bcma] add bcma_chipco_alp_clock (John Green) [757944] - [wireless] brcmsmac: remove duplicated include from debug.c (John Green) [757944] - [bcma] add common header for watchdog (John Green) [757944] - [wireless] brcmsmac: Fix possible NULL pointer dereference in _dma_ctrlflags() (John Green) [757944] - [wireless] brcmsmac: support 4313iPA (John Green) [757944] - [wireless] brcmsmac: move PHY functions (John Green) [757944] - [wireless] brcmsmac: hardware info in debugfs (John Green) [757944] - [wireless] brcmsmac: fix bounds checking in tx/rx (John Green) [757944] - [wireless] brcmsmac: cleanup in isr code (John Green) [757944] - [wireless] brcmsmac: handle packet drop during transmit correctly (John Green) [757944] - [bcma] handle return value of pci_assign_resource (John Green) [757944] - [bcma] add more package IDs (John Green) [757944] - [wireless] brcmsmac: Add __printf verification to logging prototypes (John Green) [757944] - [bcma] export PLL reading function (John Green) [757944] - [bcma] add GPIO driver (John Green) [757944] - [bcma] add comment to bcma_chipco_gpio_control (John Green) [757944] - [bcma] add bcma_chipco_gpio_pullup and bcma_chipco_gpio_pulldown (John Green) [757944] - [bcma] add locking around GPIO register accesses (John Green) [757944] - [wireless] brcmsmac: Remove stray argument from debug macro (John Green) [757944] - [wireless] brcmsmac: Remove unused wlc_prio2prec_map and _BRCMS_PREC_* constants (John Green) [757944] - [wireless] brcmsmac: Remove some noisy and uninformative debug messages (John Green) [757944] - [wireless] brcmsmac: Add tracepoint for AMPDU session information (John Green) [757944] - [wireless] brcmsmac: Add tracepoint for macintstatus (John Green) [757944] - [wireless] brcmsmac: Improve tx trace and debug support (John Green) [757944] - [wireless] brcmsmac: Add brcms_dbg_ht() debug macro (John Green) [757944] - [wireless] brcmsmac: Add brcms_dbg_dma() debug macro (John Green) [757944] - [wireless] brcmsmac: Add brcms_dbg_int() debug macro (John Green) [757944] - [wireless] brcmsmac: Add rx and tx debug macros (John Green) [757944] - [wireless] brcmsmac: Add brcms_dbg_mac80211() debug macro (John Green) [757944] - [wireless] brcmsmac: Use debug macros for general error and debug statements (John Green) [757944] - [wireless] brcmsmac: Add support for writing debug messages to the trace buffer (John Green) [757944] - [wireless] brcmsmac: Add module parameter for setting the debug level (John Green) [757944] - [wireless] brcm80211: Convert log message levels to debug levels (John Green) [757944] - [wireless] brcm80211: Allow trace support to be enabled separately from debug (John Green) [757944] - [wireless] brcmsmac: Reduce number of entries in tx DMA rings (John Green) [757944] - [wireless] brcmsmac: Use correct descriptor count when calculating next rx descriptor (John Green) [757944] - [wireless] brcmsmac: Remove internal tx queue (John Green) [757944] - [wireless] brcmsmac: Use IEEE 802.11 AC levels for pktq precedence levels (John Green) [757944] - [wireless] brcmsmac: Remove unimplemented flow control functions (John Green) [757944] - [wireless] brcmsmac: Add helper function for updating txavail count (John Green) [757944] - [wireless] brcmsmac: Don't weight AMPDU packets in txfifo (John Green) [757944] - [wireless] brcmsmac: Introduce AMPDU sessions for assembling AMPDUs (John Green) [757944] - [bcma] suspend/resume callbacks should be conditionally compiled on CONFIG_PM_SLEEP (John Green) [757944] - [bcma] do not initialize deactivated PCIe cores (John Green) [757944] - [bcma] add an extra pcie core struct (John Green) [757944] - [bcma] use fallback sprom if sprom on card was not valid (John Green) [757944] - [bcma] add some more flash chips for serial flash (John Green) [757944] - [bcma] extract drv_cc in bcma_core_mips_flash_detect() (John Green) [757944] - [bcma] mark nflash if it is the boot flash (John Green) [757944] - [bcma] add and use constants for the flash windows (John Green) [757944] - [bcma] mark pflash as present when available (John Green) [757944] - [bcma] init sprom struct earlier (John Green) [757944] - [bcma] just do the necessary things in early register on SoCs (John Green) [757944] - [bcma] fix unregistration of cores (John Green) [757944] - [bcma] Convert #include ... to #include in kernel system headers (John Green) [757944] - [mtd] bcm47xxsflash: basic read-only driver for BCMA serial flash (John Green) [757944] - [bcma] change delays to follow timers-howto guide (John Green) [757944] - [bcma] handle BCM43227 (John Green) [757944] - [wireless] brcm80211: Remove bogus memcpy in ai_detach (John Green) [757944] - [wireless] brcmsmac: fix mismatch in number of custom regulatory rules (John Green) [757944] - [bcma] don't leak memory for PCIE, MIPS, GBIT cores (John Green) [757944] - [wireless] brcm80211: set interface down on reset (John Green) [757944] - [bcma] detect and register NAND flash device (John Green) [757944] - [bcma] detect and register serial flash device (John Green) [757944] - [wireless] brcmsmac: document firmware dependencies (John Green) [757944] - [bcma] add (mostly) NAND defines (John Green) [757944] - [bcma] make some functions static (John Green) [757944] - [wireless] brcmsmac: use ieee80211_channel_to_frequency (John Green) [757944] - [bcma] BCM43228 support (John Green) [757944] - [bcma] fix invalid PMU chip control masks (John Green) [757944] - [bcma] add missing iounmap on error path (John Green) [757944] - [bcma] fix regression in interrupt assignment on mips (John Green) [757944] - [bcma] add place for flash memory support (John Green) [757944] - [bcma] cc: update defines (John Green) [757944] - [bcma] add new cores at the end of list (John Green) [757944] - [bcma] add trivial GBIT MAC COMMON driver (John Green) [757944] - [bcma] fix typo reading number of slave wrappers (John Green) [757944] - [bcma] support alternative (BCM4706) ChipCommon core id (John Green) [757944] - [wireless] brcmsmac: restructure info->control.sta handling as it is going to be removed soon (John Green) [757944] - [bcma] add PMU clock support for BCM4706 (John Green) [757944] - [bcma] fix CC driver compilation on MIPS (John Green) [757944] - [wireless] brcmsmac: handle non PCI devices in the phy code (John Green) [757944] - [wireless] brcmsmac: fix read in write_phy_reg (John Green) [757944] - [wireless] brcmsmac: extend brcms_c_chipmatch() to also handle non PCIe devices (John Green) [757944] - [wireless] brcmsmac: fix DMA on SoCs (John Green) [757944] - [wireless] brcmsmac: extend xmtfifo_sz array (John Green) [757944] - [wireless] brcmsmac: add some workarounds for other chips again (John Green) [757944] - [wireless] brcmsmac: add a conditions for core rev 17 again (John Green) [757944] - [wireless] brcmsmac: remove some unnessessacry casts and void pointer (John Green) [757944] - [wireless] brcmsmac: use core id constants from bcma (John Green) [757944] - [wireless] brcmsmac: remove some redundant chip common workarounds (John Green) [757944] - [wireless] brcmsmac: remove si_pmu_spuravoid_pllupdate() (John Green) [757944] - [wireless] brcmsmac: remove si_pmu_init() and si_pmu_res_init() (John Green) [757944] - [wireless] brcmsmac: remove ai_findcore() (John Green) [757944] - [wireless] brcmsmac: use container_of instead of cast (John Green) [757944] - [wireless] brcmsmac: remove ai_get_buscoretype() and ai_get_buscorerev() (John Green) [757944] - [wireless] brcmsmac: remove PCI_FORCEHT() macro (John Green) [757944] - [wireless] brcmsmac: remove PCIE() macro (John Green) [757944] - [bcma] use custom printing functions (John Green) [757944] - [wireless] brcmsmac: fix brcms_c_regd_init() which crashed after 11ad patch (John Green) [757944] - [bcma] add mdelay bcma_pmu_resources_init() (John Green) [757944] - [bcma] add bcma_pmu_spuravoid_pllupdate() (John Green) [757944] - [bcma] remove chip ids doing nothing from PMU initialization (John Green) [757944] - [bcma] remove bcma_pmu_pll_init() and bcma_pmu_swreg_init() (John Green) [757944] - [bcma] complete workaround for BCMA43224 and BCM4313 (John Green) [757944] - [bcma] add PCI ID for BCM43224 (John Green) [757944] - [bcma] remove fix for 4329b0 bad LPOM is detection (John Green) [757944] - [bcma] add constants for chip ids (John Green) [757944] - [bcma] extend workaround for bcm4331 (John Green) [757944] - [bcma] define some additional cores IDs (John Green) [757944] - [wireless] brcmsmac: fix NULL pointer crash in brcms_c_regd_init() (John Green) [757944] - [wireless] brcm80211: use current regulatory domain when checking whether OFDM is allowed (John Green) [757944] - [wireless] brcm80211: don't validate channels against internal regulatory data (John Green) [757944] - [wireless] brcm80211: use mac80211 channel data for tx power limits (John Green) [757944] - [wireless] brcm80211: enable/disable radio on regulatory updates (John Green) [757944] - [wireless] brcm80211: inform mac80211 of the X2 regulatory domain (John Green) [757944] - [wireless] brcm80211: clean up channel.c (John Green) [757944] - [wireless] brcm80211: remove unused code for 40MHz channels (John Green) [757944] - [wireless] brcm80211: always set channel specified by mac80211 (John Green) [757944] - [wireless] brcm80211: don't set up tx power limits during initialization (John Green) [757944] - [wireless] brcmsmac: fix smatch warning found in ampdu.c (John Green) [757944] - [wireless] brcmsmac: remove brcms_set_hint() function (John Green) [757944] - [wireless] brcm80211: fixed checkpatch and sparse warnings (John Green) [757944] - [wireless] brcm80211: Remove casts to same type (John Green) [757944] - [wireless] brcm80211: brcmu_pkt_buf_free_skb() should handle NULL (John Green) [757944] - [wireless] brcm80211: remove an unneeded NULL check (John Green) [757944] - [wireless] brcmsmac: initial backport of brcmsmac wifi driver (John Green) [757944] - [firmware] Add brcmsmac wireless firmware (John Green) [757944]- [netdrv] e1000e: Release mutex lock only if it has been initially acquired (Dean Nelson) [923897] - [netdrv] e1000e: cleanup whitespace (Dean Nelson) [923897] - [netdrv] e1000e: panic caused by Rx traffic arriving while interface going down (Dean Nelson) [923897] - [netdrv] e1000e: prevent multiple calls to e1000e_down() and e1000_free_irq() (Dean Nelson) [923897] - [netdrv] e1000e: fix numeric overflow in phc settime method (Dean Nelson) [923897] - [netdrv] e1000e: Add missing dma_mapping_error-call in e1000_alloc_jumbo_rx_buffers (Dean Nelson) [923897] - [netdrv] e1000e: increase driver version number (Dean Nelson) [923897] - [netdrv] e1000e: cleanup unused defines (Dean Nelson) [923897] - [netdrv] e1000e: add support for LTR on I217/I218 (Dean Nelson) [923897] - [netdrv] e1000e: EEE capability advertisement not set/disabled as required (Dean Nelson) [923897] - [netdrv] e1000e: long access timeouts when I217/I218 MAC and PHY are out of sync (Dean Nelson) [923897] - [netdrv] e1000e: fix LED blink logic for designs with LEDs driven by cathode (Dean Nelson) [923897] - [netdrv] e1000e: slow performance between two 82579 connected via 10Mbit hub (Dean Nelson) [923897] - [netdrv] e1000e: additional error handling on PHY register accesses (Dean Nelson) [923897] - [netdrv] e1000e: workaround DMA unit hang on I218 (Dean Nelson) [923897] - [netdrv] e1000e: cleanup - move defines to appropriate header file (Dean Nelson) [923897] - [netdrv] e1000e: cleanup format of struct e1000_opt_list struct (Dean Nelson) [923897] - [netdrv] e1000e: fix scheduling while atomic bug (Dean Nelson) [923897] - [netdrv] e1000e: fix scheduling while atomic bugs (Dean Nelson) [923897] - [netdrv] e1000e: cleanup USLEEP_RANGE checkpatch checks (Dean Nelson) [923897] - [netdrv] e1000e: cleanup unnecessary line breaks (Dean Nelson) [923897] - [netdrv] e1000e: cleanup formatting of static structs (Dean Nelson) [923897] - [netdrv] e1000e: cleanup unusually placed comments (Dean Nelson) [923897] - [netdrv] e1000e: cleanup (add/remove) blank lines where appropriate (Dean Nelson) [923897] - [netdrv] e1000e: cleanup SPACING checkpatch checks (Dean Nelson) [923897] - [netdrv] e1000e: cleanup LEADING_SPACE checkpatch warnings (Dean Nelson) [923897] - [netdrv] e1000e: cleanup LONG_LINE checkpatch warnings (Dean Nelson) [923897] - [netdrv] e1000e: cleanup SPACING checkpatch errors and warnings (Dean Nelson) [923897] - [netdrv] e1000e: cleanup CODE_INDENT checkpatch errors (Dean Nelson) [923897] - [netdrv] e1000e: display a warning message when SmartSpeed works (Dean Nelson) [923897] - [netdrv] e1000e: cleanup checkpatch braces checks (Dean Nelson) [923897] - [netdrv] e1000e: convert enums of register offsets and move #defines to regs.h (Dean Nelson) [923897] - [netdrv] e1000e: cosmetic move of #defines and prototypes to the new manage.h (Dean Nelson) [923897] - [netdrv] e1000e: cosmetic move of #defines and function prototypes to the new nvm.h (Dean Nelson) [923897] - [netdrv] e1000e: cosmetic move of #defines and function prototypes to the new phy.h (Dean Nelson) [923897] - [netdrv] e1000e: cosmetic move of function prototypes to the new mac.h (Dean Nelson) [923897] - [netdrv] e1000e: cosmetic move of #defines and prototypes to the new ich8lan.h (Dean Nelson) [923897] - [netdrv] e1000e: cosmetic move of #defines to the new 80003es2lan.h (Dean Nelson) [923897] - [netdrv] e1000e: cosmetic move of #defines and prototypes to the new 82571.h (Dean Nelson) [923897] - [netdrv] e1000e: use generic IEEE MII definitions (Dean Nelson) [923897] - [netdrv] e1000e: resolve -Wunused-parameter compile warnings (Dean Nelson) [923897] - [netdrv] e1000e: cleanup some whitespace and indentation issues (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: group OR'ed bit settings with parens (Dean Nelson) [923897] - [netdrv] e1000e: cleanup defines.h (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: remove comments which are no longer applicable (Dean Nelson) [923897] - [netdrv] e1000e: cleanup hw.h (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: remove unused #define (Dean Nelson) [923897] - [netdrv] e1000e: adjust PM QoS request (Dean Nelson) [923897] - [netdrv] e1000e: correct maximum frame size on 82579 (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: remove e1000e_commit_phy() (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: remove e1000_get_cable_length() (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: remove e1000_get_phy_cfg_done() (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: rename e1000_get_cfg_done() (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: remove e1000_force_speed_duplex() (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: remove e1000_set_d0_lplu_state() (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: do not assign a variable a value when not necessary (Dean Nelson) [923897] - [netdrv] e1000e: do not ignore variables which get set a value (Dean Nelson) [923897] - [netdrv] e1000e: cleanup: remove unnecessary function prototypes (Dean Nelson) [923897] - [netdrv] e1000e: remove definition of struct which is no longer used (Dean Nelson) [923897] - [netdrv] e1000e: fix PHY init workarounds for i217/i218 (Dean Nelson) [923897] - [netdrv] e1000e: correct maximum frame size on i217/i218 (Dean Nelson) [923897] - [netdrv] e1000e: update copyright date (Dean Nelson) [923897] - [netdrv] e1000e: remove prototype of non-existent function (Dean Nelson) [923897] - [netdrv] e1000e: prevent hardware from automatically configuring PHY on I217/I218 (Dean Nelson) [923897] - [netdrv] e1000e: enable ECC on I217/I218 to catch packet buffer memory errors (Dean Nelson) [923897] - [netdrv] e1000e: add support for IEEE-1588 PTP (Dean Nelson) [923897] - [netdrv] e1000e: fix flow-control thresholds for jumbo frames on 82579/I217/I218 (Dean Nelson) [923897] - [netdrv] e1000e: fix ethtool offline register test for I217 (Dean Nelson) [923897] - [netdrv] e1000e: add support for hardware timestamping on some devices (Dean Nelson) [923897] - [netdrv] e1000e: add ethtool .get_eee/.set_eee (Dean Nelson) [923897] - [netdrv] e1000e: merge multiple conditional statements into one (Dean Nelson) [923897] - [netdrv] e1000e: cleanup code duplication (Dean Nelson) [923897] - [netdrv] e1000e: cleanup magic number (Dean Nelson) [923897] - [netdrv] e1000e: cleanup unnecessary line wrap (Dean Nelson) [923897] - [netdrv] e1000e: cleanup unusual comment placement (Dean Nelson) [923897] - [netdrv] e1000e: resolve checkpatch PREFER_PR_LEVEL warning (Dean Nelson) [923897] - [netdrv] e1000e: add missing bailout on error (Dean Nelson) [923897] - [netdrv] e1000e: unexpected "Reset adapter" message when cable pulled (Dean Nelson) [923897] - [netdrv] e1000e: fix enabling of EEE on 82579 and I217 (Dean Nelson) [923897] - [netdrv] e1000e: 82577: workaround for link drop issue (Dean Nelson) [923897] - [netdrv] e1000e: helper functions for accessing EMI registers (Dean Nelson) [923897] - [netdrv] e1000e: Invalid Image CSUM bit changed for I217 (Dean Nelson) [923897] - [netdrv] e1000e: Acquire/release semaphore when writing each EEPROM page (Dean Nelson) [923897] - [netdrv] e1000e: SerDes autoneg flow control (Dean Nelson) [923897] - [netdrv] e1000e: cosmetic cleanup of comments (Dean Nelson) [923897] - [netdrv] e1000e: Minimum packet size must be 17 bytes (Dean Nelson) [923897] - [netdrv] e1000e: Change wthresh to 1 to avoid possible Tx stalls (Dean Nelson) [923897] - [netdrv] e1000e: add transmit timestamping support (Dean Nelson) [923897] - [netdrv] e1000e: cleanup e1000_set_phys_id (Dean Nelson) [923897] - [netdrv] e1000e: implement ethtool set_phys_id (Dean Nelson) [923897] - [bluetooth] L2CAP - Fix info leak via getsockname() (Jacob Tanenbaum) [922418] {CVE-2012-6544} - [bluetooth] HCI - Fix info leak in getsockopt() (Jacob Tanenbaum) [922418] {CVE-2012-6544} - [netdrv] igbvf: be sane about random MAC addresses (Stefan Assmann) [870635] - [net] mii: Remove references to DP83840 PHY in mii.h (Nikolay Aleksandrov) [856764] - [kernel] err: add a function to cast error-pointers to a return value (Neil Horman) [856764] - [net] etherdevice: introduce help function eth_zero_addr() (Neil Horman) [856764] - [net] mii: Convert spaces to tabs in mii.h (Nikolay Aleksandrov) [856764] - [netdrv] tg3: Wait for boot code to finish after power on (Ivan Vecera) [915516] - [netdrv] tg3: Add read dma workaround for 5720 (Ivan Vecera) [915516] - [netdrv] tg3: remove redundant pm init code (Ivan Vecera) [915516] - [netdrv] tg3: Remove unnecessary lock around tg3_flag_set (Ivan Vecera) [915516] - [netdrv] tg3: Fix misplaced empty line (Ivan Vecera) [915516] - [netdrv] tg3: Use descriptive label names in tg3_start (Ivan Vecera) [915516] - [netdrv] tg3: Make tg3_rings_reset() more concise (Ivan Vecera) [915516] - [netdrv] tg3: Simplify ring control block setup (Ivan Vecera) [915516] - [netdrv] tg3: Split APE driver state change out of boot reset signature update (Ivan Vecera) [915516] - [netdrv] tg3: Update version to 3.132 (Ivan Vecera) [915516] - [netdrv] tg3: Ensure boot code has completed initialization before accessing hardware (Ivan Vecera) [915516] - [netdrv] tg3: Use module_pci_driver to register driver (Ivan Vecera) [915516] - [netdrv] tg3: Implement set/get_eee handlers (Ivan Vecera) [915516] - [netdrv] tg3: Simplify tg3_phy_eee_config_ok() by reusing tg3_eee_pull_config() (Ivan Vecera) [915516] - [netdrv] tg3: Add tg3_eee_pull_config() function (Ivan Vecera) [915516] - [netdrv] tg3: Add ethtool_eee struct and tg3_setup_eee() (Ivan Vecera) [915516] - [netdrv] tg3: Skip powering down function 0 on certain serdes devices (Ivan Vecera) [915516] - [netdrv] tg3: Fix data corruption on 5725 with TSO (Ivan Vecera) [915516] - [netdrv] tg3: fix to append hardware time stamping flags (Ivan Vecera) [915516] - [netdrv] tg3: shows HW time stamping support only if ptp_capable is present (Ivan Vecera) [915516] - [netdrv] tg3: Use bool not int (Ivan Vecera) [915516] - [netdrv] tg3: Update version to 3.131 (Ivan Vecera) [915516] - [netdrv] tg3: Reset the phy to allow modified EEE settings to take effect (Ivan Vecera) [915516] - [netdrv] tg3: Pull the phy advertised speed and flow control settings on driver load (Ivan Vecera) [915516] - [netdrv] tg3: Add support for link flap avoidance (Ivan Vecera) [915516] - [netdrv] tg3: Add SGMII phy support for 5719/5718 serdes (Ivan Vecera) [915516] - [netdrv] tg3: Add tg3_clear_mac_status() common function (Ivan Vecera) [915516] - [netdrv] tg3: Add a warning during link settings change if mgmt enabled (Ivan Vecera) [915516] - [netdrv] tg3: Remove unnecessary phy reset during ethtool commands (Ivan Vecera) [915516] - [netdrv] tg3: Fix NVRAM size detection for the STM45PE20 pinstrap on 5762 devices (Ivan Vecera) [915516] - [netdrv] tg3: Fix flow control settings not propagated to hardware (Ivan Vecera) [915516] - [netdrv] tg3: fix length overflow in VPD firmware parsing (Ivan Vecera) [915516] - [netdrv] tg3: dma_alloc_coherent, use __GFP_ZERO instead of memset() (Ivan Vecera) [915516] - [netdrv] tg3: 5715 does not link up when autoneg off (Ivan Vecera) [915516] - [netdrv] tg3: Update link_up flag for phylib devices (Ivan Vecera) [915516] - [netdrv] tg3: Download 57766 EEE service patch firmware (Ivan Vecera) [915516] - [netdrv] tg3: Enhance firmware download code to support fragmented firmware (Ivan Vecera) [915516] - [netdrv] tg3: Cleanup firmware parsing code (Ivan Vecera) [915516] - [netdrv] tg3: Refactor the 2nd type of cpu pause (Ivan Vecera) [915516] - [netdrv] tg3: Refactor cpu pause/resume code (Ivan Vecera) [915516] - [netdrv] tg3: Add new FW_TSO flag (Ivan Vecera) [915516] - [netdrv] tg3: Use different macros for pci_chip_rev_id accesses (Ivan Vecera) [915516] - [netdrv] tg3: Remove define and single use of GET_CHIP_REV_ID (Ivan Vecera) [915516] - [netdrv] tg3: Update version to 3.130 (Ivan Vecera) [915516] - [netdrv] tg3: Set initial carrier state to off (Ivan Vecera) [915516] - [netdrv] tg3: Fix 5762 NVRAM sizing (Ivan Vecera) [915516] - [netdrv] tg3: Expand EEE support for all 5717 B0 (Ivan Vecera) [915516] - [netdrv] tg3: Add 57766 device support (Ivan Vecera) [915516] - [netdrv] tg3: add support for Ethernet core in bcm4785 (Ivan Vecera) [915516] - [netdrv] tg3: make it possible to provide phy_id in ioctl (Ivan Vecera) [915516] - [netdrv] tg3: Remove unnecessary alloc/OOM messages, alloc cleanups (Ivan Vecera) [915516] - [netdrv] tg3: missing break statement in tg3_get_5720_nvram_info() (Ivan Vecera) [915516] - [netdrv] tg3: Remove CONFIG_HWMON IS_ENABLED() check (Ivan Vecera) [915516] - [netdrv] tg3: Improve PCI function number detection (Ivan Vecera) [915516] - [netdrv] tg3: Add NVRAM support for 5762 (Ivan Vecera) [915516] - [netdrv] tg3: Add support for new 5762 ASIC (Ivan Vecera) [915516] - [netdrv] tg3: Fix sparse warning: constant 0x7fffffffffffffff is so big it is long long (Ivan Vecera) [915516] - [netdrv] tg3: PTP - Enable the timestamping feature in hardware and fill skb tx/rx timestamps (Ivan Vecera) [915516] - [netdrv] tg3: PTP - Add the hardware timestamp ioctl (Ivan Vecera) [915516] - [netdrv] tg3: PTP - Implement the ptp api and ethtool functions (Ivan Vecera) [915516] - [netdrv] tg3: PTP - Add header definitions, initialization and hw access functions (Ivan Vecera) [915516] - [netdrv] tg3: Fix inconsistent locking for tg3_netif_start() (Ivan Vecera) [915516] - [netdrv] tg3: Use tp->rxq_cnt when checking RSS tables (Ivan Vecera) [915516] - [netdrv] tg3: Cleanup hardcoded ethtool test array indexes (Ivan Vecera) [915516] - [netdrv] tg3: Prevent spurious tx timeout by setting carrier off before tx disable (Ivan Vecera) [915516] - [netdrv] tg3: Set 10_100_ONLY flag for additional 10/100 Mbps devices (Ivan Vecera) [915516] - [netdrv] tg3: Call tg3_netif_stop() from tg3_stop() (Ivan Vecera) [915516] - [netdrv] tg3: Support 5717 C0 (Ivan Vecera) [915516] - [netdrv] tg3: Fix sparse warnings (Ivan Vecera) [915516] - [netdrv] tg3: unconditionally select HWMON support when tg3 is enabled (Ivan Vecera) [915516] - [netdrv] tg3: Disable multiple TX rings by default due to hardware flaw (Ivan Vecera) [915516] - [netdrv] tg3: Add support for ethtool -L|-l to get/set the number of rings (Ivan Vecera) [915516] - [netdrv] tg3: Refactor tg3_close() (Ivan Vecera) [915516] - [netdrv] tg3: Refactor tg3_open() (Ivan Vecera) [915516] - [netdrv] tg3: Separate coalescing setup for rx and tx (Ivan Vecera) [915516] - [netdrv] tg3: Allow number of rx and tx rings to be set independently (Ivan Vecera) [915516] - [netdrv] tg3: Introduce separate functions to allocate/free RX/TX rings (Ivan Vecera) [915516] - [netdrv] tg3: Fix single-vector MSI-X code (Ivan Vecera) [915516] - [netdrv] tg3: Make the RSS indir tbl admin configurable (Ivan Vecera) [915516] - [netdrv] tg3: switch to build_skb() infrastructure (Ivan Vecera) [915516] - [netdrv] tg3: Fix EEE debounce timer values (Ivan Vecera) [915516] - [netdrv] tg3: add skb frag size accessors (Ivan Vecera) [915516] - [netdrv] tg3: use DMA_x_DEVICE and dma_mapping_error with skb_frag_dma_map (Ivan Vecera) [915516] - [netdrv] tg3: convert to SKB paged frag API (Ivan Vecera) [915516] - [netdrv] tg3: Reorg tg3_napi members (Ivan Vecera) [915516] - [netdrv] tg3: Fix MII_TG3_DSP_EXP8 offset (Ivan Vecera) [915516] - [netdrv] tg3: Remove tg3_config_info definition (Ivan Vecera) [915516] - [netdrv] tg3: Set real_num_rx_queues for non-multiq devs (Ivan Vecera) [915516] - [netdrv] tg3: Use netif_set_real_num_rx_queues() and netif_set_real_num_tx_queues() (Ivan Vecera) [915516] - [netdrv] tg3: use the DMA state API instead of the pci equivalents (Ivan Vecera) [915516] - [netdrv] tg3: Avoid null pointer dereference in tg3_interrupt in netconsole mode (Ivan Vecera) [887908] - [netdrv] virtio_net: introduce a new control to set macaddr (Amos Kong) [904924] - [net] split eth_mac_addr for better error handling (Amos Kong) [904924] - [netdrv] virtio_net: move virtnet_send_command() above virtnet_set_mac_address() (Amos Kong) [904924] - [netdrv] virtio_net: use IFF_LIVE_ADDR_CHANGE priv_flag (Amos Kong) [904924] - [net] eth: reset addr_assign_type if eth_mac_addr() called (Amos Kong) [904924] - [net] set IFF_LIVE_ADDR_CHANGE to ext_priv_flags (Amos Kong) [904924] - [net] ipvs: fix CHECKSUM_PARTIAL for TCP, UDP (Thomas Graf) [973122] - [net] ethtool: allow enable GRO even if RX csum is disabled (Ivan Vecera) [962460] - [net] bonding: enable gro by default (Ivan Vecera) [962460] - [net] bridge: fix some kernel warning in multicast timer (Amerigo Wang) [952012] - [net] sctp: confirm route during forward progress (Daniel Borkmann) [980053] - [net] bridge: Provide VLAN registration and GRO acceleration for ports (Nikolay Aleksandrov) [858198]- [netdrv] macvtap: Perform GSO on forwarding path (Vlad Yasevich) [885662] - [netdrv] macvtap: Let TUNSETOFFLOAD actually controll offload features (Vlad Yasevich) [885662] - [netdrv] macvtap: Consistently use rcu functions (Vlad Yasevich) [885662] - [netdrv] macvtap: Convert to using rtnl lock (Vlad Yasevich) [885662] - [powerpc] power8: Fix oprofile and perf (Steve Best) [929283] - [powerpc] POWER8 cputable entry (Steve Best) [929283] - [netdrv] sfc: Fix memory leak when discarding scattered packets (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Remove write permission from phy_type attribute (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix IRQ cleanup in case of a probe failure (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Do not pass non-TCP packets into GRO code (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Define and set RX buffer flag for packets parsed as TCP (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Enable accelerated RFS on vlans (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Report software timestamping capabilities (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Increase size of RX SKB header area (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Enable RX checksum offload for packets not handled by GRO (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix EEH with legacy interrupts (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Store port number in private data, not net_device::dev_id (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Reduce RX scatter buffer size, and reduce alignment if appropriate (Nikolay Aleksandrov) [953929] - [netdrv] sfc: fix return value check in efx_ptp_probe_channel() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix naming of MTD partitions for FPGA bitfiles (Nikolay Aleksandrov) [953929] - [netdrv] sfc: make local functions static (Nikolay Aleksandrov) [953929] - [netdrv] sfc: pass __GFP_ZERO to dma_alloc_coherent() instead of using memset (Nikolay Aleksandrov) [953929] - [netdrv] sfc: remove duplicated include from efx.c (Nikolay Aleksandrov) [953929] - [netdrv] sfc: allocate more RX buffers per page (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Replace efx_rx_is_last_buffer() with a flag (Nikolay Aleksandrov) [953929] - [netdrv] sfc: reuse pages to avoid DMA mapping/unmapping costs (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Enable RX DMA scattering where possible (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Update RX buffer address together with length (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Explicitly prefetch RX hash prefix, not just Ethernet heade (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Replace efx_rx_buf_eh() with simpler efx_rx_buf_va() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Wrap __efx_rx_packet() with efx_rx_flush_packet() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Make RX queue descriptor counts unsigned for consistency (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Properly distinguish RX buffer and DMA lengths (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Document current usage of efx_rx_buffer::len and efx_nic::rx_buffer_len (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Add AER and EEH support for Siena (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Disable RSS when using SR-IOV and only 1 RX queue on the PF (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix replacement detection in efx_filter_insert_filter() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Merge efx_filter_search() into efx_filter_insert() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Don't use efx_filter_ functions for default MAC filters (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Remove redundant parameter to efx_filter_search() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: More sensible semantics for efx_filter_insert_filter() replace flag (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Remove rx_alloc_method SKB (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix Kconfig typo (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Only use TX push if a single descriptor is to be written (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Correct efx_rx_buffer::page_offset when EFX_PAGE_IP_ALIGN != 0 (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Disable soft interrupt handling during efx_device_detach_sync() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Detach net device when stopping queues for reconfiguration (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix efx_rx_buf_offset() in the presence of swiotlb (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Properly sync RX DMA buffer when it is not the last in the page (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Make module parameters really boolean (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix timekeeping in efx_mcdi_poll() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: lock TX queues when calling netif_device_detach() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Work-around flush timeout when flushes have completed (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Reset driver's MAC stats after MC reboot seen (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Do not initialise buffer in efx_alloc_special_buffer() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Correctly initialise reset_method in siena_test_chip() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Remove confusing MMIO functions (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix check for failure of MC_CMD_FLUSH_RX_QUEUES (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Delete redundant page_addr variable from efx_init_rx_buffers_page() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Really disable flow control while flushing (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix byte order warning in self-test (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix byte order warnings for ethtool RX filter interface (Nikolay Aleksandrov) [953929] - [netdrv] sfc: use standard _bit_le() functions (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix loopback self-test with separate_tx_channels=1 (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix MCDI structure field lookup (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Add parentheses around use of bitfield macro arguments (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Avoid generating over-length MC_CMD_FLUSH_RX_QUEUES request (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Bump version to 3.2 (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Support variable-length response to MCDI GET_BOARD_CFG (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Convert firmware subtypes to native byte order in efx_mcdi_get_board_cfg() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix reporting of IPv4 full filters through ethtool (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Assign efx and efx->type as early as possible in efx_pci_probe() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Remove bogus comment about MTU change and RX buffer overrun (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Remove overly paranoid locking assertions from netdev operations (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix reset vs probe/remove/PM races involving efx_nic::state (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Improve log messages in case we abort probe due to a pending reset (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Never try to stop and start a NIC that is disabled (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Hold RTNL lock only when calling efx_stop_interrupts() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Keep disabled NICs quiescent during suspend/resume (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Hold the RTNL lock for more of the suspend/resume cycle (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Change state names to be clearer, and comment them (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Stash header offsets for TSO in struct tso_state (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Replace tso_state::full_packet_space with ip_base_len (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Simplify TSO header buffer allocation (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Stop TX queues before they fill up (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Refactor struct efx_tx_buffer to use a flags field (Nikolay Aleksandrov) [953929] - [netdrv] sfc: initialize dynamic sysfs attributes for lockdep (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Correct some comments on enum reset_type (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix interface statistics running backward (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Disable VF queues during register self-test (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Explain why efx_mcdi_exit_assertion() ignores result of efx_mcdi_rpc() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Use dev_kfree_skb() in efx_end_loopback() (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Use strlcpy() to copy ethtool stats names (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Stop changing header offsets on TX (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Remove dead write to tso_state::packet_space (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Use generic DMA API, not PCI-DMA API (Nikolay Aleksandrov) [953929] - [netdrv] Fix non-kernel-doc comments with kernel-doc start markers (Nikolay Aleksandrov) [953929] - [netdrv] Fix kernel-doc comments for various functions (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Implement module EEPROM access for SFE4002 and SFN4112F (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Added support for new ethtool APIs for obtaining module eeprom (Nikolay Aleksandrov) [953929] - [netdrv] sfc: Fix mapping of reset reasons and flags to methods (Nikolay Aleksandrov) [953929]- [mm] transparent hugepage core changes related to MADV_HUGEPAGE/MADV_NOHUGEPAGE (Larry Woodman) [891857] - [mm] thp: define MADV_NOHUGEPAGE (Larry Woodman) [891857] - [mm] thp: define MADV_HUGEPAGE (Larry Woodman) [891857] - [mm] thp: Add madvise MADV_NOHUGEPAGE (Larry Woodman) [891857] - [mm] thp: Add madvise MADV_HUGEPAGE (Larry Woodman) [891857] - [net] tuntap: initialize vlan_features (Vlad Yasevich) [951458] - [net] netlink_dump: fix locking regression in error path (Daniel Borkmann) [982108] - [net] ip6_fib: Various cleanups (Jiri Pirko) [958215] - [net] ip6_fib: return errno pointers consistently for fib6_add_1() (Jiri Pirko) [958215] - [net] ip6_fib: fix return value check in fib6_add() (Jiri Pirko) [958215] - [net] ip6_fib/ip6_route: Standardize prefixes for message logging (Jiri Pirko) [958215] - [net] ip6_fib: Use pr_warn() (Jiri Pirko) [958215] - [net] ip6_fib: Fix a crash when trying to replace non existing route (Jiri Pirko) [958215] - [net] ip6_fib: Removing unnecessary NULL checks (Jiri Pirko) [958215] - [net] ip6_fib: add NLM_F_* flag support for route (Jiri Pirko) [958215] - [net] ip6_route: Various cleanups (Jiri Pirko) [958215] - [net] ip6_route: add support for NLM_F_* flags (Jiri Pirko) [958215] - [net] af_key: fix info leaks in notify messages (Jiri Benc) [981004] {CVE-2013-2234} - [net] af_key: initialize satype in key_notify_policy_flush() (Thomas Graf) [981227] {CVE-2013-2237} - [net] ipv4: ipmr_expire_timer causes crash when removing net namespace (Amerigo Wang) [972573] - [net] ipv6: ip6_sk_dst_check() must not assume ipv6 dst (Jiri Pirko) [981559] {CVE-2013-2232} - [net] ipv6: remove old token ipv6 address as soon as possible (Daniel Borkmann) [876634] - [net] ipv6: check return value of ipv6_get_lladdr (Daniel Borkmann) [876634] - [net] ipv6: don't call addrconf_dst_alloc again when enable lo (Jiri Benc) [744655] - [net] rps: Ensure that an expired hardware filter can be re-added later (Daniel Borkmann) [893177] - [crypto] algboss: Hold ref count on larval (Daniel Borkmann) [889992] - [net] sctp: fix NULL pointer dereference in socket destruction (Daniel Borkmann) [889992] - [net] Use separate workqueue for linkwatch events (Jan Vesely) [783615]- [x86] Revert: Allow greater than 1TB of RAM on AMD x86_64 sytems (Larry Woodman) [970735] - [x86] Revert: Prevent panic in init_memory_mapping() when booting more than 1TB on AMD systems (Larry Woodman) [970735] - [scsi] megaraid_sas: Changelog and driver version update (Tomas Henzl) [949084] - [scsi] megaraid_sas: Add support to differentiate between iMR vs MR Firmware (Tomas Henzl) [949084] - [scsi] megaraid_sas: Add support for Uneven Span PRL11 (Tomas Henzl) [949084] - [scsi] megaraid_sas: Add support for Extended MSI-x vectors for 12Gb/s controller (Tomas Henzl) [949084] - [scsi] megaraid_sas: Set IoFlags to enable Fast Path for JBODs for 12 Gb/s controllers (Tomas Henzl) [949084] - [scsi] megaraid_sas: Add support to display Customer branding details in syslog (Tomas Henzl) [949084] - [scsi] megaraid_sas: Add support for MegaRAID Fury (device ID-0x005f) 12Gb/s controllers (Tomas Henzl) [949084] - [scsi] megaraid_sas: Set IO request timeout value provided by OS timeout for Tape devices (Tomas Henzl) [949084] - [scsi] megaraid_sas: Free event detail memory without device ID check (Tomas Henzl) [949084] - [scsi] megaraid_sas: Update balance count in driver to be in sync of firmware (Tomas Henzl) [949084] - [scsi] megaraid_sas: Fix the interrupt mask for Gen2 controller (Tomas Henzl) [949084] - [scsi] megaraid_sas: Return DID_ERROR for SCSI IO, when controller is in critical h/w error (Tomas Henzl) [949084] - [scsi] megaraid_sas: Version and Changelog update (Tomas Henzl) [949084] - [scsi] megaraid_sas: Dont load DevHandle unless FastPath enabled (Tomas Henzl) [949084] - [scsi] megaraid_sas: Add 4k FastPath DIF support (Tomas Henzl) [949084] - [scsi] mpt2sas: Bump driver vesion to v15.100.00.00 (Tomas Henzl) [947078] - [scsi] mpt2sas: fix for unused variable 'event_data' warning (Tomas Henzl) [947078] - [scsi] mpt2sas: Fix for device scan following host reset could get stuck in a infinite loop (Tomas Henzl) [947078] - [scsi] mpt2sas: Fix for issue Missing delay not getting set during system bootup (Tomas Henzl) [947078] - [scsi] mpt2sas: MPI2 Rev W (2.00.15) specification (Tomas Henzl) [947078] - [scsi] mpt2sas: Calulate the Reply post queue depth calculation as per the MPI spec (Tomas Henzl) [947078] - [scsi] mpt2sas: fix firmware failure with wrong task attribute (Tomas Henzl) [947078] - [scsi] mpt2sas: Update the timing requirements for issuing a Hard Reset (Tomas Henzl) [947078] - [scsi] mpt2sas: update version string to 14.101.00.01 (Tomas Henzl) [947078] - [scsi] mpt2sas: Add support for OEM specific controller (Tomas Henzl) [947078] - [scsi] mpt2sas: Add a module parameter that permits overriding protection capabilities (Tomas Henzl) [947078] - [scsi] mpt2sas: Return the correct sense key for DIF errors (Tomas Henzl) [947078] - [scsi] mpt2sas: fix double mutex lock in NON_BLOCKING state (Tomas Henzl) [947078] - [scsi] mpt2sas: Fix for issue - Unable to boot from the drive connected to HBA (Tomas Henzl) [947078] - [scsi] mpt2sas: Fix for With post diag reset same set of device gets added, removed and then again gets added with new target ids (Tomas Henzl) [947078] - [scsi] mpt2sas: Fix for staged device discovery functionality of driver not working (Tomas Henzl) [947078] - [scsi] mpt2sas : MPI 2.0 Rev V(2.0.14) specification (Tomas Henzl) [947078] - [scsi] mpt2sas: minor fix to follow upstream (Tomas Henzl) [947078] - [scsi] mpt2sas: Provide sysfs attribute to report Backup Rail Monitor Status (Tomas Henzl) [947078] - [scsi] mpt2sas: To include more Intel Branding (Tomas Henzl) [947078] - [scsi] mpt2sas: 2012 source code copyright (Tomas Henzl) [947078] - [scsi] mpt2sas: Fix for Driver oops, when loading driver with max_queue_depth command line option to a very small value (Tomas Henzl) [947078] - [scsi] mpt2sas: Fix unsafe using smp_processor_id() in preemptible (Tomas Henzl) [947078] - [scsi] mpt2sas: move the